ID: 963235864

View in Genome Browser
Species Human (GRCh38)
Location 3:142955251-142955273
Sequence GTTCACCCATTTCCAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 519}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963235864_963235867 -3 Left 963235864 3:142955251-142955273 CCTTTGTTTGGAAATGGGTGAAC 0: 1
1: 0
2: 0
3: 17
4: 519
Right 963235867 3:142955271-142955293 AACCTCATAAGGCAGATGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 120
963235864_963235870 18 Left 963235864 3:142955251-142955273 CCTTTGTTTGGAAATGGGTGAAC 0: 1
1: 0
2: 0
3: 17
4: 519
Right 963235870 3:142955292-142955314 GGAGAAGGCCTAAATACACATGG 0: 1
1: 0
2: 0
3: 11
4: 129
963235864_963235866 -7 Left 963235864 3:142955251-142955273 CCTTTGTTTGGAAATGGGTGAAC 0: 1
1: 0
2: 0
3: 17
4: 519
Right 963235866 3:142955267-142955289 GGTGAACCTCATAAGGCAGATGG 0: 1
1: 0
2: 0
3: 6
4: 124
963235864_963235869 3 Left 963235864 3:142955251-142955273 CCTTTGTTTGGAAATGGGTGAAC 0: 1
1: 0
2: 0
3: 17
4: 519
Right 963235869 3:142955277-142955299 ATAAGGCAGATGGTTGGAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963235864 Original CRISPR GTTCACCCATTTCCAAACAA AGG (reversed) Intronic
907907557 1:58798174-58798196 CTTCACCCATGTCCCTACAAAGG - Intergenic
908201530 1:61800879-61800901 CTTCACCCATGTCCCTACAAAGG + Intronic
909211333 1:72828734-72828756 CTTCATCCATGTCCATACAAAGG - Intergenic
909403830 1:75263822-75263844 CTTCATCCATGTCCACACAAAGG - Intronic
910178993 1:84461014-84461036 ATTCACCCATTTTCAGACCATGG + Intergenic
910399023 1:86820164-86820186 GTTCATCCATGTCCCTACAAAGG - Intergenic
910823066 1:91372429-91372451 GTTCATCCATGTCCCTACAAAGG - Intronic
911309885 1:96278895-96278917 CTTCATCCATGTCCATACAAAGG + Intergenic
911394743 1:97291529-97291551 TTTCATCCATTTCCTTACAAAGG - Intronic
911715126 1:101124075-101124097 CTTCATCCATGTCCCAACAAAGG + Intergenic
912037830 1:105344144-105344166 TTTCACCCATGTCCCTACAAAGG - Intergenic
912110514 1:106335215-106335237 GTTCATCCATGTCCCTACAAAGG - Intergenic
913089569 1:115467307-115467329 GTTCATTCATTTCCAAAACAGGG + Intergenic
913152408 1:116057749-116057771 TTTCACCCATGTCCCTACAAAGG - Intronic
913160115 1:116137815-116137837 TTTCACCCATGTCCCTACAAAGG - Intergenic
913394790 1:118354586-118354608 CTTCATCCATTTCCCTACAAAGG - Intergenic
914377569 1:147085509-147085531 GTGCACCCTTCTTCAAACAATGG + Intergenic
914610672 1:149299497-149299519 CTTCACCCATGTCCCTACAAAGG - Intergenic
914979509 1:152400500-152400522 TTTCACCCATGTCCCTACAAAGG + Intergenic
915180038 1:154050568-154050590 GTTCTCCCATTTCCTATCATAGG - Intronic
916402574 1:164464932-164464954 TTTCACCCATGTCCCTACAAAGG - Intergenic
916580784 1:166106048-166106070 CTTCACCCATGTCCCTACAAAGG - Intronic
916738851 1:167630765-167630787 GTTTACCCATTTACAAACCTTGG - Intronic
916904970 1:169273358-169273380 CTTCATCCATGTCCAATCAAAGG + Intronic
917275617 1:173328196-173328218 CTTCACCCATGTCCCTACAAAGG - Intergenic
917316524 1:173731559-173731581 CTTCATCCATGTCCATACAAAGG - Intronic
917606352 1:176634283-176634305 GCTCACCCATGTCCCTACAAAGG - Intronic
918592606 1:186256894-186256916 GTTCATCCATGTCCCTACAAAGG + Intergenic
918791542 1:188836866-188836888 ATTCACCCATGTCCCTACAAAGG + Intergenic
919930464 1:202217942-202217964 TTTCACAAATATCCAAACAAGGG - Intronic
920359189 1:205400995-205401017 TTTCACCCATGTCCCTACAAAGG + Intronic
920781619 1:208997257-208997279 TTTCATCCATGTCCCAACAAAGG - Intergenic
920999893 1:211033606-211033628 TTTCATCCATTTCCCTACAAAGG - Intronic
921909952 1:220537386-220537408 GTTCATCCATGTCCCTACAAAGG + Intronic
922493511 1:226037940-226037962 CTTCACCCATTTCCCCCCAATGG + Intergenic
923222428 1:231907465-231907487 CTTCATCCATTTCCCTACAAAGG + Intronic
923676196 1:236082528-236082550 GTTCAAAAATTTCCAAACAGGGG - Intergenic
923846497 1:237738851-237738873 GTGTACCCATTTTCAAATAAAGG + Intronic
924869473 1:248025791-248025813 TTTCACCCATGTCCCTACAAAGG - Intronic
924909955 1:248499141-248499163 GTTCAGCCATTTTGAAACAATGG - Intergenic
924914148 1:248548914-248548936 GTTCAGCCATTTTGAAACAATGG + Intergenic
1063533687 10:6861885-6861907 TTTCATCCATGTCCCAACAAAGG - Intergenic
1063697132 10:8347758-8347780 GTTCATCCATGTCCCTACAAAGG + Intergenic
1064150650 10:12861435-12861457 CTTCACCCATGTCCCTACAAAGG - Intergenic
1064845291 10:19645570-19645592 CTTCACCCATGTCCCTACAAAGG - Intronic
1065214030 10:23432619-23432641 GTTAAGCTATTTACAAACAAGGG + Intergenic
1065270967 10:24033635-24033657 GTTCACCCATCTAGACACAAAGG + Intronic
1066665392 10:37777834-37777856 TTTCATCCATTTCCCTACAAAGG + Intronic
1066784635 10:38989837-38989859 CTTCATCCATGTCCATACAAAGG + Intergenic
1067810173 10:49419917-49419939 CTTCACCCATGTCCCTACAAAGG + Intergenic
1068641073 10:59408624-59408646 CTTCACCCATGTCCCTACAAAGG + Intergenic
1069084770 10:64125995-64126017 TTTCACCCATGTCCCTACAAAGG - Intergenic
1069272171 10:66542580-66542602 CTTCATCCATGTCCATACAAAGG - Intronic
1069514693 10:69068310-69068332 GTCCACCCATGTCCTGACAAAGG - Intergenic
1071884205 10:89931829-89931851 TTTCACCCATGTCCCTACAAAGG + Intergenic
1072257554 10:93634628-93634650 CTTCACCCAGTTTCACACAATGG - Intronic
1072871865 10:99128523-99128545 GTTCATCCATGTCCCTACAAAGG - Intronic
1073777109 10:106798586-106798608 CTTCACCCATGTCCCTACAAAGG + Intronic
1074012360 10:109495445-109495467 GTCCATCCCTTTCCTAACAATGG + Intergenic
1074117570 10:110468435-110468457 CTTCACCCATGTCCCTACAAAGG + Intergenic
1074925692 10:118068057-118068079 GTTCATCCATGTCCCTACAAAGG - Intergenic
1075764483 10:124881906-124881928 CTTCATCCATGTCCCAACAAAGG - Intergenic
1076964843 11:73794-73816 CTTCACCCATGTCCCTACAAAGG + Intergenic
1077393354 11:2309798-2309820 GTCCCCCCATTTGCAAACCACGG - Intronic
1077507736 11:2939948-2939970 GTTCACCCATTTGCCATCAAAGG - Intergenic
1078034680 11:7790885-7790907 CTTCACCCATGTCCCTACAAAGG - Intergenic
1078990177 11:16638204-16638226 CTTCACCCATCTCCCTACAAAGG + Intronic
1079366895 11:19817472-19817494 GTTCCCCCATTCCCAGACACTGG - Intronic
1079424193 11:20324743-20324765 CTTCACCCATGTCCCTACAAAGG + Intergenic
1079814980 11:25044901-25044923 TTTCATCCATTTCCCTACAAAGG - Intronic
1079896026 11:26119326-26119348 GTTCATCCATGTCCCTACAAAGG - Intergenic
1080903527 11:36518138-36518160 TTTCATCCATTTCCCTACAAAGG + Intronic
1080960242 11:37149514-37149536 CTTCACCCATGTCCCTACAAAGG - Intergenic
1082116147 11:48330405-48330427 TTTCATCCATTTCCCTACAAAGG + Intergenic
1082142042 11:48620297-48620319 CTTCACCCATGTCCCTACAAAGG - Intergenic
1082256745 11:50040815-50040837 TTTCACCCATGTCCCTACAAAGG - Intergenic
1082269516 11:50154674-50154696 CTTCATCCATGTCCCAACAAAGG - Intergenic
1082569203 11:54717116-54717138 CTTCACCCATGTCCCTACAAAGG - Intergenic
1082596679 11:55090212-55090234 TTTCACCCATGTCCCTACAAAGG - Intergenic
1082891099 11:58139582-58139604 CTTCATCCATGTCCCAACAAAGG + Intronic
1082967507 11:58981814-58981836 CTTCATCCATGTCCCAACAAAGG + Intronic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1086664347 11:89461000-89461022 TTTCACCCATGTCCCTACAAAGG - Intronic
1087143817 11:94792162-94792184 CTTCACCCATATCCCTACAAAGG - Intronic
1087206380 11:95400254-95400276 GTTCACCCATGTCCCTGCAAAGG + Intergenic
1087312555 11:96561419-96561441 TTTCACCCATGTCCCTACAAAGG - Intergenic
1087372309 11:97300675-97300697 GTTCATCCATGTCCCTACAAAGG + Intergenic
1087473384 11:98604956-98604978 TTTCACCCATGTCCCTACAAAGG - Intergenic
1088234806 11:107711609-107711631 GTTCATCCATTTGCAATCACTGG - Intronic
1089891452 11:121885611-121885633 ATTCACACATTTCCAAACCTAGG - Intergenic
1090117328 11:123987397-123987419 TTTCACCCATGTCCCTACAAAGG - Intergenic
1090989075 11:131799956-131799978 GTTTCCCCATTTTCAAATAAAGG - Intronic
1091196696 11:133737679-133737701 CTTCACCCATGTCCCTACAAAGG - Intergenic
1091247774 11:134113491-134113513 CTTCATCCATATCCCAACAAAGG + Intronic
1092699569 12:11212905-11212927 TTTCATCCATGTCCCAACAAAGG + Intergenic
1092804078 12:12202901-12202923 CTCTACACATTTCCAAACAAAGG + Intronic
1093979949 12:25465119-25465141 CTTCACCCATGTCCCAACAAAGG + Intronic
1094262722 12:28519868-28519890 CTTCATCCATGTCCCAACAAAGG + Intronic
1094509685 12:31088742-31088764 GGTCACCCATGTCCAAAGATTGG + Intronic
1094790372 12:33906198-33906220 GTTCATCCATGTCCCTACAAAGG + Intergenic
1095066114 12:37777540-37777562 TTTCATCCATTTCCTTACAAAGG + Intergenic
1095069513 12:37823672-37823694 TTTCACCCATGTCCCTACAAAGG + Intergenic
1095105217 12:38225805-38225827 GTTCATCCATGTCCCTACAAAGG + Intergenic
1095615247 12:44180652-44180674 TTTCACCCATGTCCCTACAAAGG + Intronic
1096372254 12:51079065-51079087 CTTCATCCATGTCCATACAAAGG - Intronic
1096890633 12:54767252-54767274 TTTCATCCATGTCCATACAAAGG + Intergenic
1098824372 12:75274870-75274892 GTTGACCGAGTTCCAAAAAATGG + Intergenic
1099276744 12:80586033-80586055 TTTCACCCATGTCCCTACAAAGG + Intronic
1099403135 12:82224782-82224804 TTTCACCCATGTCCCTACAAAGG - Intronic
1099427754 12:82545481-82545503 CTTCACCCATGTCCCTACAAAGG + Intergenic
1099493967 12:83321528-83321550 CTTCATCCATTTCCCTACAAAGG + Intergenic
1099684881 12:85871954-85871976 GTTCACCCATCTCCATAGCAAGG + Intergenic
1099900777 12:88709154-88709176 TTTCATCCATGTCCATACAAAGG + Intergenic
1100750338 12:97691609-97691631 CTTCATCCATGTCCCAACAAAGG + Intergenic
1101097019 12:101352504-101352526 TTTCATCCATGTCCATACAAAGG - Intronic
1101780451 12:107830044-107830066 CTTCATCCATGTCCATACAAAGG + Intergenic
1106862531 13:33926050-33926072 TTTCATCCATGTCCCAACAAAGG - Intronic
1107204216 13:37762559-37762581 TTTCATCCATGTCCATACAAAGG - Intronic
1108763610 13:53600066-53600088 TTTCACCCATGTCCCTACAAAGG - Intergenic
1109051191 13:57483292-57483314 CTTCAACCATGTCCATACAAAGG - Intergenic
1109399507 13:61807217-61807239 TTTCACCCATGTCCCTACAAAGG - Intergenic
1109964842 13:69678888-69678910 CTTCACCCATGTCCCTACAAAGG + Intergenic
1110257994 13:73453283-73453305 CTTCATCCATTTCCCCACAAAGG + Intergenic
1110414918 13:75241452-75241474 CTTCATCCATGTCCATACAAAGG + Intergenic
1111067216 13:83109319-83109341 GTTCACACACTTGCAAACAAAGG - Intergenic
1111296830 13:86290155-86290177 CTTCATCCATGTCCATACAAAGG + Intergenic
1111647598 13:91050039-91050061 GTTCATCCATGTCCCTACAAAGG + Intergenic
1111793762 13:92891417-92891439 CTTCACCCATGTCCCTACAAAGG - Intergenic
1112347494 13:98602603-98602625 CTTCACCCATGTCCCTACAAAGG - Intergenic
1113362438 13:109643824-109643846 CTTCACCCATGTCCCTACAAAGG + Intergenic
1113365128 13:109668954-109668976 GTCCTGCCATTTGCAAACAAAGG + Intergenic
1114347719 14:21814332-21814354 CTTCATCCATGTCCCAACAAAGG - Intergenic
1114815146 14:25948604-25948626 TTTCATCCATGTCCCAACAAAGG - Intergenic
1115478810 14:33841771-33841793 GTTTACCCACTTTCAAACATGGG - Intergenic
1115719307 14:36142956-36142978 TTTCACCCATGTCCCTACAAAGG + Intergenic
1116337436 14:43675247-43675269 CTTCACCCATGTCCCTACAAAGG + Intergenic
1116671872 14:47852503-47852525 GTTCACACATTTCCTCTCAAAGG - Intergenic
1116974200 14:51097315-51097337 GTTCACCCTGTTCCAAACAGGGG + Intergenic
1117044050 14:51794901-51794923 TTTCACCCATGTCCCTACAAAGG + Intergenic
1117489714 14:56234443-56234465 CTTCACCCATGTCCCTACAAAGG - Intronic
1117846203 14:59914211-59914233 CTTCACCCATGTCCCTACAAAGG + Intergenic
1118097985 14:62561000-62561022 CTTCATCCATGTCCATACAAAGG - Intergenic
1119093917 14:71811375-71811397 CTTCATCCATTTCCCTACAAAGG - Intergenic
1120149725 14:81019758-81019780 CTTCACCCATGTCCCCACAAAGG + Intronic
1120496490 14:85243711-85243733 GTTCATCCATTTCCAATGGAGGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG + Intergenic
1123221718 14:106863630-106863652 TTTCACCCATGTCCCTACAAAGG + Intergenic
1123885855 15:24727712-24727734 GTTCAGGCATTTGCAAACCATGG + Intergenic
1123893091 15:24801118-24801140 ATTCTCACAATTCCAAACAAAGG - Intergenic
1126502366 15:49359931-49359953 TTTCATCCATGTCCATACAAAGG - Intronic
1126630610 15:50730936-50730958 CTTCACCCATTTCAAAAATATGG + Intronic
1127761552 15:62144748-62144770 TTTCACCCATGTCCCTACAAAGG - Intergenic
1128704531 15:69828971-69828993 GTTTCCCCATTTTAAAACAAAGG + Intergenic
1128960539 15:71998877-71998899 TTTCACCCATGTCCCTACAAAGG + Intronic
1129572656 15:76705240-76705262 TTTCACCCATGTCCCTACAAAGG - Intronic
1129768801 15:78189513-78189535 TTTCACCCATGTCCCTACAAAGG - Intronic
1130187937 15:81702857-81702879 GTTCATCCATGTCCCTACAAAGG - Intergenic
1130264722 15:82389966-82389988 CTTCACCCATGTCCCTACAAAGG + Intergenic
1130283181 15:82534705-82534727 CTTCATCCATGTCCATACAAAGG - Intergenic
1131206468 15:90452605-90452627 GTTCACCCTTCTTCAGACAAAGG + Intronic
1131834804 15:96379773-96379795 CTTCACCCATGTCCCTACAAAGG + Intergenic
1131912346 15:97221806-97221828 GTTCATCCATGTCCCTACAAAGG - Intergenic
1133571524 16:7045177-7045199 GGACTCCCACTTCCAAACAAAGG + Intronic
1134411033 16:14003440-14003462 GTTCTCTGATTTCCAAACCACGG - Intergenic
1134567927 16:15266886-15266908 GTTTCCCCATCTACAAACAAGGG + Intergenic
1134734508 16:16489467-16489489 GTTTCCCCATCTACAAACAAGGG - Intergenic
1134932958 16:18222439-18222461 GTTTCCCCATCTACAAACAAGGG + Intergenic
1138142517 16:54581057-54581079 CTTCATCCATTTCCCTACAAAGG - Intergenic
1138788170 16:59870542-59870564 CTTCACCCATGTCCCTACAAAGG + Intergenic
1140694945 16:77523607-77523629 TTTCACCCATGTCCCTACAAAGG - Intergenic
1142963911 17:3568959-3568981 CTTCACCCATGTCCCTACAAAGG - Intronic
1143258168 17:5578953-5578975 CTTCATCCATTTCCCTACAAAGG - Intronic
1144048792 17:11479302-11479324 CTTCATCCATGTCCTAACAAAGG - Intronic
1144355228 17:14438935-14438957 TTGAACCCATTTCCAAACAATGG - Intergenic
1145829141 17:27900965-27900987 TTTCACCCATGTCCCTACAAAGG + Intergenic
1147470257 17:40651942-40651964 GTTCATCCTTTTCCACACCATGG - Intergenic
1147901966 17:43792794-43792816 CTTCATCCATTTCCCTACAAAGG + Intergenic
1150944990 17:69735365-69735387 GATCACTCATCTCCAAACAAAGG + Intergenic
1153408415 18:4766433-4766455 TTTCACCCATGTCCCTACAAAGG + Intergenic
1154288862 18:13087020-13087042 GTTCCTCCATATCCAGACAAAGG - Exonic
1157151870 18:45226511-45226533 CTTCATCCATGTCCCAACAAAGG - Intronic
1157960185 18:52144755-52144777 CTTCACCCATGTCCCTACAAAGG + Intergenic
1158486766 18:57874203-57874225 CTTCATCCATTTCCCTACAAAGG - Intergenic
1159476072 18:68922350-68922372 GTTCAACAATTTCCAAACTAGGG - Intronic
1159635303 18:70798187-70798209 GTTCATCCATGTCCCTACAAAGG - Intergenic
1159900897 18:74044664-74044686 TTTCACCCATGTCCCTACAAAGG - Intergenic
1160641648 19:143424-143446 CTTCACCCATGTCCCTACAAAGG + Intergenic
1162246183 19:9403437-9403459 CTTCATCCATGTCCCAACAAAGG - Intergenic
1163164947 19:15489703-15489725 CTTCACCCATGTCCCTACAAAGG + Intronic
1164094078 19:21989381-21989403 TTTCATCCATGTCCCAACAAAGG + Intronic
1164110742 19:22155805-22155827 CTTCATCCATTTCCCTACAAAGG + Intergenic
1164390359 19:27814492-27814514 TTTCACCCATGTCCATACAAAGG - Intergenic
1166097108 19:40547328-40547350 CTTCACCCATGTCCCTACAAAGG + Intronic
1166591126 19:44000210-44000232 CTTCATCCATGTCCATACAAAGG + Intergenic
1167094314 19:47366008-47366030 GTGGGCCCATTTCCAAAAAATGG + Intronic
926068739 2:9866778-9866800 CTTCACCCATGTCCCTACAAAGG - Intronic
926974903 2:18504889-18504911 GTTCATCCATATCCCTACAAAGG + Intergenic
928462958 2:31492544-31492566 CTTCACCCATGTCCCCACAAAGG - Intergenic
928486810 2:31740460-31740482 CTTCATCCATGTCCATACAAAGG + Intergenic
928795887 2:35018270-35018292 CTTCATCCATGTCCCAACAAAGG - Intergenic
928860392 2:35850322-35850344 CTTCACCCATGTCCCTACAAAGG - Intergenic
930081701 2:47454980-47455002 CTTCATCCATTTCCCTACAAAGG + Intronic
930260027 2:49134757-49134779 TTTCATCCATGTCCATACAAAGG - Intronic
930433591 2:51313015-51313037 TTTCATCCATGTCCATACAAAGG + Intergenic
930598317 2:53414391-53414413 GTTCATCCATGTCCCTACAAAGG - Intergenic
931498822 2:62841182-62841204 TTTCATCCATGTCCATACAAAGG - Intronic
931827046 2:66011817-66011839 GTTCCCTCATTTGCAAAAAAGGG + Intergenic
931952788 2:67383743-67383765 TTTCACCCATGTCCCTACAAAGG - Intergenic
932361253 2:71108159-71108181 GTTTATCCATTACTAAACAAGGG + Intergenic
934632709 2:95946750-95946772 TTTCACCCATGTCCCTACAAAGG - Intronic
934693923 2:96384810-96384832 TTTCACCCATGTCCCTACAAAGG - Intergenic
934800794 2:97156519-97156541 TTTCACCCATGTCCCTACAAAGG + Intronic
935952005 2:108338410-108338432 TTTCACCCATGTCCCTACAAAGG - Intergenic
937479183 2:122241469-122241491 GTGCAGCCATTTTCAAACGAAGG + Intergenic
938782266 2:134595414-134595436 CTTCATCCATTTCCCTACAAGGG + Intronic
938857085 2:135324380-135324402 CTTCATCCATGTCCCAACAAAGG + Intronic
939270084 2:139928085-139928107 TTTCATCCATTTCCCTACAAAGG + Intergenic
939292935 2:140218759-140218781 CTTCATCCATGTCCCAACAAAGG + Intergenic
939838350 2:147156650-147156672 TTTCATCCATGTCCATACAAAGG - Intergenic
940413908 2:153398221-153398243 TTTCACCCATGTCCCTACAAAGG + Intergenic
941237073 2:162988111-162988133 CTTCACCCATGTCCCTACAAAGG - Intergenic
942216881 2:173729786-173729808 CTTCACCCATGTCCCTACAAAGG + Intergenic
942343963 2:174982096-174982118 CTTCACCCATGTCCCTACAAAGG + Intronic
942436794 2:175987365-175987387 TTTCATCCATGTCCATACAAAGG - Intronic
942534823 2:176951927-176951949 TTTCATCCATGTCCCAACAAAGG - Intergenic
943007518 2:182403676-182403698 GTTCACCCATGTCCCTGCAAAGG - Intronic
943054693 2:182961421-182961443 CTTCACCCATGTCCCTACAAAGG - Intronic
943160726 2:184246442-184246464 CTTCATCCATGTCCCAACAAAGG - Intergenic
943377600 2:187099009-187099031 CTTCATCCATGTCCATACAAAGG + Intergenic
943766897 2:191672892-191672914 CTTCACCCATGTCCCTACAAAGG - Intergenic
943999280 2:194811719-194811741 CTTCACCCATGTCCCTACAAAGG - Intergenic
944124478 2:196277820-196277842 CTTCACCCATGTCCCTACAAAGG - Intronic
944604060 2:201333703-201333725 CTTCACCCATGTCCCTACAAAGG + Intronic
944623467 2:201544157-201544179 CTTCATCCATTTCCCTACAAAGG + Intronic
945917333 2:215717805-215717827 GCTCACCCATTGCCAAATGACGG + Intergenic
946570066 2:221014562-221014584 GTTCACACATTCCCAAAGAGTGG + Intergenic
946983723 2:225248206-225248228 CTTCACCCATGTCCCTACAAAGG - Intergenic
947207884 2:227679053-227679075 TTTCACCCATGTCCCTACAAAGG - Intergenic
947969858 2:234313794-234313816 GTTCAACCATAGCAAAACAAAGG - Intergenic
948026396 2:234781326-234781348 CTTCATCCATGTCCATACAAAGG - Intergenic
948553177 2:238789324-238789346 GTTCACCCATGTCTGAACACTGG - Intergenic
948967728 2:241397026-241397048 TTTCACCCATGTCCCTACAAAGG - Intronic
1169883504 20:10372824-10372846 TTTCATCCATGTCCATACAAAGG + Intergenic
1170459512 20:16564233-16564255 CTTCACCCATGTCCCTACAAAGG + Intronic
1171073072 20:22094187-22094209 CTTCACCCATGTCCCTACAAAGG + Intergenic
1171076779 20:22135019-22135041 CTTCATCCATGTCCCAACAAAGG - Intergenic
1171274145 20:23841308-23841330 CTTCATCCATGTCCATACAAAGG - Intergenic
1171575544 20:26309766-26309788 GATATCCCATTTCCAAAGAAGGG - Intergenic
1171772648 20:29336296-29336318 GTTCATCCATGTCCCTACAAAGG - Intergenic
1171786138 20:29466447-29466469 CTTCACCCATGTCCCTACAAAGG + Intergenic
1172094303 20:32453155-32453177 GTTCCCTCATTTGCAAACCAGGG + Intronic
1173771263 20:45660715-45660737 TTTCACCCATGTCCCTACAAAGG + Intronic
1174727305 20:52876662-52876684 CTTCACCCATGTCCCTACAAAGG - Intergenic
1174922978 20:54724577-54724599 CTTCATCCATTTCCATGCAAAGG + Intergenic
1176593751 21:8671695-8671717 CTTCATCCATGTCCATACAAAGG + Intergenic
1177132676 21:17277243-17277265 CTTCACCCATGTCCCTACAAAGG - Intergenic
1177478929 21:21660791-21660813 TTTCACCCATGTCCCTACAAAGG + Intergenic
1179003630 21:37487900-37487922 GGTGACCCATTTCCATTCAAGGG + Intronic
1179173994 21:38994150-38994172 GTCCACCCATTCCCAAGAAAAGG + Intergenic
1179428460 21:41301899-41301921 GTTCCCTCACTTCGAAACAAGGG + Intergenic
1180276599 22:10648823-10648845 CTTCATCCATGTCCATACAAAGG + Intergenic
1180396556 22:12350991-12351013 TTTCATCCATGTCCCAACAAAGG + Intergenic
1180397535 22:12367508-12367530 TTTCATCCATGTCCCAACAAAGG - Intergenic
1180402185 22:12496627-12496649 TTTCATCCATGTCCCAACAAAGG + Intergenic
1180403159 22:12513138-12513160 TTTCATCCATGTCCCAACAAAGG - Intergenic
1182832942 22:33318409-33318431 CTTCACCCATGTCCCTACAAAGG + Intronic
1182875989 22:33691321-33691343 TTTCACCCATTTCTAAAAGATGG + Intronic
1184537460 22:45096938-45096960 GTTCGCCCATGTCAAAGCAAAGG - Intergenic
1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG + Exonic
949154811 3:815085-815107 TTTCATCCATTTCCCTACAAAGG - Intergenic
949244738 3:1913804-1913826 CTTCACCCATGTCCCTACAAAGG + Intergenic
949407031 3:3725071-3725093 TTTCACCCATGTCCCTACAAAGG - Intronic
951067626 3:18285617-18285639 TTTCTCTCATTTACAAACAAGGG + Intronic
951572453 3:24079249-24079271 CTTCACCCATGTCCCTACAAAGG + Intergenic
951747950 3:25999879-25999901 CTTCACCCATGTCCCGACAAAGG + Intergenic
951769454 3:26239379-26239401 TTTCACCCATGTCCCTACAAAGG + Intergenic
952575455 3:34768917-34768939 CTTCACCCATGTCCCTACAAAGG - Intergenic
954828458 3:53396968-53396990 CTTCACCCATGTCCCTACAAAGG - Intergenic
957037553 3:75308933-75308955 TTTCACCCATTTAAAAAAAAAGG - Intergenic
957118551 3:76058948-76058970 CTTCACCCATGTCCCTACAAAGG + Intronic
957195041 3:77057153-77057175 CTTCATCCATTTCCCTACAAAGG - Intronic
958863804 3:99476750-99476772 CTTCACCCATGTCCCTACAAAGG + Intergenic
959169351 3:102825878-102825900 CTTCATCCATGTCCCAACAAAGG - Intergenic
959199383 3:103226154-103226176 GTTCATCCATGTCCCTACAAAGG - Intergenic
959235057 3:103710237-103710259 TTTCACCCATGTCCCTACAAAGG + Intergenic
959632356 3:108521715-108521737 GTTTACCCATTTACAATCACTGG - Intronic
962621209 3:137181599-137181621 GTTTTCCCACTTCCAGACAAGGG - Intergenic
962711776 3:138092675-138092697 GTCCTCCCAAGTCCAAACAATGG - Intronic
962818837 3:139026922-139026944 GTTCATCCATGTCCCTACAAAGG + Intronic
962844999 3:139266416-139266438 GTGCAGCCATTTGCAAACTAGGG - Intronic
963050177 3:141135641-141135663 CTTCATCCATTTCCCTACAAAGG + Intronic
963235864 3:142955251-142955273 GTTCACCCATTTCCAAACAAAGG - Intronic
963246388 3:143067573-143067595 GTTTGCCCCTTTCCCAACAAGGG + Intergenic
963979017 3:151515310-151515332 CTTCATCCATGTCCATACAAAGG - Intergenic
965159280 3:165110600-165110622 TTTCACCCATGTCCCTACAAAGG - Intergenic
965238167 3:166156023-166156045 CTTCATCCATGTCCCAACAAAGG + Intergenic
965487387 3:169294523-169294545 GTTTACCCAGCTCCATACAATGG - Intronic
965617356 3:170608281-170608303 GCTCACACATTGGCAAACAAGGG + Intronic
967211023 3:187169153-187169175 GTTCACCTATTTTCAAACCATGG + Intronic
967288771 3:187898953-187898975 GTTCATCCCTTTACAAAAAAAGG - Intergenic
967333150 3:188312826-188312848 GTTCATCCATGTCCCTACAAAGG - Intronic
967825765 3:193876177-193876199 GTTCACTCATTTGGAAACCAAGG - Intergenic
968740126 4:2323842-2323864 TTTCATCCATTTCCCTACAAAGG + Intronic
969846035 4:9920726-9920748 GTTTTCCCATTTTTAAACAAGGG - Intronic
970282334 4:14471488-14471510 CTTCACCCATGTCCCTACAAAGG + Intergenic
970341567 4:15112831-15112853 TTTCACCCATGTCCCTACAAAGG + Intergenic
970497998 4:16646810-16646832 GTTCACATAGTTACAAACAATGG + Intronic
970989887 4:22200532-22200554 ATACACCCATCTCCAAACCAAGG - Intergenic
971480177 4:27107924-27107946 CTTCATCCATGTCCCAACAAAGG - Intergenic
972880366 4:43415586-43415608 GTTCATCCATGTCCCTACAAAGG + Intergenic
973097112 4:46215976-46215998 GTTCATCCATGTCCCTACAAAGG - Intergenic
973098493 4:46231682-46231704 GTTCATCCATGTCCCTACAAAGG + Intergenic
973098814 4:46235897-46235919 TTTCACCCATGTCCCTACAAAGG + Intergenic
973314443 4:48745445-48745467 GTTCATCCATGTCCCTACAAAGG - Intronic
974245135 4:59304683-59304705 TTTCATCCATGTCCCAACAAAGG - Intergenic
974256015 4:59456453-59456475 CTTCACCCATGTCCCTACAAAGG + Intergenic
974264660 4:59569407-59569429 CTTCACCCATGTCCCTACAAAGG - Intergenic
974331160 4:60480843-60480865 TTTCACCCATGTCCCTACAAAGG + Intergenic
975258570 4:72269394-72269416 CTTCACCCATATCCCTACAAAGG - Intergenic
975426939 4:74240760-74240782 GATGACCCATTTCCAATCACTGG + Intronic
975657084 4:76652436-76652458 ATGCACCCATCTCCAAACATTGG + Intronic
976024429 4:80670287-80670309 GTTCACCCATGTCCCTGCAAAGG + Intronic
976394338 4:84539786-84539808 GTTCATCCATGTCCCTACAAAGG + Intergenic
976594985 4:86886955-86886977 CTTCACCCATGTCCCTACAAAGG - Exonic
977150351 4:93503624-93503646 CTTCACCCATGTCCCTACAAAGG + Intronic
977291680 4:95171537-95171559 TTTCACCCATGTCCCTACAAAGG + Intronic
977778936 4:100957336-100957358 TTTCACCCATGTCCCTACAAAGG + Intergenic
977900311 4:102414965-102414987 CTTCACCCATGTCCCTACAAAGG - Intronic
977998860 4:103530979-103531001 GTTCATCCATGTCCCTACAAAGG - Intergenic
978059617 4:104321781-104321803 TTTCATCCATGTCCCAACAAAGG + Intergenic
978175726 4:105730041-105730063 CTTCACCCATGTCCCTACAAAGG + Intronic
978413563 4:108451635-108451657 CTTCATCCATGTCCATACAAAGG + Intergenic
979225613 4:118280866-118280888 TTTCCCCCATTTGAAAACAAGGG + Exonic
979660080 4:123243439-123243461 CTTCATCCATGTCCCAACAAAGG - Intronic
980011027 4:127594641-127594663 TTTCACCCATGTCCCTACAAAGG - Intergenic
981096052 4:140782976-140782998 CTTCACCCATGTCCCTACAAAGG + Intergenic
981502059 4:145462542-145462564 CTTCACCCATGTCCCTACAAAGG - Intergenic
983117192 4:163832889-163832911 GTTCATCCATGTCCCTACAAAGG + Intronic
983614396 4:169686015-169686037 CTTCATCCATGTCCCAACAAAGG - Intronic
985235839 4:187872970-187872992 TTTCACCCATGTCCCTACAAAGG + Intergenic
985352651 4:189082747-189082769 GTACACCCCTTTCCAAAACAGGG - Intergenic
986437948 5:7753254-7753276 ATTCATCCATTAACAAACAAGGG - Intronic
989072720 5:37528321-37528343 CTTCATCCATGTCCATACAACGG - Intronic
989448992 5:41564829-41564851 CTTCATCCATGTCCCAACAAAGG + Intergenic
989834589 5:45970848-45970870 TTTCATCCATTTCCCTACAAAGG - Intergenic
989835373 5:45982069-45982091 CTTCACCCATTTCCCTACAAAGG - Intergenic
990065047 5:51701921-51701943 CTTCACCCATGTCCCTACAAAGG - Intergenic
990314187 5:54568532-54568554 CTTCCCCCATTTCCAAAGGAAGG + Intergenic
990710855 5:58578622-58578644 CTTCATCCATGTCCAAACAAAGG - Intergenic
991032455 5:62096871-62096893 CTTCACCCATGTCCCTACAAAGG - Intergenic
991169066 5:63599785-63599807 TTTCACCCATGTCCCTACAAAGG + Intergenic
991180834 5:63748772-63748794 CTTCATCCATGTCCATACAAAGG - Intergenic
991233000 5:64358933-64358955 TTTCACCCATGTCCCTACAAAGG + Intronic
991379705 5:66007231-66007253 CTTCACCCATGTCCCTACAAAGG - Intronic
991551172 5:67837422-67837444 CTTCACCCATGTCCCTACAAAGG - Intergenic
991553220 5:67866294-67866316 CTTCACCCATGTCCCTACAAAGG + Intergenic
991556348 5:67898891-67898913 GTCAACCCATTTCAAATCAAGGG - Intergenic
992310166 5:75490038-75490060 GTTCATCCATGTCCCTACAAAGG - Intronic
992658287 5:78932092-78932114 TTTCACCCAATTCCAAAAGATGG + Intronic
993006084 5:82429700-82429722 TTTCATCCATGTCCATACAAAGG + Intergenic
993170992 5:84418883-84418905 CTTCACCCATGTCCCTACAAAGG + Intergenic
993255234 5:85582535-85582557 GTTCATCCATGTCCAAGCAAAGG + Intergenic
994321148 5:98396370-98396392 TTTCACCCATGTCCCTACAAAGG - Intergenic
994333249 5:98532913-98532935 CTTCATCCATGTCCATACAAAGG + Intergenic
994437200 5:99752175-99752197 ATTCTCCCATTTCAAAAAAAAGG - Intergenic
994928272 5:106147388-106147410 CTTCACCCATGTCCCTACAAAGG - Intergenic
995210756 5:109535290-109535312 TTTCACCCATGTCCCTACAAAGG - Intergenic
995307674 5:110673145-110673167 CTTCACCCATGTCCCTACAAAGG - Intronic
995321143 5:110835600-110835622 CTTCACCCATGTCCCTACAAAGG - Intergenic
995339010 5:111035537-111035559 CTTCACCCATGTCCCTACAAAGG - Intergenic
995340168 5:111049246-111049268 CTTCACCCATGTCCCTACAAAGG + Intergenic
995698171 5:114903066-114903088 GTTCATCCATGTCCCTACAAAGG + Intergenic
996056973 5:118992227-118992249 CTTCACCCATGTCCCTACAAAGG + Intergenic
996320501 5:122210235-122210257 CTTCACCCATGTCCCTACAAAGG - Intergenic
996989410 5:129610588-129610610 CTTCACCCATGTCCCCACAAAGG + Intronic
997112731 5:131092978-131093000 CTTCACCCATGTCCCTACAAAGG - Intergenic
997776423 5:136611508-136611530 TTTCATCCATGTCCCAACAAAGG - Intergenic
998748994 5:145296490-145296512 TTTCATCCATGTCCATACAAAGG + Intergenic
998783401 5:145683228-145683250 GTTCTCCCATTTGCAAAATAAGG + Intronic
1000464048 5:161553438-161553460 TTTCACCCATGTCCCTACAAAGG + Intronic
1000563810 5:162823435-162823457 CTTCACCCATGTCCCTACAAAGG + Intergenic
1002997695 6:2302698-2302720 CTTCACCCATGTCCCTACAAAGG - Intergenic
1003431051 6:6037801-6037823 CTTCATCCATGTCCATACAAAGG + Intergenic
1003813977 6:9816456-9816478 TTTCACCCATGTCCCTACAAAGG - Intronic
1004326465 6:14678320-14678342 GTTCATCCATTTCCAAATCGAGG + Intergenic
1004549965 6:16637188-16637210 CTTCATCCATGTCCCAACAAAGG - Intronic
1004832067 6:19487571-19487593 TTTCATCCATTTCCCTACAAAGG - Intergenic
1004876278 6:19958071-19958093 CTTCACCCATGTCCCTACAAAGG - Intergenic
1006139755 6:31921115-31921137 CCCCACCCATTTCCACACAAAGG - Intronic
1006163855 6:32053318-32053340 GTTCACCCATCACCAGAGAAAGG + Intronic
1006210428 6:32388980-32389002 GTTCATCCATGTCCCTACAAAGG - Intergenic
1009064695 6:58445000-58445022 TTTCACCCATGTCCCTACAAAGG + Intergenic
1009475012 6:64079867-64079889 CTTCATCCATGTCCCAACAAAGG + Intronic
1009717701 6:67422159-67422181 TTTCAACCATTTCAAAATAAAGG + Intergenic
1009808177 6:68629246-68629268 TTTCATCCATGTCCATACAAAGG - Intergenic
1010117969 6:72337889-72337911 CTTCATCCATGTCCATACAAAGG + Intronic
1010392804 6:75356342-75356364 GGTCACCTATTCCTAAACAAGGG - Intronic
1010546745 6:77167380-77167402 CTTCACCCATGTCCCTACAAAGG + Intergenic
1010844567 6:80689036-80689058 CTTCATCCATTTCCCTACAAAGG - Intergenic
1010852967 6:80800790-80800812 TTTCATCCATGTCCCAACAAAGG + Intergenic
1010857107 6:80853452-80853474 TTTCATCCATGTCCCAACAAAGG - Intergenic
1010904741 6:81473850-81473872 TTTCATCCATTTCCCTACAAAGG - Intergenic
1011926030 6:92645770-92645792 CTTCACCCATGTCCCTACAAAGG - Intergenic
1012214302 6:96562642-96562664 GTTCCCCAATTTCCCAAGAAGGG + Exonic
1012356313 6:98318413-98318435 CTTCATCTATTTCCCAACAAAGG + Intergenic
1012533926 6:100272737-100272759 CTTCATCCATTTCCCTACAAAGG - Intergenic
1012714636 6:102652648-102652670 CTTCACCCATGTCCCTACAAAGG + Intergenic
1013403483 6:109821016-109821038 GTTCACCCAATTCAATACCAGGG + Intronic
1014857399 6:126418773-126418795 CTTCACCCATGTCCCTACAAGGG - Intergenic
1015714000 6:136171936-136171958 TTTCACCCATGTCCCTACAAAGG + Intronic
1015800036 6:137051406-137051428 ATTCTGCAATTTCCAAACAATGG - Intergenic
1016184488 6:141182353-141182375 TTTCACCCATGTCCCTACAAAGG - Intergenic
1018114336 6:160568848-160568870 GTTCATCCATGTCCCTACAAAGG - Intronic
1021302065 7:18985368-18985390 TTTCATCCATGTCCATACAAAGG + Intronic
1023533655 7:41185065-41185087 GTTCACCAAGTTCCCAACATTGG + Intergenic
1023712377 7:43008691-43008713 GGTCACCCATTTCCCAAACAAGG + Intergenic
1024437815 7:49379923-49379945 CTTCAGCCATGTCCATACAAAGG + Intergenic
1024512876 7:50217021-50217043 GTACAGCCATTTCCAAGCACAGG + Intergenic
1024813833 7:53244530-53244552 CTTCATCCATGTCCATACAAAGG - Intergenic
1026651564 7:72220340-72220362 TTTCACCCATGTCCCTACAAAGG + Intronic
1026659450 7:72286994-72287016 GTGCATGCATTTGCAAACAAAGG + Intronic
1027539155 7:79446008-79446030 CTTCACCCATGTCCCTACAAAGG - Intronic
1027792811 7:82654676-82654698 CTTCACCCATGTCCCTACAAAGG - Intergenic
1028821349 7:95215270-95215292 CTTCATCCATGTCCCAACAAAGG + Intronic
1030287553 7:107842007-107842029 CTTCACCCATGTCCCTACAAAGG - Intergenic
1030519816 7:110584669-110584691 TTTCACCCATGTCCCTACAAAGG - Intergenic
1030801875 7:113862131-113862153 CTTCACCCATGTCCCAGCAAAGG - Intergenic
1031424228 7:121586101-121586123 CTTCATCCATGTCCATACAAAGG + Intergenic
1031818523 7:126470489-126470511 TTTCATCCATTTCCCTACAAAGG + Intronic
1034055282 7:148028206-148028228 TTTCACCCATTTGCAATCACTGG + Intronic
1034168204 7:149042200-149042222 GGTACCCCAATTCCAAACAAAGG - Intergenic
1034360562 7:150493603-150493625 TTTCACCCATGTCCCTACAAAGG + Intergenic
1034692359 7:153023908-153023930 TTTCACCCATGTCCCTACAAAGG - Intergenic
1035961349 8:4141522-4141544 TTTCACACATGTACAAACAAAGG + Intronic
1036974352 8:13394270-13394292 TTATACCCATTTTCAAACAAGGG - Intronic
1036989020 8:13570594-13570616 TTTCACCCATGTCCCTACAAAGG + Intergenic
1037176813 8:15957126-15957148 TTTCACCCATGTCCCTACAAAGG + Intergenic
1038264442 8:26027065-26027087 GTTTACCCATTTCCGAGGAATGG + Intronic
1040445652 8:47490688-47490710 CTTCACCCATGTCCCTACAAAGG - Intronic
1040707617 8:50148699-50148721 CTTCATCCATGTCCATACAAAGG + Intronic
1042619099 8:70685187-70685209 TTTCACCCATGTCCCTACAAAGG - Intronic
1043617394 8:82143732-82143754 GTTCATCCATGTCCCTACAAAGG + Intergenic
1043752065 8:83950248-83950270 CTTCATCCATGTCCATACAAAGG - Intergenic
1044140691 8:88647811-88647833 TTTCACCCATATCCCTACAAAGG - Intergenic
1044284304 8:90393683-90393705 GTTCATCCATGTCCCTACAAGGG + Intergenic
1044557804 8:93583542-93583564 GCTCACGCATTTTCAAACATGGG + Intergenic
1046006704 8:108494738-108494760 CTTCATCCATGTCCCAACAAAGG + Intergenic
1046425449 8:114042515-114042537 TTTCACCCATGTCCCTACAAAGG + Intergenic
1046880027 8:119297873-119297895 TTTCACCCATGTCCCTACAAAGG - Intergenic
1047317308 8:123746379-123746401 CTTCATCCATGTCCCAACAAAGG - Intergenic
1047736446 8:127769455-127769477 CTTCACCCATATCCCTACAAAGG + Intergenic
1048248710 8:132839012-132839034 GTTCATCCAGTTCAAAACAAAGG + Intronic
1050115703 9:2261124-2261146 GAACACCCAAGTCCAAACAATGG + Intergenic
1050776106 9:9262608-9262630 ATTCATCCATTTCTATACAAGGG - Intronic
1050857433 9:10377590-10377612 CTTCACCCATGTCCCTACAAAGG + Intronic
1052631873 9:31051769-31051791 CTTCACCCATGTCCCTACAAAGG + Intergenic
1052656815 9:31373818-31373840 CTTCACCCATGGCCCAACAAAGG + Intergenic
1053041044 9:34872505-34872527 TTTCACCCATGTCCCTACAAAGG + Intergenic
1053834536 9:42120664-42120686 CTTCACCCATGTCCCTACAAAGG - Intronic
1055540504 9:77299766-77299788 CTTCATCCATGTCCCAACAAAGG - Intronic
1055728164 9:79253895-79253917 GCTCACCCATTTCCACATCAGGG - Intergenic
1055827645 9:80345960-80345982 TTTCATCCATGTCCCAACAAAGG - Intergenic
1055996207 9:82162584-82162606 CTTCATCCATGTCCCAACAAAGG + Intergenic
1056162172 9:83907552-83907574 CTTCTCCCATTTCCAACAAATGG + Intronic
1056358167 9:85823929-85823951 CTTCTCCCATTTCCAACAAATGG - Intergenic
1058146375 9:101416223-101416245 CTTCACCCATGTCCCTACAAAGG + Intergenic
1058623468 9:106908820-106908842 GTTAACAAATTTCCAAATAAAGG - Intronic
1059265961 9:113030925-113030947 CTTCATCCATGTCCCAACAAAGG - Intergenic
1059513597 9:114872076-114872098 TTTCATCCATGTCCATACAAAGG - Intergenic
1059541230 9:115132551-115132573 CTCCAGTCATTTCCAAACAATGG - Intergenic
1059904887 9:118971607-118971629 CTTCATCCATGTCCATACAAAGG - Intergenic
1060319149 9:122539413-122539435 CTTCACCCATGTCCCTACAAAGG + Intergenic
1061252381 9:129434041-129434063 TTTCACCCATGTCCAAACTGTGG + Intergenic
1061312504 9:129773295-129773317 CTTGACCCATTTGCAGACAAGGG + Intergenic
1062759679 9:138333668-138333690 CTTCACCCATGTCCCTACAAAGG - Intergenic
1203465913 Un_GL000220v1:86888-86910 CTTCATCCATGTCCACACAAAGG - Intergenic
1203623884 Un_KI270749v1:151925-151947 CTTCATCCATGTCCATACAAAGG + Intergenic
1185497643 X:567432-567454 CTTCATCCATTTCCCTACAAAGG + Intergenic
1186230839 X:7451797-7451819 CTTCATCCATTTCCCTACAAAGG + Intergenic
1188292091 X:28401883-28401905 CTTCACCCATGTCCCTACAAAGG - Intergenic
1188718786 X:33498401-33498423 TTTCACCCATGTCCCTACAAAGG - Intergenic
1189151618 X:38714598-38714620 CTTCATCCATGTCCATACAAAGG + Intergenic
1189970159 X:46410188-46410210 CTTCACCCATGTCCCTACAAAGG + Intergenic
1190506682 X:51133429-51133451 GTTCACACAGATCCAAACACTGG - Intergenic
1190921147 X:54853810-54853832 CTTCACCCATGTCCCTACAAAGG + Intergenic
1191071488 X:56405253-56405275 CTTCATCCATGTCCCAACAAAGG + Intergenic
1191134829 X:57052448-57052470 TTTCATCCATTTCCCTACAAAGG + Intergenic
1191198405 X:57749946-57749968 TTTCACCCATGTCCCTACAAAGG - Intergenic
1191751913 X:64551918-64551940 CTTCACCCATGTCCCTACAAAGG + Intergenic
1191765146 X:64690265-64690287 CTTCATCCATTTCCCTACAAAGG + Intergenic
1191926324 X:66314678-66314700 CTTCACCCATGTCCCTACAAAGG + Intergenic
1191990685 X:67032010-67032032 CTTCACCCATGTCCCTACAAAGG - Intergenic
1192010040 X:67259530-67259552 CTTCATCCATTTCCCTACAAAGG - Intergenic
1192720864 X:73696470-73696492 CTTCATCCATGTCCATACAAAGG - Intergenic
1192978628 X:76315042-76315064 CTTCACCCATGTCCCTACAAAGG + Intergenic
1192980990 X:76341192-76341214 CTTCACCCATGTCCCTACAAAGG - Intergenic
1193095565 X:77544716-77544738 TTTCACCCATGTCCCTACAAAGG + Intronic
1193249048 X:79266159-79266181 CTTCACCCATGTCCCTACAAAGG + Intergenic
1193374277 X:80739873-80739895 ATTCACCTATTTTCAAACCATGG + Intronic
1193566843 X:83087098-83087120 CTTCACCCATATCCCTACAAAGG + Intergenic
1193619757 X:83737516-83737538 CTTCACCCATGTCCCTACAAAGG + Intergenic
1193692921 X:84668971-84668993 TTTCACCCATGTCCCTACAAAGG + Intergenic
1193908782 X:87277182-87277204 CTTCACCCATGTCCCTACAAAGG + Intergenic
1193927135 X:87501255-87501277 TTTCACCCATATCCCTACAAAGG - Intergenic
1193953335 X:87827102-87827124 TTTCATCCATGTCCATACAAAGG - Intergenic
1194254327 X:91618176-91618198 CTTCATCCATTTCCCTACAAAGG + Intergenic
1194551146 X:95301091-95301113 CTTCACCCATGTCCCCACAAAGG - Intergenic
1194585986 X:95734951-95734973 TTTCACCCATGTCCCTACAAAGG - Intergenic
1195434153 X:104823398-104823420 TTTCATCCATGTCCATACAAAGG + Intronic
1195730995 X:107967103-107967125 TTTCACCCATGTCCCTACAAAGG + Intergenic
1196573153 X:117286870-117286892 CTTCACCCATGTCCCTACAAAGG - Intergenic
1196623886 X:117855852-117855874 CTTCATCCATGTCCCAACAAAGG - Intergenic
1197501710 X:127250763-127250785 TTTCATCCATGTCCCAACAAAGG + Intergenic
1197636304 X:128918467-128918489 CTTCATCCATGTCCCAACAAAGG - Intergenic
1198335275 X:135659819-135659841 CTTCACCCATGTCCCTACAAAGG + Intergenic
1198596009 X:138236570-138236592 CTTCATCCATGTCCATACAAAGG - Intergenic
1198997116 X:142585883-142585905 CTTCACCCATGTCCCTACAAAGG - Intergenic
1199029128 X:142975610-142975632 CTTCATCCATTTCCCTACAAAGG - Intergenic
1199097808 X:143762605-143762627 GTTCATCCATGTCCCTACAAAGG + Intergenic
1199141738 X:144321486-144321508 CTTCACCCATGTCCCTACAAAGG - Intergenic
1199266789 X:145837415-145837437 CTTCATCCATGTCCCAACAAAGG + Intergenic
1199373131 X:147074752-147074774 CTTCACCCATGTCCCTACAAAGG + Intergenic
1199611470 X:149619801-149619823 TTTCACCCATGTCCCTACAAAGG + Intronic
1199644297 X:149890990-149891012 CTTCACCCATGTCCCTACAAAGG + Intergenic
1200573117 Y:4857772-4857794 CTTCATCCATTTCCCTACAAAGG + Intergenic
1200693113 Y:6328753-6328775 TTTCACCCATGTCCCTACAAAGG + Intergenic
1200771544 Y:7130116-7130138 CTTCACCCATGTCCCTACAAAGG + Intergenic
1200834451 Y:7719247-7719269 GTTCAACCAATTCCAGATAAAGG + Intergenic
1200888950 Y:8301483-8301505 GTTCATCCATATCCCTACAAAGG - Intergenic
1201042159 Y:9845973-9845995 TTTCACCCATGTCCCTACAAAGG - Intergenic
1201750625 Y:17427993-17428015 CTTCACCCATGTCCCCACAAAGG + Intergenic
1202082507 Y:21098968-21098990 CTTCATCCATGTCCCAACAAAGG + Intergenic
1202250012 Y:22860643-22860665 TTTCACCCATGTCCCTACAAAGG - Intergenic
1202403001 Y:24494391-24494413 TTTCACCCATGTCCCTACAAAGG - Intergenic
1202467781 Y:25175692-25175714 TTTCACCCATGTCCCTACAAAGG + Intergenic
1202581765 Y:26389155-26389177 CTTCACCCATGTCCCTACAAAGG + Intergenic