ID: 963227204

View in Genome Browser
Species Human (GRCh38)
Location 3:142874372-142874394
Sequence CACATTTAAAACCATCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963227204 Original CRISPR CACATTTAAAACCATCAGCT CGG (reversed) Intronic
901361917 1:8708624-8708646 CATTTTTAAAACCGTCAGATTGG - Intronic
901719628 1:11186191-11186213 CACAATTAAAACTAACAGCAAGG + Intronic
902181266 1:14690314-14690336 CCCATGTAAAAACATCAGATGGG - Intronic
902574789 1:17370903-17370925 AAAATGTAAAACCATTAGCTGGG + Intergenic
904365233 1:30006815-30006837 CACCTATCAAACCATCACCTAGG + Intergenic
906471947 1:46138497-46138519 CAAAATTAAAAAAATCAGCTAGG + Intronic
906970064 1:50503458-50503480 AAAATTTAAAACAATTAGCTGGG + Intronic
907529912 1:55084744-55084766 GACATGAAAATCCATCAGCTGGG + Intronic
908106298 1:60846078-60846100 CACCTATAAACCCATCACCTAGG - Intergenic
909366297 1:74826831-74826853 CACCTATAAACCCATCACCTAGG - Intergenic
909653033 1:77997182-77997204 GACATTAAAAACTTTCAGCTGGG + Intronic
909824425 1:80109368-80109390 CACCTTTCAACCCATCACCTAGG - Intergenic
910877219 1:91888405-91888427 CACATTTAAATGCATCGGCCAGG + Intronic
910905633 1:92174678-92174700 AACATTTAAAACGTTCAGATAGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912220081 1:107664277-107664299 CACAGATCAAACCATCACCTGGG + Intronic
913018751 1:114765374-114765396 CCCTTATAAAACCATCAGATAGG - Intergenic
913490773 1:119377764-119377786 CCTTTATAAAACCATCAGCTCGG + Intronic
914003139 1:143709598-143709620 CACCTTTAGAAACATCAGCTGGG - Intergenic
914094347 1:144532084-144532106 CACCTTTAGAAACATCAGCTGGG - Intergenic
914304174 1:146401804-146401826 CACCTTTAGAAACATCAGCTGGG + Intergenic
914312369 1:146478098-146478120 CGCGTTTAGAACCACCAGCTGGG - Intergenic
914407019 1:147385627-147385649 CACCTATCAAACCATCACCTAGG + Intergenic
914515598 1:148371460-148371482 CACCTTTAGAAACACCAGCTGGG - Intergenic
914860935 1:151385627-151385649 AAAATTTAAAAACATTAGCTGGG - Intergenic
916855131 1:168741452-168741474 CTTATTTTAAACCATCAGATTGG + Intergenic
917263788 1:173197738-173197760 CACAGATCAAACCATCACCTAGG - Intronic
917492346 1:175508173-175508195 CACATATCAACCCATCATCTAGG - Intronic
917568699 1:176239419-176239441 CAAATTTACAAGCATTAGCTGGG + Intergenic
918213911 1:182376340-182376362 ATCATTTAAAAGCATCGGCTGGG - Intergenic
921999764 1:221464692-221464714 TACATTTTAAACCATCAGATTGG - Intergenic
923337569 1:232983804-232983826 CACGTCTGATACCATCAGCTGGG - Exonic
924265356 1:242276175-242276197 AATATTTAAAAACATCAGCTGGG + Intronic
1063148243 10:3315305-3315327 CACATCTAAATCCATCACCCCGG - Intergenic
1063628005 10:7708660-7708682 CAAATGCAAGACCATCAGCTGGG - Intronic
1063669717 10:8090309-8090331 CACCTATCAAACCATCACCTAGG + Intergenic
1063760540 10:9070183-9070205 CACCTATAAACCCATCATCTAGG + Intergenic
1063888580 10:10605333-10605355 CACATATCAACCCATCACCTAGG - Intergenic
1064848522 10:19683855-19683877 CACATATCAACCCATCATCTGGG + Intronic
1065519010 10:26553491-26553513 AAAATTTAAAAACATTAGCTGGG + Intronic
1065832162 10:29624248-29624270 CAGTTTAAAAACCATCTGCTTGG + Intronic
1066719468 10:38322315-38322337 AATATTTAAAAACATCAGCTGGG - Intergenic
1068427683 10:56888914-56888936 CACCTATCAAACCATCATCTAGG + Intergenic
1069528853 10:69200002-69200024 AAAAATTAAAAACATCAGCTAGG - Intronic
1070157587 10:73845280-73845302 CAAAATGAAAACCATCATCTTGG + Intronic
1072643694 10:97234317-97234339 CACCTGTAAACCCATCACCTAGG - Intronic
1072878419 10:99200195-99200217 CACAATTAAAAAAATCACCTGGG + Intronic
1074181906 10:111072850-111072872 TAAATTTATAACTATCAGCTAGG - Intergenic
1075094109 10:119459988-119460010 CACTTCTAGAACCATCTGCTGGG - Intergenic
1075756097 10:124812662-124812684 CACATTTGAAAGCATAAACTGGG + Intronic
1076425652 10:130365785-130365807 CACCTATAAACCCATCATCTAGG + Intergenic
1077757285 11:5046473-5046495 CACATGTAGAAGCAGCAGCTGGG - Intergenic
1079200821 11:18376065-18376087 CAACTATAAAACCCTCAGCTGGG + Intergenic
1082122738 11:48396991-48397013 CACATTGATACCCAGCAGCTTGG + Intergenic
1082556441 11:54568272-54568294 CACATTGATACCCAGCAGCTTGG + Intergenic
1082939208 11:58686322-58686344 AACATTTAAAAGGATCAGCTGGG - Intronic
1083353232 11:62046208-62046230 CACATATAAAAAAATTAGCTAGG + Intergenic
1083382007 11:62277023-62277045 CTAATTTAAAACTATCAGCTGGG + Intergenic
1085736021 11:79039697-79039719 CACCTTTCAACCCATCATCTAGG - Intronic
1088134293 11:106535470-106535492 CACATTTAAAATCCATAGCTTGG - Intergenic
1088426204 11:109706871-109706893 CACATTTAAAATAAGCACCTGGG - Intergenic
1088462732 11:110099649-110099671 CACAATTACAAAAATCAGCTGGG + Intronic
1089173277 11:116530847-116530869 CCCCTTTAAACCCATCAGCCTGG + Intergenic
1089985844 11:122812802-122812824 CACATTTTAATGCATAAGCTGGG + Exonic
1093440330 12:19187698-19187720 TCCATTTAAAATCATCAGATAGG - Intronic
1093506171 12:19869422-19869444 CTCTTTTCAAACCTTCAGCTTGG + Intergenic
1094174532 12:27527867-27527889 CATATTTAAATCCATCTGTTTGG - Intronic
1095353183 12:41239379-41239401 CACAGTTCAACCCATCACCTAGG - Intronic
1095595847 12:43957212-43957234 CACCTATCAACCCATCAGCTAGG - Intronic
1095828193 12:46552698-46552720 CAAATTTAAAACCAGAAGATAGG - Intergenic
1096708728 12:53439994-53440016 CACCAATAAACCCATCAGCTAGG - Intergenic
1097015495 12:55983816-55983838 AACATTTAAAAAAATTAGCTGGG - Intronic
1098700869 12:73623659-73623681 CACCTTTAAACCCATCATCTAGG - Intergenic
1098712594 12:73783226-73783248 CATCTATAAAACCATCACCTAGG - Intergenic
1099923633 12:88990173-88990195 CACCTATCAAACCATCACCTAGG - Intergenic
1100931744 12:99617856-99617878 CACACTTAATACAATCAGGTAGG + Intronic
1101474319 12:105029534-105029556 CACATTTAACACCACCACCATGG + Intronic
1101568595 12:105932916-105932938 CACATATCAACCCATCATCTAGG + Intergenic
1101909093 12:108849394-108849416 CACATTTAAAAAAATTAGCCAGG + Intronic
1103221249 12:119247491-119247513 GACTTTTAACACCATCCGCTTGG + Intergenic
1104123012 12:125817431-125817453 CACATTTCACATCATCTGCTGGG - Intergenic
1104374708 12:128254169-128254191 CACCTATCAAACCATCACCTAGG - Intergenic
1104431715 12:128721589-128721611 CACTTTTAAAACCACCAGATAGG - Intergenic
1105047206 12:133014844-133014866 AACTTTTAAAACCATCATCATGG - Exonic
1109531335 13:63652722-63652744 CACCTTTCAACCCATCACCTAGG + Intergenic
1110160831 13:72376524-72376546 AACATTTAAAGCCATGAGCTTGG + Intergenic
1111641814 13:90979023-90979045 CACTTTTCAACCCATCATCTAGG + Intergenic
1111989521 13:95102964-95102986 CACCTTTAAAACCTGAAGCTGGG + Intronic
1112462016 13:99611061-99611083 CACAGTGAAAACCAGCAGCATGG - Intronic
1114804599 14:25820365-25820387 TAAATTTAGACCCATCAGCTTGG + Intergenic
1115410667 14:33070671-33070693 CAGCTTTCAAACCAGCAGCTTGG - Intronic
1116614128 14:47112329-47112351 CACCTATAAACCCATCACCTAGG + Intronic
1116714283 14:48408105-48408127 CACTTATAAAACCATCAGATTGG + Intergenic
1117424857 14:55583217-55583239 CACATTTAAGCACAACAGCTCGG - Intronic
1117561266 14:56941861-56941883 CACACTTCATCCCATCAGCTAGG + Intergenic
1117629595 14:57676480-57676502 CACATGTCAACCCATCACCTAGG - Intronic
1118146906 14:63147635-63147657 CACATATCAACCCATCACCTAGG + Intergenic
1118462094 14:65996671-65996693 CACAATTATGACCATCAACTTGG + Intronic
1119078556 14:71669776-71669798 CACTTGTAAAACCAACAGATAGG + Intronic
1119084582 14:71728059-71728081 CACCTGTAAAACCATCAGGCTGG + Intronic
1119153151 14:72384418-72384440 CACTTTTAAAACCAAAAGATAGG - Intronic
1120368492 14:83602321-83602343 CACCTATCAAACCATCACCTAGG + Intergenic
1120530778 14:85628438-85628460 GACATTTAAAACCAATAGCGTGG - Exonic
1120640724 14:87009067-87009089 TACATATAAAACCTACAGCTTGG - Intergenic
1121853941 14:97249171-97249193 CCCACTTGAAACCCTCAGCTTGG + Intergenic
1124608075 15:31186003-31186025 CACCTTTAAAAATATCAGCTAGG - Intergenic
1126236903 15:46396152-46396174 CACCTATCAAACCATCACCTAGG - Intergenic
1126293356 15:47108530-47108552 CACCTATCAACCCATCAGCTAGG + Intergenic
1127280281 15:57484642-57484664 CACCTATCAAACCATCATCTAGG + Intronic
1127766702 15:62192724-62192746 CACAGTTAAAACTAACACCTTGG + Intergenic
1128025448 15:64432649-64432671 CACCTTTAATCCCAGCAGCTTGG + Intronic
1128620146 15:69141968-69141990 TACATTTAAAAGCATAATCTGGG + Intergenic
1128950611 15:71876727-71876749 AATCTTTAAAACAATCAGCTTGG - Intronic
1129266271 15:74395095-74395117 AACATTAATAGCCATCAGCTTGG - Intergenic
1129830433 15:78666118-78666140 CAGTTATAAAACCATCAGATCGG - Intronic
1130007423 15:80113241-80113263 CAAATTAAAACCCATCAGCTAGG - Intronic
1130839472 15:87684262-87684284 CACATGTAAAGTCCTCAGCTTGG - Intergenic
1131425469 15:92342206-92342228 TCCATTTAAAATCATTAGCTAGG + Intergenic
1131929217 15:97420183-97420205 CACATTTAATACCAGAAGTTTGG - Intergenic
1131988215 15:98066203-98066225 CACATTAAAAATCATTAACTGGG + Intergenic
1132362356 15:101227197-101227219 CACAGCAAAAACCAGCAGCTTGG + Intronic
1133974197 16:10588742-10588764 CTGACTTAAAACCTTCAGCTGGG - Intergenic
1134289189 16:12889929-12889951 CACCTGTCAACCCATCAGCTAGG - Intergenic
1134627745 16:15734917-15734939 CACATGTAATACCAGCAGTTTGG + Intronic
1134869673 16:17640524-17640546 CACCTATCAACCCATCAGCTAGG + Intergenic
1135053381 16:19210832-19210854 CACATTTGAAACCCTTTGCTAGG + Intronic
1136028174 16:27483451-27483473 CACATTTAAAAACATCAAACAGG + Intronic
1137603642 16:49773016-49773038 CCCTTATAAAACCATCAGATTGG + Intronic
1137771698 16:51020951-51020973 CTCATTTAATTCCATCAGATAGG + Intergenic
1138050567 16:53772725-53772747 TACATTAGAAATCATCAGCTTGG + Intronic
1138077218 16:54054450-54054472 CAGTTTTAATTCCATCAGCTTGG - Intronic
1139051374 16:63129253-63129275 CCCTTATAAAACCATCAGATCGG + Intergenic
1139248363 16:65470648-65470670 CACAGATAAACCCATCACCTAGG + Intergenic
1140696684 16:77541539-77541561 CACGTTGATAACCATCTGCTTGG - Intergenic
1140736801 16:77905551-77905573 GACACTTAAAAACAGCAGCTAGG - Intronic
1142642320 17:1291408-1291430 CCCTTATAAAACCATCAGATTGG - Intronic
1144034256 17:11351205-11351227 CACCTATGAAACCATCATCTAGG - Intronic
1144120436 17:12147436-12147458 TACATCTAAAACCATGAGTTTGG - Intergenic
1144242258 17:13324065-13324087 CACAATGAAAACCAACAGCCTGG - Intergenic
1144338208 17:14291021-14291043 CACACTTAATACCATCACATTGG + Intergenic
1144773987 17:17775011-17775033 AAAATTTAAAACCAGAAGCTGGG - Intronic
1144969820 17:19101080-19101102 CACACTTAAAACTTTCAGCTTGG - Intergenic
1144978096 17:19150984-19151006 CACACTTAAAACTTTCAGCTTGG + Intronic
1144990125 17:19227248-19227270 CACACTTAAAACTTTCAGCTTGG - Intronic
1146098658 17:29957410-29957432 CACCTATCAAACCATCACCTAGG + Intronic
1149411048 17:56407321-56407343 CACATATAAAACATTTAGCTTGG - Intronic
1151108604 17:71648833-71648855 CACCTATAAACCCATCACCTAGG - Intergenic
1151905843 17:77048534-77048556 CAAATTTCAAACATTCAGCTGGG + Intergenic
1152209809 17:78997098-78997120 CCCATTGAAAACAATCAGGTCGG + Exonic
1153377082 18:4392747-4392769 CACATTTCAAACTGTCTGCTTGG + Intronic
1154067569 18:11122340-11122362 CTCATTTTAAACAATCAGCCAGG + Intronic
1159688038 18:71447845-71447867 CACCTATAAACCCATCATCTAGG - Intergenic
1159693757 18:71526912-71526934 CACATTTAAGATTATCAACTGGG - Intergenic
1160672272 19:371335-371357 CCCATTTTAGACCAGCAGCTCGG + Intronic
1162254411 19:9476588-9476610 TACTTATAAAACCATCAGATTGG - Intronic
1163295140 19:16406858-16406880 CACACCTAATACCATCATCTTGG - Intronic
1164620276 19:29691417-29691439 CATTTTTAAAACCATCAGATTGG + Intergenic
1166599474 19:44081408-44081430 CCCTTATAAAACCATCAGATAGG + Intronic
1166918437 19:46212088-46212110 AACATGGAAAACCATCAGTTGGG - Intergenic
1167061185 19:47147711-47147733 CACCTGTAAACCCAGCAGCTTGG - Intronic
924980795 2:219341-219363 CACTTCTAACACCATCACCTTGG - Intronic
925347706 2:3182527-3182549 GACATTGAAAGCCATAAGCTGGG - Intergenic
925383413 2:3444725-3444747 CACTGTTAACACCATCATCTTGG - Intronic
927238236 2:20897801-20897823 CACACTAAAAACCATCAGCCTGG - Intergenic
928886498 2:36154732-36154754 CACATGTCAACCCATCATCTAGG + Intergenic
928959247 2:36906623-36906645 TACATTTAAAAACTTCAGGTAGG + Intronic
930132404 2:47865947-47865969 TACTTTTAAAAACATTAGCTGGG + Intronic
930790362 2:55320685-55320707 CACATTTAAAATTATGAGTTAGG - Intronic
931279971 2:60781880-60781902 CACAGGTAAATCCATCAGATAGG + Exonic
931929701 2:67117677-67117699 CACATTAAAAACTCTCAACTAGG + Intergenic
932537241 2:72611978-72612000 CACATTAAAAATTATCATCTTGG + Intronic
932982694 2:76689031-76689053 CACTTCTAATACCATCAGCTTGG + Intergenic
934034872 2:88080805-88080827 TACCTTGAAAACCATCAGTTAGG + Intronic
935138063 2:100324818-100324840 CACCTATCAAACCATCACCTAGG - Intergenic
935342328 2:102069157-102069179 CACATTTTGAAAAATCAGCTTGG + Intronic
935557906 2:104530540-104530562 CACCTTTCAATCCATCATCTAGG - Intergenic
936116098 2:109704387-109704409 AACATTTAAAAACCTTAGCTGGG + Intergenic
938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG + Intergenic
938892731 2:135721989-135722011 CACATTCCAAACCAACAGGTAGG + Exonic
940067430 2:149645706-149645728 CATATTTTAAACTATAAGCTGGG + Intergenic
940340089 2:152571091-152571113 CACAGTGAAAACCAGCAGCCTGG + Intronic
941079700 2:161046248-161046270 CACATTCAAACTCCTCAGCTTGG + Intergenic
941756682 2:169193851-169193873 CACACTTGAACTCATCAGCTAGG + Exonic
942298878 2:174542944-174542966 CACATTTCAACCCATCATCCTGG - Intergenic
943147257 2:184061414-184061436 CACATCTACAACCATCTGATTGG - Intergenic
943428912 2:187773138-187773160 CACCTATCAAACCATCACCTAGG - Intergenic
943828551 2:192428148-192428170 CACGTGTAAGACCATCACCTTGG + Intergenic
943833658 2:192491537-192491559 TACAATTAAACCCATCACCTAGG - Intergenic
943918927 2:193677108-193677130 TACATTTAAAAAAATCAGCAGGG + Intergenic
944562739 2:200957069-200957091 CACCTTTCAACCCATCATCTAGG - Intronic
944991208 2:205238185-205238207 CACATTAAACACCTTCAGCAGGG - Intronic
945639651 2:212408171-212408193 CACCTATCAAACCATCACCTAGG + Intronic
947169723 2:227299093-227299115 CCCTTATAAAACCATCAGATCGG + Intronic
948576603 2:238955745-238955767 TACATTTAAAAGAATCAGCATGG - Intergenic
948579482 2:238974667-238974689 CACAGTGAAAACCAGCAGCCTGG + Intergenic
1168793424 20:595614-595636 CACATTTAAAAACACCAGACTGG + Intergenic
1170037383 20:12003677-12003699 CATTTTTAAAACCATCAGCTCGG - Intergenic
1171023080 20:21604145-21604167 CACCTATAAACCCATCATCTGGG + Intergenic
1177662569 21:24105180-24105202 CACCTTTCAACCCATCACCTAGG - Intergenic
1178134065 21:29606366-29606388 CACATATCCACCCATCAGCTAGG + Intronic
1178614706 21:34122033-34122055 CACAAATAAAACCATGAGCCTGG - Intronic
1180622731 22:17172451-17172473 CAAATTCAAAACCAGCAGCTCGG + Intergenic
1181435887 22:22910590-22910612 CTCATCTAAAATGATCAGCTGGG - Intergenic
1181798858 22:25330938-25330960 CACCTGTCAAACCATCACCTAGG + Intergenic
1182654655 22:31880367-31880389 CACATTTCAACCCATCAGTCAGG - Intronic
1182952863 22:34393940-34393962 CACCTATTAAACCATCACCTAGG - Intergenic
1183875371 22:40775761-40775783 CTCCTATAAAACCATCAGATCGG - Intronic
950294195 3:11814015-11814037 CACACATAAAAAAATCAGCTGGG + Intronic
950941188 3:16893499-16893521 CACTTTTAAACCCAGCTGCTTGG - Intronic
951698301 3:25468647-25468669 CAAATTTAAAACTAACAGATAGG + Intronic
951769416 3:26239002-26239024 CAAAGCTAAAACCATTAGCTGGG + Intergenic
951975132 3:28498150-28498172 TACAGGTAACACCATCAGCTGGG - Intronic
953755037 3:45639026-45639048 AAAATTTTAAACCATTAGCTGGG - Intronic
954192294 3:48972316-48972338 CAAATTTAAAAAAATTAGCTGGG - Intronic
954727995 3:52632419-52632441 AACATTTAAAAAAATTAGCTGGG + Intronic
955625288 3:60912000-60912022 CACCTTTAAACCCATGAGATGGG - Intronic
956644636 3:71443947-71443969 CACATTTTGGACCAGCAGCTTGG + Intronic
958437598 3:94116531-94116553 AACTTTTAAAAGCATCAGATAGG - Intronic
958484207 3:94682583-94682605 CACTTATCAACCCATCAGCTAGG - Intergenic
959297717 3:104558260-104558282 CACCTATCAAACCATCACCTAGG + Intergenic
960315515 3:116171524-116171546 CAGATTTAAAAAAATCAGGTAGG - Intronic
960606836 3:119514927-119514949 CACCTGTAAAACCAGCAGTTTGG + Intronic
960635108 3:119777203-119777225 CACCTCCAAAACCATCACCTTGG + Intergenic
961413788 3:126742922-126742944 TACATTTCTAACCATCAGATAGG + Intronic
961804362 3:129478286-129478308 CAGTTTTAAAACCATGAGGTGGG - Intronic
961910190 3:130306797-130306819 CAAAGTAAAAACCATCAACTTGG - Intergenic
962211755 3:133485659-133485681 CACCTTTAATACCAGCAGTTTGG + Intergenic
963227204 3:142874372-142874394 CACATTTAAAACCATCAGCTCGG - Intronic
963474991 3:145793641-145793663 CATTTTTAAAACCATCAGATTGG + Intergenic
963951031 3:151201252-151201274 CACATTTAAAAACAAAACCTAGG + Intronic
964735096 3:159908783-159908805 AATATTTAAAACCATATGCTGGG + Intergenic
967296818 3:187973540-187973562 CACCTGTAAAACCAGCAGTTTGG + Intergenic
967767486 3:193297023-193297045 CACAGTTCAACCCATCACCTAGG - Intronic
969097231 4:4742886-4742908 GATATTTAAAGCCATCAGATAGG + Intergenic
969431578 4:7158026-7158048 CACTCCTAAAACCATCACCTTGG - Intergenic
970174679 4:13327173-13327195 CACCTTTCAACCCATCATCTAGG - Intergenic
970563428 4:17306202-17306224 CACCTATCAACCCATCAGCTAGG - Intergenic
971400664 4:26272744-26272766 CATATTTGAAACCATGAGGTAGG + Intronic
971587366 4:28421710-28421732 CCCTTATAAAACCATCAGATTGG + Intergenic
972416198 4:38842757-38842779 CACATCTAATACCATCACGTTGG + Intronic
972471459 4:39409624-39409646 TACATTTAAAAATATCAGATTGG + Intronic
972731782 4:41801848-41801870 CCCTTATAAAACCATCAGATTGG - Intergenic
974805163 4:66869809-66869831 CACCTATCAAACCATCACCTAGG - Intergenic
975526092 4:75352278-75352300 CACATATTAACCCATCATCTAGG + Intergenic
975964770 4:79958653-79958675 CAAATTTACAACCAACAGCTCGG + Intronic
976651466 4:87439353-87439375 CCCTTATAAAACCATCAGATTGG + Intronic
978022638 4:103832554-103832576 CACAGATCAAACCATCACCTTGG + Intergenic
978110253 4:104954826-104954848 CACCCTTAAAACCAGCATCTTGG - Intergenic
978192349 4:105929045-105929067 CACCTATCAAACCATCATCTAGG + Intronic
978569832 4:110124616-110124638 CACCTTTCAACCCATCACCTAGG - Intronic
979352567 4:119662440-119662462 CACAGTGAAAACCAACAGCAAGG - Intergenic
979853681 4:125605604-125605626 CACCTGTAAACCCATCACCTAGG + Intergenic
979932685 4:126651644-126651666 CACTTTTAAAACAATCAATTAGG + Intergenic
980210822 4:129785012-129785034 CATTTTTGAAACCATCAACTTGG + Intergenic
980734835 4:136871075-136871097 CACCTATCAAACCATCACCTAGG + Intergenic
981930704 4:150185995-150186017 CACAATTAAAGCAATCAGTTAGG - Intronic
982012683 4:151121879-151121901 CACATGGAAACCCATGAGCTAGG - Exonic
982284343 4:153719043-153719065 CACCTGTCAACCCATCAGCTAGG + Intronic
982752029 4:159173595-159173617 TAGAGTTAAAACCTTCAGCTTGG - Intronic
983702898 4:170620764-170620786 TACATTTAAAAGGAGCAGCTGGG - Intergenic
983907227 4:173196630-173196652 CACATATCAACCCATCACCTAGG + Intronic
984076641 4:175189911-175189933 AACTTTAAAAACCATTAGCTGGG + Intergenic
984224213 4:177015134-177015156 CACCTGTAAATCCAGCAGCTTGG - Intergenic
984789316 4:183600392-183600414 CACAGTGAAAACCAGCAGCTTGG - Intergenic
984832971 4:183992899-183992921 CACACTATAACCCATCAGCTAGG - Intronic
985339436 4:188933702-188933724 AAGATTTAAAAGCATTAGCTTGG - Intergenic
985802912 5:2017433-2017455 CCCTTATAAAACCATCAGATCGG - Intergenic
986011391 5:3719099-3719121 CACCTTTCAACCCATCACCTAGG + Intergenic
986219696 5:5756865-5756887 TACATTAACAACCAGCAGCTGGG + Intergenic
986432289 5:7693188-7693210 CACATTGTAAACCTTCAGTTGGG + Intronic
986556066 5:9010871-9010893 CACTTTCAAAACAATCAGCGAGG + Intergenic
986725903 5:10596252-10596274 CACAGATCAACCCATCAGCTAGG + Intronic
986787646 5:11129567-11129589 CAAATTTGCAGCCATCAGCTTGG + Intronic
986788306 5:11135993-11136015 CTCACTTAATACCATCACCTTGG - Intronic
987376883 5:17243996-17244018 TACATTGTAAACTATCAGCTAGG + Intronic
987431402 5:17838526-17838548 CAAGTTAAAAACCATTAGCTGGG + Intergenic
987446213 5:18022758-18022780 CAAAATTAAAAACATTAGCTAGG + Intergenic
987573490 5:19696552-19696574 AAAATTCAAAAACATCAGCTGGG - Intronic
987891338 5:23882020-23882042 CAGACATAAAACCATCAGCTCGG - Intergenic
988119682 5:26944490-26944512 AACTTTTAAAAACATTAGCTGGG + Intronic
988186832 5:27874870-27874892 CACCTATAAACCCATCACCTAGG - Intergenic
988905012 5:35778343-35778365 CACATTAATAACCATAAGATAGG + Intronic
989032641 5:37135532-37135554 CCCTTATAAAACCATCAGATTGG + Intronic
990450285 5:55927003-55927025 CCCTTATAAAACCATCAGATCGG + Intergenic
991002122 5:61793009-61793031 CACCTATAAACCCATCATCTAGG + Intergenic
991326786 5:65442759-65442781 CACCTATCAACCCATCAGCTAGG + Intronic
991520418 5:67490950-67490972 CACATTTAAAACAAAAAGGTTGG - Intergenic
992755338 5:79900030-79900052 CACAGATCAACCCATCAGCTAGG + Intergenic
994680254 5:102877867-102877889 AAAATTTAAAACAATTAGCTGGG + Intronic
995399607 5:111725978-111726000 TACATTTAAAATAATCAGCATGG + Intronic
996004204 5:118401739-118401761 CACCTATAAACCCATCACCTAGG + Intergenic
996599320 5:125243573-125243595 CATGTTAAAAACCCTCAGCTAGG - Intergenic
997465211 5:134083488-134083510 GACATTTAAAAGCATAGGCTTGG - Intergenic
997933738 5:138092727-138092749 CTAATTTAAAACAATAAGCTAGG - Intergenic
997981276 5:138468869-138468891 CACATGTCAAGCCATCAGCAAGG - Exonic
998567602 5:143230023-143230045 CAAAATTAAAACCTTCTGCTAGG - Intergenic
1000796752 5:165673611-165673633 CACTTTTATAACTATAAGCTTGG + Intergenic
1001832854 5:174804018-174804040 CCCTTATAAAACCATCAGATCGG - Intergenic
1001847062 5:174931449-174931471 CACCTGTCAAACCATCACCTAGG - Intergenic
1003299983 6:4871307-4871329 CACATTAAAATCCAACAGCAGGG - Intronic
1003335389 6:5166978-5167000 CACCTATAAAACCAGCATCTTGG - Intronic
1003411679 6:5869434-5869456 CAAATTTTAAAACATCACCTGGG + Intergenic
1004177561 6:13353312-13353334 CATTTTTAAAAACATTAGCTAGG + Intergenic
1004497149 6:16175315-16175337 CACACTTATAATCCTCAGCTAGG + Intergenic
1004686779 6:17953997-17954019 CAGATTTAAAACAATCCGATCGG + Intronic
1006261307 6:32873872-32873894 CACATATCAACCCATCACCTAGG + Intergenic
1006567398 6:34971883-34971905 GACATTTAAAATCATCAGTGAGG + Intronic
1006894831 6:37461264-37461286 CACATTCTAAACCATCTCCTTGG + Intronic
1007872877 6:45061502-45061524 CACAGATCAACCCATCAGCTAGG - Intronic
1008021237 6:46580200-46580222 CACACTTAAAAACATCAGATCGG + Intronic
1008345672 6:50423525-50423547 CACATATCAAACCATCACGTAGG + Intergenic
1008365253 6:50671548-50671570 TACATTTAAAACAAACATCTAGG + Intergenic
1009763609 6:68039401-68039423 CACATTTCAAACCATCTCTTTGG + Intergenic
1011362913 6:86547764-86547786 AACATTTTAACCAATCAGCTAGG + Intergenic
1014178727 6:118359717-118359739 CAGCATTGAAACCATCAGCTTGG - Intergenic
1014465412 6:121750805-121750827 CACATATCAACCCATCACCTAGG + Intergenic
1015554297 6:134444904-134444926 CACATCTAAAACCCTCTGCATGG - Intergenic
1016047138 6:139492689-139492711 CGCTTATAAAACCATCAGATAGG + Intergenic
1016106774 6:140172629-140172651 CCCTTTTAAAATCATCAGATTGG + Intergenic
1016702633 6:147070687-147070709 CCCTTATAAAACCATCAGATTGG + Intergenic
1017897195 6:158690926-158690948 CACATTAAAAACCCTCTGCACGG - Intronic
1018035904 6:159880809-159880831 CACATTCCACACCATCTGCTGGG - Intergenic
1021665648 7:22975875-22975897 CAAATTTTAAAAAATCAGCTGGG - Intronic
1023335990 7:39171118-39171140 CACCTATAAACCCATCATCTAGG + Intronic
1024801238 7:53082529-53082551 ACCATTTAAAACCATGAGATTGG - Intergenic
1024929678 7:54656954-54656976 AAAATTTAAAAACATTAGCTGGG + Intergenic
1026315879 7:69226795-69226817 CACTTCTAATACCATCACCTTGG + Intergenic
1026571377 7:71534297-71534319 CCCTTATAAAACCATCAGATTGG + Intronic
1027635176 7:80662670-80662692 CACCTATCAAACCATCATCTAGG + Intronic
1027823145 7:83074733-83074755 AACATTAAAATCCATCTGCTTGG + Intronic
1027881457 7:83843456-83843478 CACTTTTAAAACCATCGGGTTGG - Intergenic
1028418462 7:90605921-90605943 CACATCTTTAACCTTCAGCTGGG - Intronic
1028887086 7:95946210-95946232 CACCTATCAAACCATCACCTAGG - Intronic
1029183404 7:98720968-98720990 CTCTTATAAAACCATCAGATCGG + Intergenic
1029855454 7:103511575-103511597 CACATTTAAAACATACATCTTGG + Intronic
1029916630 7:104216347-104216369 CACATTTAGAAAAACCAGCTGGG + Intergenic
1029962509 7:104703198-104703220 AACAGTTAAAAACATCAGTTCGG - Intronic
1030950536 7:115785513-115785535 CACTTCTAAAAACATAAGCTGGG - Intergenic
1031393583 7:121246000-121246022 GGCATTTTAAACCATCACCTTGG + Intronic
1031418575 7:121522167-121522189 CACATTTCAAACCAGCTGCCTGG + Intergenic
1031709875 7:125032181-125032203 CACATATCAACCCATCACCTAGG + Intergenic
1031758657 7:125681882-125681904 CACCTATTAAAACATCAGCTGGG + Intergenic
1032528197 7:132596159-132596181 CACTTACAAAACTATCAGCTTGG - Intronic
1034090728 7:148361890-148361912 CGCTTATAAAACCATCAGATCGG + Intronic
1034424167 7:151005647-151005669 CACTTTTAAATGCTTCAGCTGGG - Intronic
1035891122 8:3344357-3344379 CACCTTTCAACCCATCATCTAGG - Intronic
1035959291 8:4119154-4119176 CACCTATCAAACCATCATCTAGG - Intronic
1036466079 8:8998816-8998838 AACATTTAAAAACATCGGCCAGG + Intergenic
1037181152 8:16006992-16007014 CACCTTTTAATCCATCACCTAGG - Intergenic
1037746392 8:21648846-21648868 CAAATTTAAGAGCATTAGCTGGG + Intergenic
1038093015 8:24275399-24275421 CACCTGTCAAACCATCATCTAGG - Intergenic
1038093955 8:24286571-24286593 CACCTATCAATCCATCAGCTAGG - Intergenic
1038274409 8:26108413-26108435 CCCCTTTAAAACCATCAGACCGG - Intergenic
1038341359 8:26688628-26688650 CACCTATCAAACCATCATCTAGG + Intergenic
1038721088 8:30036018-30036040 CACATGTAGTACCATCTGCTTGG + Intergenic
1039129382 8:34245634-34245656 CACCTATCAAACCATCATCTAGG + Intergenic
1039821089 8:41136182-41136204 CACAGATCAACCCATCAGCTAGG - Intergenic
1041931543 8:63292680-63292702 GGTATTTAAAGCCATCAGCTTGG + Intergenic
1042005304 8:64173018-64173040 CACATATTAAGCCATCACCTAGG + Intergenic
1042152366 8:65801676-65801698 CAATTTGATAACCATCAGCTAGG + Intronic
1042645785 8:70984585-70984607 CCCATTTAAAACAAATAGCTAGG - Intergenic
1044760056 8:95508501-95508523 CACCTATCAACCCATCAGCTAGG + Intergenic
1044786584 8:95800297-95800319 CACCTATCAACCCATCAGCTAGG - Intergenic
1045093119 8:98767798-98767820 AACAGTTAAAACCCTCAGCTGGG + Intronic
1046247304 8:111581355-111581377 CACATATCAACCCATCACCTAGG + Intergenic
1046393339 8:113606104-113606126 CATATTTAAAACCATCATGTTGG + Intronic
1046585100 8:116141095-116141117 CCCTTATAAAACCATCAGGTTGG - Intergenic
1046694324 8:117321711-117321733 CATTTTTAAAACCATCAGATGGG + Intergenic
1048170367 8:132100339-132100361 CACATTTTAATAAATCAGCTTGG + Intronic
1048381697 8:133871137-133871159 CACCTATCAAACCATCACCTGGG + Intergenic
1049718782 8:144106050-144106072 CACAGACAGAACCATCAGCTGGG - Intronic
1049739235 8:144228072-144228094 AAAATTTAAAAACATTAGCTGGG + Intronic
1050408400 9:5334790-5334812 CTCATTGCAAACCATCAGTTTGG - Intergenic
1050737910 9:8785556-8785578 CATATTAAAGACCATCAGCTAGG + Intronic
1050942479 9:11477077-11477099 CACCTATCAAACCATCATCTAGG - Intergenic
1051023452 9:12574772-12574794 CACATTTAAAACCATATATTTGG - Intergenic
1051025608 9:12607354-12607376 CACCTTTCAACCCATCACCTAGG + Intergenic
1051331649 9:16030141-16030163 CGCCTTTAATACCATCACCTTGG + Intronic
1051792934 9:20828716-20828738 CACCTATCAAACCATCACCTAGG + Intronic
1051998998 9:23253260-23253282 CACATATCAATCCATCACCTAGG - Intergenic
1053245824 9:36533857-36533879 CTCTTTTAAAACCATCAGATCGG - Intergenic
1053265016 9:36706217-36706239 CCCTTATAAAACCATCAGATTGG + Intergenic
1054835193 9:69669564-69669586 CATTTTTAAAACTATCAGCCTGG + Intronic
1054887502 9:70214543-70214565 CTCATTTAAAACCTTCCACTGGG - Intronic
1055167761 9:73218226-73218248 CCTTTTTAAAACCATCAGATCGG - Intergenic
1055303394 9:74904740-74904762 AATATTTAAAACAAACAGCTGGG - Intergenic
1055381737 9:75714687-75714709 CAGTTTTAAAGCCATCAGATGGG - Intergenic
1055876931 9:80954440-80954462 CAAAAAAAAAACCATCAGCTGGG - Intergenic
1056086698 9:83156524-83156546 CATATTTAAAATCATAAGATTGG - Intergenic
1056669578 9:88614964-88614986 CACCTTTCAACCCATCACCTAGG + Intergenic
1057477662 9:95416991-95417013 AACATTTAAAAAAATTAGCTAGG + Intergenic
1057679964 9:97170484-97170506 CACATATCAATCCATCACCTAGG - Intergenic
1059845074 9:118266380-118266402 TACCTGTTAAACCATCAGCTAGG + Intergenic
1060111244 9:120908051-120908073 AATAATAAAAACCATCAGCTGGG - Intronic
1060507676 9:124210208-124210230 AGCATTTAAAACCATGAGCAGGG - Intergenic
1060672050 9:125478486-125478508 AACATTTAAAAACCTTAGCTGGG - Intronic
1187277001 X:17825009-17825031 CACATTTAATAGCTTCAGATGGG - Intronic
1187295366 X:17994495-17994517 CTCTTTTAAAAACATCAACTTGG - Intergenic
1187400716 X:18957479-18957501 CACATCTGAAACCATAGGCTTGG - Intronic
1188054004 X:25520819-25520841 CACCTTTGAACCCATCACCTAGG - Intergenic
1188703245 X:33292151-33292173 CACCTTTAAAACCAAGAGTTAGG + Intronic
1189643369 X:43098868-43098890 CACCTATAAACCCATCATCTAGG - Intergenic
1189664493 X:43339528-43339550 CCCATATAAAACCATCAGATAGG + Intergenic
1189788936 X:44584833-44584855 CCCTTATAAAACCATCAGATAGG - Intergenic
1190088605 X:47418060-47418082 AAAATTTAAAAACATCAGCTGGG - Intergenic
1190157801 X:48007837-48007859 CACAGTGACAACCATCAGCGTGG - Exonic
1190173573 X:48130722-48130744 CACAGTGACAACCATCAGCGTGG - Exonic
1190373884 X:49769758-49769780 CACCTATAAACCCATCACCTAGG + Intergenic
1190418518 X:50204633-50204655 CAGACTTAAAACCACCAGATGGG - Intronic
1192280993 X:69685515-69685537 GACATTTAAAACCAGCATCTTGG + Intronic
1193018957 X:76769439-76769461 CACCTTTCAACCCATCATCTAGG + Intergenic
1193515515 X:82457169-82457191 CATCTTTAATACCATCACCTTGG + Intergenic
1193618373 X:83718819-83718841 CACTTTTCAACCCATCACCTAGG + Intergenic
1193977293 X:88137342-88137364 CTGATTTAAACACATCAGCTTGG + Intergenic
1194649394 X:96497632-96497654 CACACTCAAAACTAGCAGCTGGG - Intergenic
1195347909 X:103969315-103969337 CACATATCAACCCATCATCTAGG + Intergenic
1195359533 X:104069526-104069548 CACATATCAACCCATCATCTAGG - Intergenic
1195560305 X:106275652-106275674 CACATTTGAAATCATAAACTAGG + Intergenic
1195561657 X:106290687-106290709 CACATTTGAAATCATAAACTAGG - Intergenic
1195801162 X:108712589-108712611 CACATTTTCAACATTCAGCTAGG + Intergenic
1195924058 X:110008005-110008027 CTCACTAAAAACCAACAGCTTGG - Intronic
1196394467 X:115244375-115244397 CACCTATAAACCCATCACCTAGG - Intergenic
1196741108 X:119026811-119026833 CACCTGTCAAACCATCACCTAGG - Intergenic
1197732209 X:129820858-129820880 CACCTATAAAGCCATCACCTAGG + Intronic
1197878879 X:131143519-131143541 CACAGATAAACCCATCAACTAGG - Intergenic
1198107863 X:133478004-133478026 CACATATAAAACAAACAGCTGGG - Intergenic
1198850909 X:140964747-140964769 CCCATTTAAATTCATCAGCCAGG - Intergenic
1198887337 X:141353934-141353956 CCCATTTTAAACCATCAGTTTGG - Intergenic
1198965558 X:142226176-142226198 CATAGTGAAAACCAGCAGCTTGG - Intergenic
1201467953 Y:14305573-14305595 CACCTATCAACCCATCAGCTTGG + Intergenic
1201497735 Y:14607297-14607319 CACCTTTCAACCCATCATCTAGG + Intronic
1201960181 Y:19672094-19672116 CACATATTAACCCATCACCTAGG - Intergenic