ID: 963233393

View in Genome Browser
Species Human (GRCh38)
Location 3:142932121-142932143
Sequence GGCCAATGAGACAGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963233393_963233401 5 Left 963233393 3:142932121-142932143 CCTGCCTTCCTGTCTCATTGGCC No data
Right 963233401 3:142932149-142932171 CTGTTCACTCCTGCTCCCTTGGG No data
963233393_963233400 4 Left 963233393 3:142932121-142932143 CCTGCCTTCCTGTCTCATTGGCC No data
Right 963233400 3:142932148-142932170 CCTGTTCACTCCTGCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963233393 Original CRISPR GGCCAATGAGACAGGAAGGC AGG (reversed) Intergenic