ID: 963226280

View in Genome Browser
Species Human (GRCh38)
Location 3:142865614-142865636
Sequence AAACAACATCCTGTGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963226278_963226280 3 Left 963226278 3:142865588-142865610 CCATAATTTCTACAGAATATAAA 0: 1
1: 0
2: 7
3: 63
4: 739
Right 963226280 3:142865614-142865636 AAACAACATCCTGTGAAGGATGG 0: 1
1: 0
2: 2
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963226280 Original CRISPR AAACAACATCCTGTGAAGGA TGG Intronic
902043448 1:13508980-13509002 AGATAACATCCTGTCTAGGAAGG - Intronic
902190301 1:14758178-14758200 AAGCAAGAGCCTGTCAAGGAAGG - Intronic
902706064 1:18205545-18205567 AAACAACCCATTGTGAAGGAGGG + Intronic
903709010 1:25308041-25308063 AAAAAAAAGCCAGTGAAGGAAGG + Intronic
903718106 1:25384378-25384400 AAAAAAAAGCCAGTGAAGGAAGG - Intronic
904578298 1:31520678-31520700 GAACAACATTATGTGGAGGAAGG + Intergenic
905509638 1:38508651-38508673 AAACAGCATCCTGTGCTGTAAGG - Intergenic
905665280 1:39759985-39760007 ACACCACACCCTGTGATGGATGG + Exonic
906283768 1:44572065-44572087 ATAAAACATCCTGTAGAGGAAGG - Intronic
908148216 1:61270245-61270267 ACACAACATCCTGTTAAGTTAGG + Intronic
908590349 1:65625579-65625601 AAACTACATGTTGTGAAAGAAGG + Intronic
912238978 1:107885120-107885142 AAACAGCTCCCTGTGAAGCAGGG + Intronic
912504067 1:110143607-110143629 ACTCAACACCCTGTGAGGGAGGG + Intergenic
913029843 1:114890634-114890656 ACAAAACATCATGTGTAGGAAGG + Intronic
914464389 1:147913164-147913186 CTATAACATCTTGTGAAGGAGGG - Intergenic
917954918 1:180085145-180085167 AAACACCATTCTGTGAAATAAGG - Intronic
917964147 1:180167957-180167979 AAATATCAGCCTGTGAATGATGG - Intronic
919800538 1:201351401-201351423 AAACAACTTGGTGTGATGGATGG - Intergenic
922852678 1:228747343-228747365 CAAGGTCATCCTGTGAAGGATGG + Intergenic
923272613 1:232371605-232371627 AACCAACATTTTGTGAAGAAAGG + Intergenic
923791123 1:237112078-237112100 CAAAAACATCCAGTGATGGAGGG - Intronic
1069017150 10:63443277-63443299 AAACAAAACCCTGTAAATGATGG - Intronic
1069348120 10:67493984-67494006 ATACAACTTCCTATAAAGGAAGG + Intronic
1069816056 10:71195201-71195223 AAACCAGCTCCTCTGAAGGAGGG + Intergenic
1071026311 10:81117948-81117970 ATGCAACAACCTGTGAGGGAAGG - Intergenic
1071246390 10:83769569-83769591 AAACAGAATCCTGTGAACAATGG - Intergenic
1073118979 10:101109838-101109860 AAACAATGCCCAGTGAAGGATGG - Intronic
1073517853 10:104094173-104094195 AAAAAAAATCCTGTGAATGCAGG - Intergenic
1079291620 11:19193316-19193338 AAACGACATGATGTGCAGGAAGG + Intronic
1080419559 11:32097840-32097862 AAACAAGATCGGGAGAAGGAAGG + Intronic
1083482793 11:62960490-62960512 AAGTACCTTCCTGTGAAGGAGGG + Intronic
1085569743 11:77549067-77549089 AAACAACATGCTTTCAAGAAAGG - Intronic
1086471270 11:87114449-87114471 AAACAACAAGCTGTATAGGAAGG + Intronic
1087193508 11:95281605-95281627 AAACAAAATTCTGAGAAAGATGG + Intergenic
1088130259 11:106480234-106480256 AAACAAAATCCTGTGAAGTAAGG + Intergenic
1088482054 11:110303641-110303663 AGAGAACATCATGTGGAGGAAGG + Intergenic
1090858950 11:130636008-130636030 AAACAGCTCCCTGTCAAGGAAGG + Intergenic
1093199138 12:16166016-16166038 AAACTACTTCCTGGGAATGAAGG + Intergenic
1094363786 12:29658868-29658890 CAACAACATATTCTGAAGGAAGG + Intronic
1097951770 12:65437890-65437912 AAACAACATCTAGTGAAAAAGGG - Intronic
1098442399 12:70532654-70532676 GAGCAAGACCCTGTGAAGGACGG - Intronic
1098842789 12:75496555-75496577 AAAAAACATACTGGGATGGAAGG - Exonic
1099975988 12:89545929-89545951 AGACAACATCTTGTGAAGTTGGG - Intergenic
1101861554 12:108486402-108486424 AAACAAAATCCTATGAAAGGCGG - Intergenic
1102921310 12:116793637-116793659 GAACAAAAGCCTGAGAAGGAAGG - Intronic
1103186680 12:118964124-118964146 AGTCAATATCCTGAGAAGGATGG + Intergenic
1105729551 13:23199133-23199155 CACCAACATACTTTGAAGGATGG + Intronic
1109253037 13:60044016-60044038 AAAAAAAATGCTGTGATGGAGGG + Intronic
1109392809 13:61715021-61715043 AAACAACATTCAGAGAAAGAAGG - Intergenic
1109908267 13:68874540-68874562 AAGCACCATCCTGTTAGGGAGGG + Intergenic
1110113357 13:71779984-71780006 CAAAAACATCCTATGAAGGAAGG + Intronic
1110134316 13:72046489-72046511 TAACAAAACCTTGTGAAGGAAGG - Intergenic
1112296324 13:98190337-98190359 AAACAACAGCCTGAGAAAAAGGG - Intronic
1112495324 13:99899371-99899393 GAACAACATCCAGGAAAGGAAGG - Intergenic
1117255217 14:53970364-53970386 AAGCACAAACCTGTGAAGGAAGG - Intergenic
1117804111 14:59472477-59472499 GCACAACAGCCTGGGAAGGATGG - Intronic
1118192183 14:63590838-63590860 CAACAACATCCAGTGGAAGAGGG - Intergenic
1118562341 14:67099610-67099632 ATACAACATCCTGTGACAGAAGG + Intronic
1118779825 14:69000253-69000275 AAACAAGCTCCTTTGAAGGCAGG - Intergenic
1119610729 14:76059644-76059666 AAAGAACATCCAGTGAGAGAGGG - Intronic
1120554354 14:85910685-85910707 AAACATAGTCCTGTGAAGAAGGG + Intergenic
1120704241 14:87730765-87730787 AAAAAAAAATCTGTGAAGGAAGG + Intergenic
1125032182 15:35084102-35084124 AAGAAAAATCCTATGAAGGATGG + Intergenic
1125783144 15:42289625-42289647 AAGCAACAGCCTCTCAAGGATGG + Intronic
1129675368 15:77630409-77630431 AAACAACCTCTTGTGGAGGTGGG - Intronic
1130822027 15:87506036-87506058 AAACAGCATCATGACAAGGATGG + Intergenic
1131589372 15:93731646-93731668 GAACAACAGCCTGTGACAGAAGG - Intergenic
1133500950 16:6365963-6365985 AAAAAACACCCAGAGAAGGAGGG - Intronic
1134607845 16:15585073-15585095 CATTAACATCCTGTGAAAGATGG + Intronic
1138190203 16:55008579-55008601 ATCCAACATCCTGTGTAGAATGG - Intergenic
1139337763 16:66245128-66245150 AAACAACAACCTGAAAAGGTTGG + Intergenic
1140193365 16:72836940-72836962 AAATGACATCCTGAGAAGGTGGG - Intronic
1140261393 16:73383441-73383463 AAAAAACATCCTGGACAGGAGGG + Intergenic
1141436459 16:84002452-84002474 AAACACCTTCTTGTGGAGGATGG - Exonic
1141795588 16:86271475-86271497 ACACACCATGCTGTGTAGGAAGG - Intergenic
1142684243 17:1568486-1568508 AAAAAACATTCTTTGAAGGCTGG - Intergenic
1143197364 17:5086311-5086333 AACCAACATCCTGTGGATAACGG + Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1144991944 17:19238814-19238836 AGAAAATATCCTGTGAAAGAAGG + Intronic
1146449386 17:32960494-32960516 AAACTACATTCTGTGAAGCTGGG - Intergenic
1146611973 17:34314216-34314238 AAACAACGGTCTGTGAATGAAGG - Intergenic
1150697958 17:67422112-67422134 AAACCACATCATCTGAAAGAAGG + Intronic
1151070372 17:71203519-71203541 AAAGACCATCCTGAGAAAGATGG + Intergenic
1152577884 17:81150844-81150866 AAACAGGATCCCGTGCAGGAAGG + Intronic
1152907893 17:82979584-82979606 AAACTACAACATGTGAATGAAGG + Intronic
1153183662 18:2463944-2463966 ACATAACATCCAGTGAAGAAGGG + Intergenic
1153481465 18:5551426-5551448 AAAAAACATCCGCTGAAGGCTGG + Intronic
1154021368 18:10666700-10666722 AAAGAACATCCTGGGACGGAAGG + Intronic
1154138934 18:11805992-11806014 AAATAACATGCTGGGGAGGATGG - Intronic
1155731920 18:29171036-29171058 AAAATACTTACTGTGAAGGATGG - Intergenic
1157059624 18:44272809-44272831 AAAAAAAATCCTGTGAAATATGG + Intergenic
1158877190 18:61744743-61744765 GAAGACCATCCTGTGAGGGAGGG - Intergenic
1160551943 18:79699067-79699089 AAACAAACTCCTGTGCAGCACGG - Intronic
1162681599 19:12347682-12347704 AAACAAAATTCTGTTAGGGAGGG - Intergenic
1163031476 19:14547067-14547089 TAATAAGATCCTATGAAGGAGGG + Intronic
1165099585 19:33431093-33431115 GAGCAAGATCCTATGAAGGAAGG + Intronic
1165718476 19:38062448-38062470 ACACAGCATCCTGAGGAGGAAGG - Intronic
1167873885 19:52395815-52395837 AAGCAACATCCTGAGAGGAAGGG - Intergenic
1168677172 19:58286944-58286966 AAAGGACATGCTGAGAAGGATGG - Intronic
925380670 2:3423442-3423464 AAACAAAATCCAGTGACGCAAGG - Intronic
926929870 2:18026542-18026564 GAAAAACAGCCTGTGCAGGAAGG - Intronic
927162735 2:20283747-20283769 AAACTACAGGCTATGAAGGAAGG + Intronic
929091263 2:38219384-38219406 AAACAAAATTATATGAAGGAAGG + Intergenic
929251101 2:39756523-39756545 AAAATACAAGCTGTGAAGGAGGG + Intronic
931623141 2:64231062-64231084 GAACACCATCCTTTAAAGGAAGG + Intergenic
931722032 2:65073637-65073659 ACACAACATCCTAAGAAGGCAGG - Intronic
933856897 2:86423178-86423200 AAAAAACATCATGAGAAGGCAGG + Intergenic
936470850 2:112797568-112797590 AAGCAACATCATGAGTAGGAAGG + Intergenic
936678856 2:114747664-114747686 AAAGAACAAACTGTGAAGAATGG - Intronic
936959886 2:118061833-118061855 AAACAACATGGTGTAATGGAAGG + Intergenic
937190416 2:120091599-120091621 GATCAACATCCTTTGAAAGAAGG + Exonic
937678781 2:124621804-124621826 TAACAACATCCTAAGAAGGCTGG - Intronic
937753833 2:125512151-125512173 AAACAACATCTTAAGAAGTAAGG + Intergenic
938717476 2:134034081-134034103 GAAAAACATCCTAAGAAGGAAGG - Intergenic
940011123 2:149056672-149056694 ATACAACATCCTCTGTAGGGAGG + Intronic
941834445 2:170000830-170000852 AAAAAAGATCCTTAGAAGGAAGG + Intronic
942124841 2:172813456-172813478 AAACAGCATCCGATGAAGTACGG - Intronic
942377692 2:175354171-175354193 AAAGAAAATCCTATGAAGGAGGG - Intergenic
944840070 2:203616199-203616221 AAACCACATGCTGAGAACGAAGG + Intergenic
945300309 2:208209794-208209816 AAACTAGATCCTGAGCAGGAAGG - Intergenic
947548724 2:231031257-231031279 ACACAACATTCTGTGAAGCAAGG + Intergenic
947823655 2:233089769-233089791 ACCGAACATCCTATGAAGGAGGG - Intronic
1169482573 20:5997994-5998016 AAACACCACCCTGTGATTGATGG + Intergenic
1169995475 20:11551362-11551384 AAGCAGCATTCTCTGAAGGACGG + Intergenic
1171325109 20:24284268-24284290 AAACAATATCAGATGAAGGAAGG + Intergenic
1171357965 20:24565233-24565255 AAACAAGAATATGTGAAGGAAGG + Intronic
1175086384 20:56462642-56462664 AAACAACATCCTTTAAAAGATGG + Intergenic
1177227804 21:18280278-18280300 AAACTTCATCCTATGAAGGCCGG + Intronic
1180121244 21:45749865-45749887 AGACCACATCCTGTGCTGGAGGG - Intronic
1180152436 21:45957197-45957219 AAACAACACCCTTGGAAAGATGG - Intergenic
1181612611 22:24028488-24028510 AAAGGTCATCCTGTGAATGATGG + Intronic
1181904434 22:26182817-26182839 AAACAACAGCCAGAGAATGATGG - Intronic
1183752045 22:39726699-39726721 TAACAACATCCTGGGCAGAAAGG - Intergenic
1183930507 22:41233523-41233545 ACACAACATCACGTGAAGGTTGG + Intronic
1184948784 22:47824153-47824175 AATTAAAATCCTGTTAAGGAGGG + Intergenic
949374864 3:3377790-3377812 AAACAACTTGCTGTGAAAGAAGG - Intergenic
949756263 3:7414269-7414291 AAACAAGATACTGTGGGGGAAGG + Intronic
952085448 3:29815004-29815026 AAAAGACATCCTGAGGAGGAGGG + Intronic
954412797 3:50378324-50378346 AAATAGTAGCCTGTGAAGGAAGG + Exonic
955112635 3:55964186-55964208 AAACAACATCCTTACATGGAGGG + Intronic
955485614 3:59431691-59431713 AAACAACATCCAGAGGAAGAAGG + Intergenic
955511290 3:59682951-59682973 AAAAACCATCTTGTGAAGGAAGG - Intergenic
956852605 3:73244492-73244514 TAACAACATACTATGAAGGAAGG - Intergenic
957000680 3:74880227-74880249 AAAAATTATCCTGTGAAAGATGG - Intergenic
957941752 3:87014767-87014789 ATACTACATACTCTGAAGGAGGG - Intergenic
958114820 3:89202077-89202099 AAAGATTATCATGTGAAGGAAGG - Intronic
959189335 3:103090405-103090427 CAACAACATACTTTGAAGAAAGG - Intergenic
959767062 3:110044149-110044171 ATTCAACATTCTATGAAGGAAGG - Intergenic
961373361 3:126446238-126446260 AAGCAACCTCCTGGGAAGCAAGG + Intronic
962108184 3:132415459-132415481 AAACTACATCTTGTGAACAATGG + Intergenic
962556537 3:136557991-136558013 ATACATTATCCTTTGAAGGAAGG - Intronic
963124497 3:141802688-141802710 AAACATCATCCTGTGGGGTATGG + Intronic
963226280 3:142865614-142865636 AAACAACATCCTGTGAAGGATGG + Intronic
963482663 3:145896037-145896059 CAACATGATCCTGTTAAGGAAGG - Intergenic
964653429 3:159038788-159038810 AAAAAAAGTCCTGGGAAGGAAGG - Intronic
966825973 3:183965393-183965415 AGACAACATCCTGTTTGGGAAGG - Exonic
967868042 3:194206380-194206402 AAACTGCATCCAGTGAAGCATGG + Intergenic
970890526 4:21038930-21038952 AAAAAGCATCCTGTGAAGGCTGG + Intronic
970929888 4:21497178-21497200 AAAGAGCATCCTCTGGAGGAGGG + Intronic
973883077 4:55293181-55293203 AAATAACACCTGGTGAAGGATGG + Intergenic
974343220 4:60640971-60640993 AAACAATCACCTGTAAAGGAAGG - Intergenic
974667770 4:64987288-64987310 CAAATACATCCTGTGAAGGTAGG + Intergenic
976046177 4:80950628-80950650 AAACATGAGGCTGTGAAGGAAGG + Intronic
976885072 4:89971800-89971822 AAACAACATTCTTTAAATGATGG - Intergenic
977241540 4:94576120-94576142 AACCAACTTTCTTTGAAGGAAGG + Intronic
977575785 4:98672897-98672919 AGACAACACCCTGTGAAGGAAGG + Intergenic
979940135 4:126752056-126752078 AATCAGAATCCTGTCAAGGACGG - Intergenic
980268627 4:130553962-130553984 ATAGGACATCCTGTGAAGAAAGG + Intergenic
982726433 4:158911143-158911165 AAACAACCCTCTGAGAAGGAAGG + Intronic
986258454 5:6121834-6121856 AAACAACATTTTGGGTAGGATGG + Intergenic
989150800 5:38298014-38298036 AAAGAACATCCTGGGAAGAGCGG + Intronic
990934445 5:61132667-61132689 AAATAACATTATGGGAAGGAAGG - Intronic
991251692 5:64569203-64569225 AAACAACATGCTGTGAAGAGAGG + Intronic
993706247 5:91174434-91174456 AATCTAAATCCTGTGAAGAATGG - Intergenic
994046609 5:95317426-95317448 AACCAACTACCAGTGAAGGATGG - Intergenic
1000978243 5:167788227-167788249 CAAAAAAATCCTATGAAGGAGGG - Intronic
1001194725 5:169662395-169662417 AAACAAAAACCTGTGAATTAGGG - Intronic
1002414394 5:179111878-179111900 AAACCACATCTTCTTAAGGAAGG + Exonic
1003122954 6:3333192-3333214 AAACAGTATACAGTGAAGGATGG - Intronic
1004422409 6:15483174-15483196 AAACAACATCCTATGAAAAAGGG + Intronic
1004982738 6:21044760-21044782 AAACAACCTTCTGAGAAGGAAGG - Intronic
1007503164 6:42313998-42314020 AAACAAGATCCTGGGAAACAGGG + Intronic
1008319208 6:50086645-50086667 AAATAATAGCCTCTGAAGGAAGG - Intergenic
1008936235 6:56995635-56995657 CAAGAACATCCTGTGAAGATTGG - Intronic
1010020982 6:71159551-71159573 AAACAACATGGTGTTCAGGAAGG - Intergenic
1010210318 6:73357802-73357824 ATTCAACATGCTGTGGAGGAGGG - Intergenic
1015062899 6:128988977-128988999 AGAAAACATCCTGTAAAGAATGG + Intronic
1015517031 6:134093014-134093036 AAAGAACACCATGTGAAGGCTGG + Intergenic
1016690106 6:146928102-146928124 TAACAACATCCTGTGAATTAGGG + Intergenic
1018279507 6:162170470-162170492 AAACAAAATACAGTAAAGGAAGG + Intronic
1018469969 6:164086421-164086443 CAACAAGTTCCTGTGAAGGGGGG + Intergenic
1019875217 7:3804348-3804370 AAAAACCAATCTGTGAAGGAAGG - Intronic
1020562135 7:9741688-9741710 TAACTACCTCTTGTGAAGGAAGG - Intergenic
1020887441 7:13835631-13835653 GAAGAACATCCTGGGAAGCAAGG + Intergenic
1022851931 7:34272568-34272590 AAATATCTTCCTGTGAAGAAAGG - Intergenic
1024244513 7:47459119-47459141 AAAAAACATGCTGTTAAAGAGGG - Intronic
1027867874 7:83671626-83671648 AGAAAACATCCTGGGAATGATGG - Intergenic
1028503695 7:91547982-91548004 AAACATCATCCTGCAAAGGAGGG - Intergenic
1029123574 7:98283359-98283381 AGGCAACTTCCTGGGAAGGAAGG + Intronic
1030188910 7:106791214-106791236 AAACAAAATGCAGTGCAGGAGGG - Intergenic
1032055937 7:128684251-128684273 AAAAGAAATCCTGAGAAGGATGG + Exonic
1034604574 7:152300229-152300251 TTACATTATCCTGTGAAGGAGGG + Intronic
1035083264 7:156235153-156235175 AAGCCACATCCTGAAAAGGAGGG - Intergenic
1035685082 8:1517904-1517926 AAACAACATACCGTGGGGGATGG - Intronic
1038654020 8:29432006-29432028 GAGCCAGATCCTGTGAAGGAAGG + Intergenic
1039419957 8:37429143-37429165 AAACAACAGCCACTGAAGAAAGG + Intergenic
1041594262 8:59628600-59628622 AAAGAACATTCTCTTAAGGAAGG + Intergenic
1042449318 8:68925938-68925960 ATACAACAACCTGAAAAGGAGGG - Intergenic
1043543678 8:81291751-81291773 AGACAACATAATGTGAATGAAGG + Intergenic
1043990582 8:86748315-86748337 AAACAACATCCAGTGAATTAAGG + Intergenic
1045542107 8:103096413-103096435 AAACAAAAGCAAGTGAAGGAGGG + Intergenic
1048435107 8:134408970-134408992 TAACACAATCCTGTGAAGCAAGG - Intergenic
1052792581 9:32889678-32889700 AAACAAAATTCTGTTAAGCATGG - Intergenic
1053591825 9:39521977-39521999 AAAGGACTTACTGTGAAGGAAGG - Intergenic
1053849671 9:42277344-42277366 AAAGGACTTACTGTGAAGGAAGG - Intergenic
1054574480 9:66843312-66843334 AAAGGACTTACTGTGAAGGAAGG + Intergenic
1056177524 9:84049839-84049861 AAACAAAATGCTGTAAAGGAAGG + Intergenic
1057242965 9:93428533-93428555 TAAAAACATCCAGTGTAGGAGGG + Intergenic
1057946568 9:99335033-99335055 ATACAATTCCCTGTGAAGGAGGG - Intergenic
1059144343 9:111884876-111884898 AAATATCATGCTGTGAAAGAAGG + Intergenic
1060344665 9:122805772-122805794 ATACAACATGCTGTGGAGCAGGG + Intronic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1061217290 9:129229084-129229106 AAAAAATATCATGGGAAGGAGGG - Intergenic
1062088618 9:134662157-134662179 AAAAAAATTCCTCTGAAGGAGGG + Intronic
1186971931 X:14855461-14855483 AAACAACATTAAGGGAAGGAAGG - Intronic
1189095935 X:38139650-38139672 GAACAAGTTTCTGTGAAGGATGG - Intronic
1189305931 X:39986597-39986619 AAACAAAAGCCTGGGAGGGAGGG - Intergenic
1195974625 X:110513062-110513084 AAGCAACACACTGTGAAGCAGGG - Intergenic
1199693703 X:150328601-150328623 AAAAAAAATCCTGTGGAGGGTGG - Intergenic