ID: 963237617

View in Genome Browser
Species Human (GRCh38)
Location 3:142971190-142971212
Sequence ATGTGGGTAGGGAAGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 887
Summary {0: 1, 1: 3, 2: 6, 3: 67, 4: 810}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963237611_963237617 -5 Left 963237611 3:142971172-142971194 CCTTGTTTAATGGGGTGTATGTG 0: 1
1: 0
2: 1
3: 14
4: 130
Right 963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG 0: 1
1: 3
2: 6
3: 67
4: 810
963237610_963237617 -1 Left 963237610 3:142971168-142971190 CCAACCTTGTTTAATGGGGTGTA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG 0: 1
1: 3
2: 6
3: 67
4: 810
963237606_963237617 9 Left 963237606 3:142971158-142971180 CCTGATTATACCAACCTTGTTTA 0: 1
1: 0
2: 0
3: 13
4: 109
Right 963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG 0: 1
1: 3
2: 6
3: 67
4: 810

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963237617 Original CRISPR ATGTGGGTAGGGAAGGAAAA TGG Intronic
900010095 1:98851-98873 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900026206 1:275435-275457 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900035990 1:409288-409310 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900057614 1:645039-645061 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
901181227 1:7343055-7343077 CTGTGGATAGGAAATGAAAAGGG + Intronic
901421055 1:9151516-9151538 TCGTGGGTGCGGAAGGAAAAAGG - Intergenic
901433320 1:9231652-9231674 AGGTGGGGAGGGAGGGAAACAGG - Intergenic
901681584 1:10915923-10915945 CTGAGGGTTGGGAAGCAAAAGGG - Intergenic
901917768 1:12513058-12513080 AAGAGGGCAGGGAAGGAATAAGG + Intergenic
902178573 1:14670137-14670159 ATGGAAGAAGGGAAGGAAAAAGG - Intronic
902364078 1:15959482-15959504 AGGAGGGAAGGGAAGGAAGAGGG + Intronic
902539095 1:17139805-17139827 ATGTGGGTGGGGAAGGCAGGGGG + Intergenic
903035556 1:20490455-20490477 AGGAGGGTAGGGAAGGGAAGTGG - Intergenic
903200618 1:21735163-21735185 AAGTGGGTAGGGGAGGATCATGG - Intronic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
903845222 1:26275853-26275875 AGGTAGGAAGGGAAGGAAAGTGG + Intronic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
904553508 1:31341484-31341506 AAATGGGTAGGGAAGGGAAAGGG + Intronic
904643939 1:31951865-31951887 GGGTGGGAAGGGAAGCAAAATGG + Intergenic
904823864 1:33262146-33262168 AGGTGTGTAGGGAAGGCCAAGGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906155728 1:43612950-43612972 GGGAGGGTAGGGAAGGAAAAAGG - Intronic
906746299 1:48224413-48224435 CTTTGGGGAGGGAAGGATAAGGG + Intronic
906825880 1:48979550-48979572 ATTTGGATAGGGTGGGAAAAAGG + Intronic
907701037 1:56788608-56788630 AAGTGGGGAGGGAGTGAAAAGGG - Intronic
908223033 1:62027564-62027586 TTGTTGGTAGGGATGTAAAATGG - Intronic
909313110 1:74178866-74178888 ATGTGCTTAGGGCAGAAAAAAGG - Intronic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
909919686 1:81365631-81365653 ATATTGGTTGGGAAGGATAACGG + Intronic
910037311 1:82803810-82803832 ATTTGGGTAGGGAAGAAAGAGGG + Intergenic
910056206 1:83035598-83035620 ATGTGGGTAGGGTCAGATAAGGG - Intergenic
910377400 1:86587527-86587549 CAATGGGAAGGGAAGGAAAATGG - Intergenic
910473336 1:87578795-87578817 ATGAGGGGAGGGCAGGAAATTGG - Intergenic
910738056 1:90484011-90484033 CTGTTGGTAGGGATGTAAAATGG + Intergenic
910760895 1:90730060-90730082 AAGGGTGGAGGGAAGGAAAAAGG + Intergenic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911788975 1:101986684-101986706 ACGTAAGTAGGGAAAGAAAAAGG + Intronic
911947309 1:104128549-104128571 ATGAAAGTAGGGATGGAAAATGG - Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913324875 1:117618595-117618617 AGGAGGGGTGGGAAGGAAAAAGG + Intronic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
913705137 1:121413495-121413517 ATGGGGATAGAGAAGGAAATGGG + Intergenic
913707542 1:121441835-121441857 ATGGAGGAAGGGATGGAAAAGGG - Intergenic
913970132 1:143408631-143408653 ATGTGGATAGGAGAGTAAAAGGG - Intergenic
914064507 1:144234228-144234250 ATGTGGATAGGAGAGTAAAAGGG - Intergenic
914114643 1:144732126-144732148 ATGTGGATAGGAGAGTAAAAGGG + Intergenic
914234141 1:145792856-145792878 ATGTGTGTAGTGGAGAAAAAAGG - Intronic
914235132 1:145802350-145802372 ATATAGGAAGGAAAGGAAAAGGG + Intronic
914675283 1:149903472-149903494 ATGTGGGGAGTGAGGGACAAGGG + Exonic
915184233 1:154090884-154090906 CTGTTGGTAGGAAAGTAAAATGG + Intronic
915312236 1:155010578-155010600 AGTTGGGGAGGGAAGGTAAAGGG - Intronic
915457866 1:156052817-156052839 ATGTGGTTAGGGAGGGAGCAAGG + Intronic
915584176 1:156834940-156834962 ATGAGGGAAGGAATGGAAAAAGG + Intronic
916229279 1:162523714-162523736 ATGAGGGAAGGGGAGGAAAAAGG - Exonic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916472791 1:165140387-165140409 ATGGGAGGAGGGAAAGAAAAAGG + Intergenic
916572165 1:166037499-166037521 ATGTGGATAGTGAAGGAAGAGGG + Intergenic
918696326 1:187550779-187550801 ATGTGGGTAGGGCCGGATAAAGG - Intergenic
918833180 1:189425151-189425173 AAAAGGGAAGGGAAGGAAAAAGG - Intergenic
919612080 1:199758008-199758030 ATGTAGCTGGGGAAGAAAAAAGG + Intergenic
920102018 1:203522559-203522581 AGGTGGGTAGGGAAAGAGAGAGG + Intergenic
920237187 1:204516029-204516051 AGGGTGGTAGGGAAGGGAAACGG - Intergenic
920284835 1:204871925-204871947 TTGTTGGTTGGGAGGGAAAAAGG + Intronic
920416357 1:205801338-205801360 AGGTGGGTGGGGAAGGGTAATGG + Intronic
920795231 1:209130593-209130615 GTGTGTGTATGAAAGGAAAAGGG - Intergenic
921557907 1:216621430-216621452 TTGTTGCTAGGTAAGGAAAAAGG + Intronic
921673133 1:217948677-217948699 ATGTGTGTATGAAAGGAAAGGGG - Intergenic
921760261 1:218905502-218905524 ATGTGGCCTTGGAAGGAAAATGG - Intergenic
922035537 1:221844504-221844526 ATGTGGTTAGGGATGGAGATGGG - Intergenic
922258529 1:223914856-223914878 TGGTGGGGAGGGAAGAAAAAAGG + Intergenic
922860256 1:228810398-228810420 ATGGGGGCAGGTAAGGAAGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923874422 1:238032644-238032666 ATGTGGTTGGTGGAGGAAAAAGG + Intergenic
924329747 1:242929599-242929621 GTGTGGGCAGGGTAGGGAAAGGG - Intergenic
924440580 1:244082270-244082292 GTGTGGGACGGGAAGGCAAATGG + Intergenic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1064004383 10:11688523-11688545 AGGGAGGGAGGGAAGGAAAAAGG - Intergenic
1064167048 10:12995585-12995607 AAGTGGGTAGGGAGTAAAAACGG + Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064276290 10:13908302-13908324 GAATGGGGAGGGAAGGAAAAAGG - Intronic
1064354578 10:14605174-14605196 ATGAAGGGAGGGGAGGAAAATGG - Intronic
1064634311 10:17348186-17348208 ATATTTTTAGGGAAGGAAAAGGG + Intronic
1065077788 10:22098347-22098369 ATGTGGGTAGGGAAGACATCTGG + Intergenic
1065204520 10:23344256-23344278 AGGTGTGGAGGGAAGGAAGAGGG + Intronic
1065359000 10:24871560-24871582 ATCTGGGGAGGGAAGAGAAAAGG - Intronic
1065542469 10:26784056-26784078 ATGCGGGGAAGTAAGGAAAAAGG + Intronic
1066227683 10:33400168-33400190 GAGTGGGAAGGGAAGGGAAATGG - Intergenic
1067789303 10:49275774-49275796 ATGCAGGTAAGGGAGGAAAAGGG - Intergenic
1068434215 10:56970037-56970059 ATGTGGGTAAGTAAAGAAAGAGG - Intergenic
1068619685 10:59167705-59167727 AACTGGGTATGGAAAGAAAATGG - Intergenic
1068698182 10:59991741-59991763 AGGTAGGGAGGGGAGGAAAACGG - Intergenic
1069597721 10:69683252-69683274 AGGTGGGTGGGGAAGGGGAAAGG - Intergenic
1070942453 10:80359093-80359115 ATGTGGGTAGGGCCGGATAAGGG - Intronic
1071078829 10:81784981-81785003 ATGTGGGTAGGGCCAGATAAGGG + Intergenic
1071867730 10:89755429-89755451 AAGGGGGGAGGGAAGGAAAGGGG - Intronic
1071961706 10:90813758-90813780 ATGTGGTTTGGCAAGGAGAAGGG - Intronic
1072763952 10:98081059-98081081 AAGGGAGTAGGGCAGGAAAAGGG - Intergenic
1073782747 10:106857275-106857297 TTTTGGGTAGGGAAGGAGATGGG - Intronic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074835409 10:117287648-117287670 ATCTGAACAGGGAAGGAAAATGG - Intronic
1075256836 10:120932066-120932088 GTCAGGGTAGGAAAGGAAAATGG - Intergenic
1075285046 10:121176497-121176519 ATGGGGTAAGGGGAGGAAAAAGG + Intergenic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1075989548 10:126823670-126823692 ATTTGGGTGGGAATGGAAAATGG + Intergenic
1077011222 11:380216-380238 ATGGGGGTCGGGGAGCAAAACGG + Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077773243 11:5243860-5243882 GTGGGGGTAGTGTAGGAAAATGG - Intergenic
1077914530 11:6602698-6602720 ATGGGGCTAGGGGATGAAAAAGG + Intronic
1078185639 11:9050053-9050075 ATGTGTGCTGGGAAAGAAAAAGG + Intronic
1078554424 11:12309321-12309343 AAGTGGGGAGGGAAGGCTAAAGG - Intronic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1078798014 11:14612987-14613009 ATGGAGATAGGGAAGGAACATGG + Intronic
1078826541 11:14935521-14935543 AGGAGGGGAGGGAAGGGAAAGGG + Intronic
1078923658 11:15854493-15854515 AGGAGGGGAGGGAAGGAAGAGGG + Intergenic
1079867729 11:25756931-25756953 ATGTGGGTGGGGTCAGAAAAGGG + Intergenic
1080232755 11:30035988-30036010 ATGTGGGTATGGGAGCAATAGGG + Intergenic
1080255643 11:30287929-30287951 ATGTGGGTATGGAACAAAAACGG + Intergenic
1080368086 11:31600897-31600919 ATGGGGGTACAGGAGGAAAACGG - Intronic
1080605363 11:33860818-33860840 AGTTGGGTAGGGAAGGAGGAGGG - Intronic
1080748045 11:35126716-35126738 CTGTGGGTGGGGGAAGAAAAAGG + Intergenic
1080819117 11:35788230-35788252 ATTTGGGTGGGGAAAGAGAAAGG + Intronic
1081047565 11:38295965-38295987 ATGTAGGTAGGGTCGGATAAGGG - Intergenic
1081136032 11:39441586-39441608 ATGTGGGTAGGGCCAGATAAGGG - Intergenic
1081245338 11:40759325-40759347 ATGTGTGAAGGGAAAGTAAATGG - Intronic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1083329345 11:61890458-61890480 AGGTGGGTAACTAAGGAAAAGGG + Intronic
1083743333 11:64722500-64722522 AAGTGGAGAGGGAAGGAAAGGGG - Intronic
1084456031 11:69268768-69268790 CTGTGTGGTGGGAAGGAAAATGG + Intergenic
1084551289 11:69843652-69843674 AGGGGGGTGGGGGAGGAAAATGG + Intergenic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1084951883 11:72671020-72671042 AGGTGGGTAGGAAAGGCACAGGG - Intronic
1085765277 11:79276798-79276820 ATGTGGGTGGCAGAGGAAAAAGG - Intronic
1085886835 11:80532186-80532208 ATGTGGGTAGGGTCAGATAAGGG - Intergenic
1086028174 11:82320177-82320199 ATTTGGCAAGGAAAGGAAAAGGG - Intergenic
1086032448 11:82376439-82376461 ATGTGGGAAGTGATGGGAAATGG + Intergenic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1086311116 11:85537258-85537280 ATGTGGGTGGGGCAAGATAAGGG + Intronic
1086747294 11:90445539-90445561 ATGTTGCAAGGGAAGGAACATGG - Intergenic
1086761144 11:90633295-90633317 ATGTAGGTAGGAATGTAAAATGG - Intergenic
1086961426 11:92982800-92982822 GTGTGTGTAGGGAAGGTCAATGG - Intronic
1087683681 11:101240682-101240704 ATGTGGGTAGGGCCAGATAAGGG - Intergenic
1088229710 11:107661264-107661286 TTGTGTGTAAGGTAGGAAAATGG + Intronic
1088431671 11:109765585-109765607 GTGTTGGTGGGGAAGGAAATAGG - Intergenic
1088720466 11:112587822-112587844 TTCTGGGTAGGGAAGAAAAAAGG - Intergenic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1089827924 11:121295738-121295760 ATTTGGGTAGGGTAGGAATAGGG - Intronic
1090100653 11:123793552-123793574 ATGTGGTGAGGGGAGAAAAATGG - Intergenic
1090303728 11:125672097-125672119 GAGTGTGTAGGGATGGAAAAGGG + Exonic
1090517878 11:127448140-127448162 GTGTGGCTAGAGAAGGAAATTGG - Intergenic
1090684136 11:129096790-129096812 AGGGGGACAGGGAAGGAAAAGGG - Intronic
1091204503 11:133810418-133810440 GAGTGGGGAGGGAAGGAAATGGG + Intergenic
1091263293 11:134251015-134251037 ATCTTTGAAGGGAAGGAAAAAGG - Intronic
1091508966 12:1102035-1102057 CTGCAGGTAGGAAAGGAAAAGGG + Intronic
1091608986 12:1986605-1986627 AGGGAGGTAGGGAAAGAAAAGGG + Intronic
1091802619 12:3334159-3334181 TTTTGGGGAGGGAAGGAGAAGGG - Intergenic
1091996122 12:4995597-4995619 ATGTGGGAGGGGATGGAAAGGGG - Intergenic
1091996185 12:4995974-4995996 ATGTGGGAGGGGATGGAAACGGG + Intergenic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1092762001 12:11818903-11818925 ATGTGGGTAGGGTAGGCTGAGGG - Intronic
1092785466 12:12022542-12022564 AGATGGGGAGGGAAGGAAAAGGG + Intergenic
1093113286 12:15179107-15179129 TTGGGGGTAGGGAAGAGAAATGG + Intronic
1093182073 12:15978012-15978034 ATGTTGGTAGGAAAGGACAATGG - Intronic
1093288378 12:17294672-17294694 ATGAGGGTAGGGAAGGAGGTAGG - Intergenic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1093899771 12:24618253-24618275 ATGGCTGTAGGGAAAGAAAAAGG + Intergenic
1095046291 12:37510839-37510861 AAGTCAGTGGGGAAGGAAAATGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096711970 12:53464292-53464314 GGGTGGGTAGGGAAGCAAAGAGG - Intronic
1096746797 12:53734051-53734073 ATGTGGGCAATGAAGGAAACAGG + Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096869693 12:54585552-54585574 CAGTGGGGAGGGAAGGCAAATGG + Intronic
1097210029 12:57360657-57360679 AAGAGGAAAGGGAAGGAAAAAGG + Intronic
1097242912 12:57588472-57588494 ATGTGGGGATTGAAGGAAAAGGG - Intergenic
1097537802 12:60895730-60895752 CTGTTGGTAGGAATGGAAAAAGG + Intergenic
1098289187 12:68940204-68940226 ATGTGGGTAGGGCAGGAAAAGGG - Intronic
1100022175 12:90082855-90082877 TTGTGGGTAGAGGAGTAAAAAGG + Intergenic
1100318738 12:93469641-93469663 ATGTGGGTTGGGGAGGGGAATGG + Intronic
1100591961 12:96037638-96037660 ATGTGAGAAGGGAAGATAAAGGG + Intronic
1101132910 12:101707676-101707698 AGGTGAGAAGGCAAGGAAAAGGG + Intronic
1101838261 12:108310222-108310244 ATGTGGCTAAGGAAAGAAGAGGG + Intronic
1102099399 12:110266842-110266864 CAGTGGGGAGGGAAGGTAAAGGG - Intergenic
1102152251 12:110696952-110696974 TTGGGAGTAGGGAAGGAAAAAGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102644978 12:114397932-114397954 AAGTGGGGAGGGAAGGTATATGG + Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102755521 12:115336395-115336417 AACGGGGGAGGGAAGGAAAATGG - Intergenic
1102797116 12:115698264-115698286 AGGAGGGAAGGGAAGGGAAAAGG + Intergenic
1103693310 12:122793480-122793502 CTGGGGGTAGGTAAGGAATATGG + Intronic
1104158199 12:126153452-126153474 ATCTGGGAAGAGAAGGAAAATGG + Intergenic
1105455789 13:20540067-20540089 ATGTGGGTGGGGACAGATAAGGG - Intergenic
1105724022 13:23142805-23142827 ATGTGGGTGGGGCCGGATAAGGG + Intergenic
1105795152 13:23844171-23844193 ATGCGGGCAGAGAAGGTAAAGGG + Intronic
1106556253 13:30810856-30810878 AATTGGGTAGGGAAGAAAAATGG - Intergenic
1107155432 13:37161432-37161454 CTGTAGGTAGGAAAGTAAAATGG - Intergenic
1107829628 13:44362848-44362870 GTTTGGGCAGGGAAGGAAAAAGG + Intergenic
1108162675 13:47658378-47658400 GTGTGGGTTGGGCAGGAACAGGG - Intergenic
1108972013 13:56388322-56388344 GAGTGGGTAGGGATGGAGAAAGG - Intergenic
1109121321 13:58461789-58461811 AGGGAGGGAGGGAAGGAAAAAGG - Intergenic
1109588230 13:64438662-64438684 ATATGTGTAAAGAAGGAAAAAGG - Intergenic
1109881812 13:68487839-68487861 AAGTGGGTGGGGAAGGAGAAAGG - Intergenic
1110315840 13:74105386-74105408 ATCTGTATAGTGAAGGAAAATGG + Intronic
1110366446 13:74691604-74691626 ATGTGGTGAGAGAAGGACAAGGG + Intergenic
1110440336 13:75519422-75519444 ATGTGGGTAGGGCCAGATAAAGG + Intergenic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1110705673 13:78601055-78601077 ACGCGGGAAGGGTAGGAAAATGG - Exonic
1110854065 13:80278091-80278113 ATGTGGGTGGGGCCGGATAAGGG - Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111331593 13:86765430-86765452 AGGTGGGGAGGGAAGGAGAAAGG + Intergenic
1111585878 13:90284305-90284327 GAGTGGGCAGAGAAGGAAAAAGG + Intergenic
1111833225 13:93355811-93355833 ATGGGGGAAGGGAAATAAAAAGG + Intronic
1111888441 13:94052372-94052394 GGGTTGGCAGGGAAGGAAAAGGG + Intronic
1112144240 13:96679984-96680006 ACGTGGGGAAGGAAGGCAAAGGG + Intronic
1112629201 13:101141739-101141761 CTGTGGGAAGGGAAAGAAAGCGG + Intronic
1112635255 13:101210169-101210191 ATGGGGGTGGGGAAGGAGAGAGG - Intronic
1112641901 13:101284933-101284955 ATGTGTGTATGGTAGGAATAGGG + Intronic
1112722072 13:102256954-102256976 ATGTGAAAAGTGAAGGAAAATGG - Intronic
1113518098 13:110918558-110918580 ATGTGGATAGGAATGGAGAAGGG - Intergenic
1113600212 13:111563250-111563272 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600236 13:111563325-111563347 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1114258470 14:21021594-21021616 ATGGGTGGAGGGAAGGAAAAGGG - Intronic
1114345747 14:21792808-21792830 ATGTGGGTAGGGGAAGAAAATGG + Intergenic
1114420030 14:22574210-22574232 ATGTGGCCAGGGAAGGCCAATGG + Intronic
1114772166 14:25440402-25440424 ATGTGGGTGGGGACAAAAAAGGG - Intergenic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115456440 14:33609450-33609472 ATTTGGGTTGAAAAGGAAAAAGG - Intronic
1115509800 14:34128435-34128457 ATGTTGGTAGGGAAAGCAATAGG - Intronic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1116251388 14:42487429-42487451 AGATGGGTAAAGAAGGAAAAAGG + Intergenic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118153322 14:63213277-63213299 AGTTGGGAAGGGAAGGAAGAGGG - Intronic
1118157745 14:63257649-63257671 GGGTGGGTGGGGAAGGAATATGG - Intronic
1118730804 14:68664997-68665019 ATGTGAGTAGGGGAAGAAAGGGG - Intronic
1119081303 14:71696884-71696906 ATGTGAGTAGCAAAGGAAGAAGG + Intronic
1119192872 14:72695696-72695718 AAGGGGGAAGGGAAGGAAGAGGG + Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1120229628 14:81828899-81828921 ATGTGGGTGGGGACAGATAAGGG - Intergenic
1120840507 14:89081170-89081192 TTGTGGGGAGGGCAGCAAAAAGG - Intergenic
1121429314 14:93875689-93875711 TTGTGGGTAGTGATGGAGAAAGG + Intergenic
1121593358 14:95137476-95137498 ATGGGGATAGGGAAGGGGAAGGG + Intronic
1121703318 14:95973273-95973295 ATTTGGGTAGGTAAAGGAAAAGG - Intergenic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122415691 14:101548554-101548576 ACGTGGGGAAGGAAGGAAAGAGG + Intergenic
1122704828 14:103614163-103614185 GGGAGGGAAGGGAAGGAAAAAGG - Intronic
1122738932 14:103859645-103859667 TTGAGGGTGGGGAAGGGAAAGGG + Intergenic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1123678642 15:22739478-22739500 AAGGGGGAAGGGAAGGAGAAAGG - Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124474984 15:30025558-30025580 TTGTGGGTAGGTAGGGGAAAGGG - Intergenic
1125119936 15:36143973-36143995 ATGTGGATAGATAAAGAAAAAGG + Intergenic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1125243568 15:37605829-37605851 ATTGGTGTAGGGATGGAAAATGG - Intergenic
1125766393 15:42139433-42139455 ATGAGGCAAGGGAAGAAAAAGGG - Exonic
1125792874 15:42383010-42383032 ATATGGGGAGGGAAGGAATAAGG - Intronic
1126832913 15:52627212-52627234 AAGAGGGAAGGGAAGGAGAAGGG + Intronic
1126949983 15:53870411-53870433 GTGGGGGGTGGGAAGGAAAAAGG - Intergenic
1127162657 15:56205983-56206005 CTGCTGGTAGGGATGGAAAATGG + Intronic
1127267555 15:57374193-57374215 AAAGGGGAAGGGAAGGAAAAAGG - Intergenic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1128147691 15:65341270-65341292 ATGTTGGTGGGGATGTAAAACGG + Intronic
1128406803 15:67349912-67349934 TTGTTGGTAGGGATGCAAAATGG + Intronic
1128633394 15:69287414-69287436 ATGAGGGCCAGGAAGGAAAAGGG - Intergenic
1128665392 15:69533782-69533804 ATTTAAGTATGGAAGGAAAAGGG - Intergenic
1128668791 15:69558737-69558759 ATCTGGTTAAGTAAGGAAAATGG - Intergenic
1128949035 15:71855600-71855622 ATATAGTTAGGGAAGGACAATGG - Intronic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129044444 15:72721266-72721288 ATGTGGGTAGTTTAAGAAAAAGG + Intronic
1129914987 15:79260908-79260930 ATGAGGGCAGGGAGAGAAAAAGG + Intergenic
1130130906 15:81142066-81142088 ACGTGGGTGGGGAAGGGAGATGG - Intronic
1130162413 15:81414535-81414557 ATGTGGGTAGGGTCAGATAAGGG + Intergenic
1130229951 15:82089232-82089254 ATCTGGGTACTGAAGGAAAGGGG - Intergenic
1130656959 15:85798504-85798526 GTGTAGGTAGGGAAGGGAATAGG - Intergenic
1131822001 15:96283180-96283202 AAGTATGTAGGGAAGGAGAAGGG + Intergenic
1132812572 16:1808627-1808649 ATGAGGGAAGGGCAGGACAAAGG - Exonic
1133168142 16:3963601-3963623 TTGTGGTTGGGGAAGGAAATGGG + Exonic
1133436682 16:5785941-5785963 ATGAAGGTAGGGAATGGAAATGG - Intergenic
1133484326 16:6204167-6204189 GTGAGGGTAGGGGAGGAAAAGGG - Intronic
1134036976 16:11038605-11038627 ATGGGGGTGGGGAAGGTAAGTGG - Intronic
1134037237 16:11040300-11040322 TTGTGGGTAGGTATGGAAACAGG + Intronic
1134060817 16:11198533-11198555 AAGGAGGGAGGGAAGGAAAAAGG + Intergenic
1134316282 16:13121707-13121729 ATGGGGGCAGGGAAGGGGAATGG + Intronic
1134423033 16:14112181-14112203 AGGGAGGTAGGAAAGGAAAAAGG + Intronic
1134867301 16:17619892-17619914 ATGGTGGGAAGGAAGGAAAAAGG - Intergenic
1135985762 16:27182825-27182847 ATGGGGGTAGGGAGGGAGAAAGG + Intergenic
1136271090 16:29148719-29148741 AGGTGGGGAGGGGAGAAAAATGG + Intergenic
1136287078 16:29250715-29250737 GTCTGGGGAGGGAAGGCAAAAGG - Intergenic
1136849902 16:33604295-33604317 ATGAGTGCAGGGAAGGAACAAGG - Intergenic
1137608178 16:49800867-49800889 AACAGGGAAGGGAAGGAAAAAGG + Intronic
1138881912 16:61026966-61026988 ATGGAGATAGTGAAGGAAAAGGG + Intergenic
1139242983 16:65412988-65413010 ATGTGGGCTGGGAAGGACCAGGG - Intergenic
1139413895 16:66790229-66790251 AAAAGGGAAGGGAAGGAAAAAGG + Intronic
1139413900 16:66790246-66790268 AAAAGGGAAGGGAAGGAAAAAGG + Intronic
1139435410 16:66934065-66934087 ATGTGGGAAGTGAAGGAAAAGGG + Exonic
1140126609 16:72123525-72123547 AAGTGAGTATGGGAGGAAAAAGG - Exonic
1140152097 16:72377992-72378014 ATGAGGTCAGGGAAGGGAAAGGG + Intergenic
1141783973 16:86185925-86185947 CTTTGAGTAGGGAAGGACAAGGG + Intergenic
1142074574 16:88110064-88110086 ATGTGAGGAGTGAGGGAAAAAGG - Intronic
1142074704 16:88110724-88110746 AGGTGGGGAGGGGAGAAAAATGG + Intronic
1142092682 16:88223347-88223369 GTCTGGGGAGGGAAGGCAAAAGG - Intergenic
1142346872 16:89559769-89559791 GTGAGGGTAGGGAAGAAAGAGGG + Intergenic
1203111513 16_KI270728v1_random:1452748-1452770 ATGAGTGCAGGGAAGGAACAAGG - Intergenic
1143197380 17:5086382-5086404 ATGTGGTAAGGGAAGGGGAAAGG - Intronic
1143546836 17:7601989-7602011 ATCAGGGTACTGAAGGAAAATGG + Intronic
1143756733 17:9072932-9072954 AGGAGGGTGGGGAAGGAAAGAGG - Intronic
1144084398 17:11795847-11795869 ATGTTGTTGGGGAAGGATAATGG - Intronic
1144796343 17:17893814-17893836 ATGTGGGGAGGGAAGGAAAAGGG + Intronic
1145095973 17:20026883-20026905 CTGTGGGTAGGGATGCAAATTGG - Intronic
1145154566 17:20533484-20533506 AGGTGGGGAGGGGAAGAAAAAGG + Intergenic
1145895488 17:28455310-28455332 ATTTGGGCAAGCAAGGAAAAAGG + Intergenic
1145934579 17:28707263-28707285 TTGTGGGAAGGAAAGGCAAAGGG - Intronic
1145941933 17:28747185-28747207 ATGGGGGAGGGGCAGGAAAAAGG - Intronic
1145960704 17:28885095-28885117 GTGTGGGTATGGAAGGAGAGAGG + Intronic
1146248524 17:31314039-31314061 ATTTGGCTAAGAAAGGAAAATGG + Exonic
1146733514 17:35216250-35216272 ATGTGGGGAGGGAAGACTAAAGG - Intergenic
1146885593 17:36468663-36468685 ATGTGAGAAGTGAAGGAAAGGGG + Intergenic
1147163189 17:38579437-38579459 CTCTGGGGAGGGAAGGGAAAAGG - Intronic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147263805 17:39223577-39223599 GTGTGGGGAGGGAAGGTCAAGGG - Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1148022082 17:44559939-44559961 AAATGAGTAGGGAAAGAAAAGGG - Intergenic
1148115555 17:45172711-45172733 ATGTGGGGAGGGGAGGAGAGGGG + Intergenic
1148520116 17:48265736-48265758 ATGGGGGGAGGGAAAGAGAAAGG - Intronic
1148549347 17:48541559-48541581 ATGTGGGAAGGGAAGGAGAGCGG - Intronic
1148631264 17:49111183-49111205 ATAAGGTTTGGGAAGGAAAATGG - Intergenic
1148737042 17:49870813-49870835 AAGGGGAGAGGGAAGGAAAAAGG - Intergenic
1148964026 17:51419566-51419588 ATGTGGGGAGTGAAGGATAAAGG - Intergenic
1148995712 17:51707642-51707664 AGGTGTGCAGGGAAGGAAAGTGG + Intronic
1149042543 17:52207129-52207151 ATGAATGTAGGCAAGGAAAAAGG + Intergenic
1149125550 17:53226384-53226406 ATTTGGTCAGGGAAGGAGAAAGG - Intergenic
1149272406 17:54994658-54994680 ATGTAGGTTGGGAGGGAAATAGG - Intronic
1149330412 17:55575713-55575735 GTGTGGGTAGGGAAGAAATGAGG - Intergenic
1149902914 17:60497793-60497815 ATGTGGGTTAGGAAATAAAATGG + Intronic
1150177061 17:63068967-63068989 ATTTGGGGAGGGATGGAAGAAGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150439408 17:65179189-65179211 AAGTGGGAGGGGAAAGAAAAAGG + Intronic
1151354741 17:73551616-73551638 AGGAGGGGAGGGAAGGAGAAAGG - Intronic
1151383932 17:73743824-73743846 AAGGGGGGAGGGAAGGAAGAGGG - Intergenic
1152164998 17:78697825-78697847 ATGGGGACAGGGAAGGCAAACGG + Intronic
1152195490 17:78915923-78915945 ATGAGGATAGGGAAGGAAATGGG + Intronic
1152337593 17:79707237-79707259 ACGTGGGCAGGGGAGGAAGAAGG - Intergenic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1153532408 18:6061116-6061138 TTGCTGGTAGGGAAGCAAAATGG - Intronic
1153931161 18:9880979-9881001 ATGCGGGTAGGGCAGGGAATGGG - Intergenic
1154208178 18:12355466-12355488 TTGCTGGTAGGGATGGAAAATGG + Intronic
1154315940 18:13303457-13303479 AGGAGGGCAGGGAAGGAAACGGG - Intronic
1155095336 18:22549856-22549878 ATGTGGGAAGGGAGGGAGAGAGG + Intergenic
1155336504 18:24770433-24770455 ATGTGGGTAGGGTAGGAGGCAGG - Intergenic
1155456902 18:26026642-26026664 AGGAGGGTGGGGAAGGAACATGG + Intronic
1156413418 18:36859536-36859558 AGGGAGGTAGGGAAGGAAAAAGG - Intronic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1157090134 18:44627242-44627264 ATTTGGGAAGGGAAGTGAAATGG + Intergenic
1157200638 18:45656355-45656377 GTGTGCGTTGGGAAAGAAAAGGG + Intronic
1157987720 18:52458552-52458574 ATGGGGGAAGGAAAAGAAAAAGG - Intronic
1158060428 18:53334036-53334058 ATGTGAGTGGTGCAGGAAAAGGG - Intronic
1158356072 18:56620921-56620943 AGATGGGGAGGGAAGAAAAAAGG + Intronic
1158866119 18:61639055-61639077 TTGTGGGAAGGGGAGGAAAGGGG + Intergenic
1160421471 18:78750022-78750044 AAGTGGGTATGGAATTAAAAAGG - Intergenic
1161955498 19:7492272-7492294 ATGCTGGTGGGGATGGAAAATGG - Intronic
1162826543 19:13255809-13255831 ATGAAGGGAAGGAAGGAAAAAGG - Intronic
1163238267 19:16042571-16042593 ATGTGGGAAGGGAAGGGTGATGG - Intergenic
1163677559 19:18662946-18662968 AGGAGGGCAGGGAAGGAAAGGGG - Intronic
1164840725 19:31390311-31390333 ATGGGGAGAGGGAAGGAACAGGG + Intergenic
1164898200 19:31896017-31896039 CTGTGGGTTGGGCAGGAAACGGG - Intergenic
1164976184 19:32574427-32574449 ATGAGGGGAGGGAGGGAAATTGG - Intergenic
1165400399 19:35596079-35596101 AAGAGGGAAGGGAAGGGAAAGGG + Intergenic
1165738482 19:38192365-38192387 ATCTGGGCAGGCAAGGAGAAGGG + Intronic
1165846747 19:38822788-38822810 ATGTGGGTGGGGACAGATAAGGG + Intronic
1165984962 19:39760084-39760106 CTGTGGGTAGGAATGCAAAATGG + Intergenic
1166102164 19:40577210-40577232 ATCTGGGCGGGGAAGGTAAACGG - Exonic
1166692832 19:44833988-44834010 AGGACGGAAGGGAAGGAAAAGGG + Intergenic
1167267917 19:48492795-48492817 GTGTGGGTCTGGAAGGAAAGAGG - Intronic
1167424295 19:49422146-49422168 ATGGGGGTAGGGAGGGACAGGGG + Intergenic
925018077 2:546772-546794 ATGTGGATAGGGAAGGCACTGGG + Intergenic
925225886 2:2183846-2183868 AGGAGAGGAGGGAAGGAAAAAGG + Intronic
925501793 2:4513072-4513094 ATGTGGGTAGTGAGGAAAAACGG + Intergenic
925817628 2:7768905-7768927 ACGTGGCTAGAGAAGGAGAAAGG - Intergenic
925913710 2:8589576-8589598 AGGAGGGGAGGGGAGGAAAAGGG + Intergenic
926015626 2:9448905-9448927 ATGTGGGTAGGAAAAGCAAGTGG - Intronic
926924274 2:17971124-17971146 AAGTGGTTAGGGAAAGAATAGGG + Intronic
927100422 2:19783762-19783784 GTGGGGGCAGGGAAGGCAAATGG - Intergenic
927851392 2:26502204-26502226 ATTTGGGTAGGGAAGAATCAGGG - Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928366189 2:30705398-30705420 ATGGCCGTAGGAAAGGAAAAAGG + Intergenic
928430948 2:31218046-31218068 AAGTAGGTTGGGAAGGAAGAGGG - Intronic
928906802 2:36377036-36377058 ATGGGGGGAGGCAAGGGAAAGGG - Intronic
929000370 2:37342483-37342505 ATGAGCGAAGGAAAGGAAAAGGG + Intergenic
929407526 2:41659907-41659929 AGAAGGGAAGGGAAGGAAAAAGG + Intergenic
929712713 2:44281100-44281122 AAGGAGATAGGGAAGGAAAAAGG - Intronic
929782248 2:44964746-44964768 ATGAGGGAAGGGCAAGAAAAGGG - Intergenic
930517374 2:52424759-52424781 AGGGGGGGAGGGAAGGAAAGAGG + Intergenic
930616349 2:53598592-53598614 AGGAAGGAAGGGAAGGAAAAGGG + Intronic
930616361 2:53598628-53598650 AGGAAGGAAGGGAAGGAAAAGGG + Intronic
930616373 2:53598664-53598686 AGGAAGGAAGGGAAGGAAAAGGG + Intronic
930873153 2:56186738-56186760 GTGTGGGTAGGGGAGGGGAATGG + Intronic
931174072 2:59835313-59835335 AAGGGGGAAGGGAAGGAAGAAGG - Intergenic
931518239 2:63066538-63066560 ATGTGGATGGGGAAGGAAAGGGG - Intergenic
932073311 2:68642664-68642686 CTGTCGGTAGGAAAGTAAAATGG - Intergenic
932121599 2:69105671-69105693 ATAGAGGTGGGGAAGGAAAATGG - Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932614229 2:73221949-73221971 ATTTGGGGAGGGAAGGAGACAGG - Intronic
932614355 2:73222659-73222681 ACTAGGGGAGGGAAGGAAAAAGG - Intronic
932811483 2:74830005-74830027 ATGTGGATGGGGAGGGAAAGAGG - Intergenic
933415941 2:81985922-81985944 ATGTGGGTGGGGACAGATAAGGG + Intergenic
933542838 2:83670468-83670490 ATGTTGGGAGTAAAGGAAAAGGG - Intergenic
933912290 2:86952222-86952244 ATGCTGGTAAGAAAGGAAAATGG + Intronic
934010705 2:87817675-87817697 ATGCTGGTAAGAAAGGAAAATGG - Intronic
934045005 2:88165722-88165744 ATGGGCCAAGGGAAGGAAAAAGG + Intergenic
934174824 2:89569540-89569562 ATGTGGATAGGAGAGTAAAAGGG - Intergenic
934285141 2:91643892-91643914 ATGTGGATAGGAGAGTAAAAGGG - Intergenic
934537405 2:95146784-95146806 ATCTGGGTAGGTACAGAAAAGGG + Intronic
935219892 2:101003056-101003078 GTTTGGGTAGGGAAGGGAACAGG - Intronic
935225309 2:101047401-101047423 ATCTGGGAAGGGAAGGGAAAAGG + Intronic
935558646 2:104538198-104538220 AAGTGGGGAGGGAAGAAGAAGGG + Intergenic
935606145 2:104973938-104973960 ATGTGTGCAAGGAAGAAAAAGGG + Intergenic
935774276 2:106458378-106458400 ATGCTGGTAAGAAAGGAAAATGG - Intronic
935863186 2:107356662-107356684 TGGTAGGTAGGGAATGAAAAGGG + Intergenic
935905792 2:107837535-107837557 ATGCTGGTAAGAAAGGAAAATGG + Intronic
935992275 2:108730058-108730080 ATGCTGGTAAGAAAGGAAAATGG + Intronic
935999363 2:108811143-108811165 AGGGGGGTAGGGAAGGCAGAGGG - Intronic
936127594 2:109802712-109802734 ATGCTGGTAAGAAAGGAAAATGG + Intronic
936217103 2:110568773-110568795 ATGCTGGTAAGAAAGGAAAATGG - Intronic
936283523 2:111163005-111163027 ATCTTGTTATGGAAGGAAAAGGG + Intronic
936426243 2:112423357-112423379 ATGCTGGTAAGAAAGGAAAATGG - Intronic
937251760 2:120528343-120528365 ACGTGGTGAGGGAAGGAAGAGGG + Intergenic
939684476 2:145181684-145181706 AAGTGGCTAGGGAAGGAGACAGG - Intergenic
939941112 2:148352513-148352535 AGGTGGTGAGGGAAGGGAAATGG - Intronic
941176309 2:162201467-162201489 ATGTGGGGAGGGCAAGGAAAAGG - Intronic
941338602 2:164276735-164276757 AAGAGGGGAGGGAAGGAGAAAGG + Intergenic
941476469 2:165956616-165956638 ATGTGGGTGGGGCCGGATAAGGG - Intergenic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942141692 2:172983818-172983840 ATGTGAGTAGGGTTGGAACATGG + Intronic
942346444 2:175007336-175007358 ATGTGGGTAGGGAAGGTGGTCGG - Intergenic
943344057 2:186716367-186716389 TTCTGGGTAAGGAAGGAAAAGGG - Intronic
944142755 2:196475286-196475308 ATAATGGTAGGGAAGGAGAAGGG + Intronic
945014014 2:205495615-205495637 ATATAAATAGGGAAGGAAAATGG + Intronic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945281634 2:208040923-208040945 ATGTTGCTAGGGAGGAAAAAAGG - Intergenic
945775702 2:214103830-214103852 TTGTGGGTACAGAAGGAAAGGGG + Intronic
946159415 2:217826958-217826980 ATGTGGGTGGGAAAGAAAGAAGG + Intronic
946316302 2:218915512-218915534 TTGTGGGTAAGGAAAGATAAAGG + Intergenic
946539588 2:220669524-220669546 ATGGGGGTGGGGAAGGGAAGTGG - Intergenic
946659135 2:221980491-221980513 ATGGGGGCAGGGAATGAAGATGG + Intergenic
946807504 2:223485880-223485902 ATGGTGGAAGGGAAGGAGAAAGG - Intergenic
946886167 2:224225570-224225592 ATTTGGGTAGGTAAAGGAAAAGG - Intergenic
947404672 2:229762496-229762518 ATGTGAGAAGGGCAGGAAGAAGG - Intergenic
947494615 2:230625775-230625797 AAAAGGGAAGGGAAGGAAAAGGG + Intergenic
947962653 2:234252671-234252693 ATCTGGATGGGGAAGGAGAAAGG + Intergenic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948119937 2:235522520-235522542 AGCTGGGGAGGGAAGGAAGACGG + Intronic
949005153 2:241641783-241641805 ATGTGGGTGGGAAAGAAAAGAGG + Intronic
949085694 2:242152708-242152730 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1168954784 20:1827328-1827350 GGGTGGGGAGGGGAGGAAAAGGG + Intergenic
1169237688 20:3944773-3944795 ATGGGGGTAGGGATTGAAGAAGG - Intronic
1169772918 20:9221105-9221127 GTGGGGGAAGGGAAGGGAAAGGG + Intronic
1169831344 20:9828864-9828886 ATGGGGGAAGGAAAGGAAGAAGG - Intronic
1170346061 20:15388151-15388173 ATGGGAGTTGGGATGGAAAAGGG + Intronic
1170678273 20:18502205-18502227 ATGTGGGCTGGGAAGGACAGTGG + Intergenic
1171990729 20:31694330-31694352 ATGGGGGTGGGGAAGGAAGTGGG + Intronic
1172068472 20:32238779-32238801 ATGTGGACTGGGAAGGAAAGAGG + Intergenic
1172758379 20:37304403-37304425 ATGTGGGAAGGAAGGGAATAGGG - Intronic
1173140952 20:40482364-40482386 ATGGGGAAAGGGAAGGAAAGAGG - Intergenic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173775606 20:45703710-45703732 TTGGGGGTAGGGGAGGAAATAGG + Intronic
1174750019 20:53102504-53102526 AAGAGGGGAGGGGAGGAAAAAGG + Intronic
1175207841 20:57325526-57325548 AGGGGAGTAGGGAAAGAAAAAGG + Intergenic
1175369502 20:58478421-58478443 ATGAGGGAAGGGAAGGGAAGGGG - Intronic
1175557798 20:59883697-59883719 ATGGCAGGAGGGAAGGAAAAAGG + Intronic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1178054669 21:28784781-28784803 ATGTGGGTAGGGCCAGATAAGGG + Intergenic
1178357879 21:31923593-31923615 GGGAGGGAAGGGAAGGAAAAGGG + Intronic
1178365912 21:31988746-31988768 AGGGAGGGAGGGAAGGAAAAAGG - Intronic
1178390981 21:32198197-32198219 ATATGGGAAGGGAAGGAAAGAGG + Intergenic
1178671178 21:34592922-34592944 ATGTGGGAACTGAAGGAAAGAGG + Intronic
1179200347 21:39212903-39212925 ATGTTCTTAGGGAATGAAAAAGG - Intronic
1179215880 21:39366851-39366873 AAGGGGGAAGGGAAGGAAAAAGG - Intergenic
1179951880 21:44712831-44712853 ATGGAGGGAGGGAAGGAGAAAGG + Intergenic
1180678540 22:17606103-17606125 ACCTGGGCAGGCAAGGAAAAAGG + Intronic
1181182124 22:21075699-21075721 ATTTGTGTTAGGAAGGAAAACGG + Intergenic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181901011 22:26155876-26155898 GTATGGATAGGGAAGAAAAAAGG + Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182126097 22:27816878-27816900 GGGAGGGAAGGGAAGGAAAAGGG - Intergenic
1183096390 22:35554626-35554648 ATGTGGGTGAGGATGGAAAGTGG + Intergenic
1183149532 22:36027434-36027456 ATTTGGGTAGGGAATGGGAAAGG - Intronic
1183418619 22:37697298-37697320 TTGTGGGTAGGGGAGGAAACGGG + Intronic
1183750980 22:39720155-39720177 AAGTGGGGAGTGAAAGAAAATGG + Intergenic
1184303437 22:43577783-43577805 ATGTGGGGAGGGAAGGAGTGAGG - Intronic
1184931413 22:47683937-47683959 AGGAGGGTGGGGAAGGAAGAGGG - Intergenic
1185228962 22:49669440-49669462 ATGTGGGTGGGGACAGATAAGGG - Intergenic
949200843 3:1377805-1377827 GTGTTGGTAGGGGAGGAGAAAGG + Intronic
949433453 3:4003289-4003311 ATGGGGGAAGAGAAGGAAATTGG + Intronic
949550689 3:5110499-5110521 ATGTAGATGGGGAAGGACAAGGG - Intergenic
949568009 3:5263144-5263166 ATTTCAGCAGGGAAGGAAAATGG + Intergenic
950895850 3:16450167-16450189 TTGTGGGTTAGGAAGGAAAGTGG - Intronic
951191155 3:19773049-19773071 ATGTAGGGAGGGAAAGAAGAAGG + Intergenic
951238627 3:20264738-20264760 ATGTGGGTGGGGCAGGACATAGG - Intergenic
951426582 3:22553076-22553098 CTGTGGGAAGGGAAGGCAAGGGG + Intergenic
951432101 3:22620455-22620477 ATGTTGGCAGGGGAGGATAAAGG - Intergenic
951515637 3:23556014-23556036 ATGGGGGTGGGGAGGGAAATGGG + Intronic
951814790 3:26742064-26742086 AGCTGGGTAAGGAAAGAAAATGG + Intergenic
952179439 3:30902445-30902467 ATGAGGGTGGGGAAGGGAACAGG + Intergenic
952407078 3:33014337-33014359 AGCTGGGGAGGGAAGGAAAAAGG + Intronic
952466747 3:33597158-33597180 ATGTGGGTGGGGAAGCAACGAGG - Intronic
952489265 3:33850893-33850915 AAGGGGGAAGGGAAGGAGAAAGG - Intronic
952510565 3:34049576-34049598 ACAGGGGTAGGCAAGGAAAATGG - Intergenic
952590120 3:34942530-34942552 AAGGAGGGAGGGAAGGAAAAAGG - Intergenic
952869564 3:37886314-37886336 AAGTGGGTCGGGAGGGAAATGGG - Intronic
953397811 3:42586991-42587013 AAGTGGGGAGGGAAAGAAAAGGG - Intronic
953588103 3:44223332-44223354 ATGTGGGTAAGCTATGAAAAGGG + Intergenic
953589587 3:44238601-44238623 ACATGGGTAGAAAAGGAAAAGGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954089192 3:48271345-48271367 ATGTGGGTGGGGCCGGATAAGGG - Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954560161 3:51549794-51549816 AAGGGGGTGGGGAAGGAAAATGG + Intronic
954899771 3:54008818-54008840 CTGTGGGTAGGGAAGTAGCAGGG - Intergenic
954909269 3:54088954-54088976 TTGTGGGGAGGGAAAGATAAGGG - Intergenic
955028138 3:55189898-55189920 ATTTGGGGAGGGAAGCAAATTGG + Intergenic
955080317 3:55652057-55652079 ATGTTCGCAGGAAAGGAAAATGG - Intronic
955436758 3:58908349-58908371 ATGAGAGAAGGGAAGGAAAACGG - Intronic
956622262 3:71233269-71233291 AGGAGGGGAGGGAAGGGAAATGG + Intronic
957293837 3:78310947-78310969 AGGGAGGGAGGGAAGGAAAAAGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958017669 3:87960472-87960494 TTGTGAGTAGGGAAAGAATATGG + Intergenic
958267550 3:91457218-91457240 ATTTGGGGAGGGAAAGAGAAAGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
959200877 3:103245217-103245239 ATGTGGGTAGGATAGGTACAAGG + Intergenic
959352295 3:105281106-105281128 ATGTGGGGGAGGAAGGACAAAGG + Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
960840641 3:121955152-121955174 ATGTTGGTGGGGATGGTAAAAGG - Intergenic
960953448 3:123014378-123014400 ATGTTGGTAGACAAGGGAAATGG + Intronic
961162593 3:124741766-124741788 TTGCGGGAAGGGAAGGGAAAGGG + Intronic
961391785 3:126556423-126556445 ATGTGGGGAGGGAAGGGGAAGGG - Intronic
961842620 3:129729165-129729187 CTGCTGGTAGGAAAGGAAAATGG - Intronic
963033164 3:140999454-140999476 ATGAGGGTAGGGAGGAATAAAGG - Intergenic
963044421 3:141092383-141092405 ATATGGTTAGTGAAGGAGAAGGG - Intronic
963139801 3:141937882-141937904 ATTGGGGTAGGGAAGAAAATAGG + Intergenic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963258247 3:143168090-143168112 ATGTGGGCAGGGAAGAAATCTGG - Intergenic
963512398 3:146264078-146264100 CTTTGGGTAGAGAAGGAAAGAGG + Intergenic
963530798 3:146470696-146470718 GTGGGGGGAGGGAAGAAAAAAGG + Intronic
963769824 3:149378566-149378588 ATGGGGGGAGGGAAGGAAGGAGG + Intergenic
964059259 3:152501482-152501504 ATGTGGGTGGGGTCGGATAAGGG - Intergenic
964109997 3:153078061-153078083 ATGGGGGTATGAAAGTAAAAGGG + Intergenic
964729223 3:159847155-159847177 ATGGGGGGTGGGAAGGAAATGGG + Intronic
965262958 3:166506156-166506178 ATTTGGGTAGGTAAAGGAAAGGG + Intergenic
965336016 3:167431527-167431549 ATTTGGGTAGGTAAAGGAAAGGG - Intergenic
965389557 3:168088695-168088717 AAGAGGGCAGGGAAAGAAAAGGG - Intronic
965969153 3:174532413-174532435 ATTTGAGTAGAGAAGGAAAGGGG + Intronic
966923298 3:184628589-184628611 AGGTGGCTATGGAAGGGAAATGG - Intronic
967387511 3:188926127-188926149 TTGTGGGATGGGAAGGGAAAAGG - Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968756162 4:2417593-2417615 ACGTGGGTGGGGAAGGGACAAGG + Intronic
969248325 4:5950708-5950730 ATGTCGTGAGGGAAGAAAAACGG - Intronic
969260458 4:6030240-6030262 ATGGGGGGAGGGAGGGAGAAGGG + Intronic
969353136 4:6609721-6609743 ATGAAGGAAGGGAAGCAAAAAGG + Intronic
969809795 4:9639165-9639187 ATTTGGGTAGGTAAAGGAAAAGG - Intergenic
969810593 4:9644597-9644619 ATTTGGGTAGGGAAGGAAAAAGG - Intergenic
970137876 4:12945834-12945856 ATGGAGGGAGGGAAGAAAAAAGG + Intergenic
970838744 4:20442055-20442077 TTGGGGGTAGGAGAGGAAAAAGG + Intronic
971115034 4:23635815-23635837 CTGTTGGTGGGGAAGTAAAATGG + Intergenic
971564087 4:28116818-28116840 ATGTGGGTAGGGCCAGATAAGGG - Intergenic
971793078 4:31194282-31194304 TTGTGGGGAGGGAAGAAAAACGG + Intergenic
972276375 4:37561545-37561567 ATGTGGCCAGGGAAAGAAAGGGG + Intronic
972658364 4:41088813-41088835 ATGAGGGATGGAAAGGAAAATGG + Intronic
972874638 4:43343513-43343535 AGGAAGGAAGGGAAGGAAAAAGG - Intergenic
973931624 4:55798797-55798819 CTGTGGGTAGGAATGTAAAACGG + Intergenic
974484116 4:62484877-62484899 ATGTGGGAAGCAAAAGAAAAAGG - Intergenic
974706884 4:65530618-65530640 ATGTGGATAGCGAAGAAAATGGG + Intronic
974880391 4:67749644-67749666 AGGAGGGAAGGGGAGGAAAAAGG - Intronic
975393253 4:73845428-73845450 AAGGAGGGAGGGAAGGAAAAGGG - Intronic
975530437 4:75394567-75394589 TGGTGGGTAGGGATGGAGAACGG + Intergenic
975734475 4:77367710-77367732 ATGTGGGTATGGGAAGATAATGG + Intronic
976008848 4:80462561-80462583 ATGGGGGTGGGGAAGGGATAGGG - Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976449843 4:85175773-85175795 ATGTGGGTATGGATATAAAAAGG - Intergenic
976459730 4:85295874-85295896 AAATGGGTAGGGGAGGAAATGGG + Intergenic
976596937 4:86903705-86903727 ATGTGGGTAGGGTCAGATAAGGG - Intronic
976669240 4:87633635-87633657 ATGTGTGAAGGGAGGAAAAAGGG - Intergenic
976744745 4:88391940-88391962 GAGTGGGGAGGGGAGGAAAAGGG - Intronic
978085961 4:104655035-104655057 AAGGAGGTAAGGAAGGAAAAAGG + Intergenic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978777422 4:112516983-112517005 ATTTGGTTAGGGGAGGAGAATGG + Intergenic
979630992 4:122902786-122902808 ATGTGTGTAGGGAAAGAGAAAGG + Intronic
980058169 4:128099222-128099244 TTGTGTGTAGGGAAAGAAATTGG - Intronic
980318783 4:131240648-131240670 ATGTGGGGAGGGAAAAAGAAGGG - Intergenic
980568891 4:134584132-134584154 AAGAGGGGAGGGAAGGAAAGAGG - Intergenic
981046876 4:140272802-140272824 ATTTGGGTGGGGAAGGAAGGCGG + Intronic
981086482 4:140689496-140689518 AAGGGGGAAGGGAAGGAAAGGGG - Intronic
981122982 4:141073848-141073870 AGGTAGAGAGGGAAGGAAAAGGG + Intronic
981732167 4:147911018-147911040 ATGAGGAAAGGGAAAGAAAAGGG - Intronic
982264937 4:153529752-153529774 AAGGGGGTAGGGGAGAAAAAGGG - Intronic
982364628 4:154562151-154562173 TTGTGGGAAATGAAGGAAAATGG + Intergenic
983703653 4:170630635-170630657 ATGTAGTTAGAGGAGGAAAAAGG - Intergenic
984621306 4:181955603-181955625 TTGTGGGGAGGGGAGGAACAAGG + Intergenic
984823139 4:183901512-183901534 CTGTTGGTAGGCAAGCAAAATGG - Intronic
984877018 4:184378337-184378359 ATGTGTGTCTGGAAAGAAAATGG - Intergenic
984911389 4:184676816-184676838 AAGGGGGAAGGGAAGGGAAAAGG - Intronic
985269423 4:188179748-188179770 ATGTGGGAGGGGTAGGATAAGGG + Intergenic
985765335 5:1776288-1776310 ATGTGGGCAGTGATGGGAAAAGG + Intergenic
986106800 5:4667494-4667516 AGGTGGGTAGGGTGGGAAAGGGG + Intergenic
986251483 5:6062186-6062208 AGGTGGGCATGGAAGGAAAGGGG - Intergenic
987027027 5:13937632-13937654 AAGTGGGTAGGGAAAGGAATGGG + Intronic
988020407 5:25614144-25614166 ATGTGGGTAGGGCCAGATAAAGG - Intergenic
988182851 5:27819686-27819708 ATGTGGGACAGGAAGGAAAGAGG + Intergenic
988622347 5:32835976-32835998 AAGTGGGGAGGGAAGGACAGAGG - Intergenic
988703065 5:33695686-33695708 ATGGGAGTTGGGGAGGAAAAGGG + Intronic
989063291 5:37432152-37432174 ATGTTGGTAGGAATGTAAAATGG - Intronic
989069846 5:37498722-37498744 ATGTGGGGTGTGAGGGAAAAGGG - Intronic
989344210 5:40411135-40411157 GTGAGGGTGGGGAAGGGAAAAGG + Intergenic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
989798640 5:45507254-45507276 AGATGGAAAGGGAAGGAAAAGGG - Intronic
989966551 5:50471920-50471942 ATGTAGGTAGTGAAAGAAGAAGG - Intergenic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
990854817 5:60252838-60252860 ATGTGGCATGGGATGGAAAATGG - Intronic
991158550 5:63467531-63467553 ATGTGTGGAGGAAAGAAAAAAGG - Intergenic
992579085 5:78152058-78152080 GAGAGGGAAGGGAAGGAAAAGGG - Intronic
992612903 5:78522816-78522838 ATGTGGGTAGGGCAGGACTGAGG + Intronic
993803417 5:92374490-92374512 ATGTGGGTGGGGCCAGAAAAGGG - Intergenic
993982020 5:94553996-94554018 GTGTGCCTAGGGAAGGGAAATGG - Intronic
994149127 5:96428102-96428124 ATGAGGGTAGGGAATGGGAATGG - Intronic
994266604 5:97723678-97723700 AAGGGGTCAGGGAAGGAAAAGGG - Intergenic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994754789 5:103780272-103780294 AGGGAGGTATGGAAGGAAAAAGG - Intergenic
995016523 5:107316088-107316110 TTGTGGCCAGGGAAGGATAATGG - Intergenic
995550802 5:113279228-113279250 ATGTGGGTTGGGTGGGAAACTGG - Intronic
995664197 5:114522772-114522794 ACGTGATTAGGGAAGAAAAAGGG - Intergenic
995755824 5:115502984-115503006 ATGTAGGTAGGGGAGAAAAGAGG - Intergenic
996063729 5:119058979-119059001 AGGAAGGTGGGGAAGGAAAAAGG - Intronic
996339218 5:122417717-122417739 AGGTGGGGAGGGAAGGAGGAAGG - Intronic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996551573 5:124735725-124735747 ATTTGGGCAGGGAATGTAAATGG + Intronic
996652200 5:125892629-125892651 CTATGGGAAGGAAAGGAAAAAGG + Intergenic
998117689 5:139550485-139550507 ATGTGGGTGGGGTCAGAAAAGGG + Intronic
998244804 5:140490171-140490193 ATGTGATTAGGGATGGACAAAGG + Intronic
998632361 5:143913678-143913700 AAGAGGGTAGGAAAGGCAAAGGG - Intergenic
998781330 5:145659889-145659911 ATGTGGGAAGGGATAGAAAAGGG + Intronic
1000458067 5:161477349-161477371 CTGTTGGTAGGAAAGTAAAATGG + Intronic
1000644371 5:163742989-163743011 ATTCAGGTAGGGAAGTAAAAGGG + Intergenic
1000818257 5:165951277-165951299 ATGTGGCCAGGGAAGCCAAAAGG + Intergenic
1000832168 5:166116428-166116450 TTGTGGGTGGGAATGGAAAATGG - Intergenic
1000894950 5:166844472-166844494 ATATGGATATGGGAGGAAAAAGG - Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1001121160 5:168981316-168981338 ATGGGGGTAGGGGAGAAAGAGGG + Intronic
1001273141 5:170331002-170331024 ATGTGAGTCGGGAAAGAGAAGGG - Intergenic
1001605680 5:172958557-172958579 GTGGCGGCAGGGAAGGAAAAGGG - Intergenic
1002272271 5:178080332-178080354 ATGCGGGCAGGGGAGGAAGAAGG - Intergenic
1002737831 5:181409576-181409598 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1002864966 6:1113560-1113582 CTGTTGGTAGGAATGGAAAATGG + Intergenic
1003153201 6:3570132-3570154 ATGTGGGTAGAGCAGGAGAGAGG - Intergenic
1003822717 6:9917920-9917942 CTGAGAGTAGGGAAGGAAAATGG - Intronic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004201806 6:13555464-13555486 CTGTGGGGAGGGAAGAAAATGGG - Intergenic
1004303434 6:14478641-14478663 GTGTGGGTAGGGGAGGAGAGGGG + Intergenic
1004329147 6:14705744-14705766 ATGTAGGAAGGGGAGGAAAAGGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004587350 6:17015589-17015611 ATGTGGGTGGGGCCGGATAAGGG - Intergenic
1004768105 6:18754281-18754303 ATTTGGGTAGGTAAAGGAAAAGG + Intergenic
1004768935 6:18759617-18759639 ATTTGGGTAGGTAAAGGAAAAGG + Intergenic
1005109076 6:22258851-22258873 ATGTGGGTAATGAAGGAAAAAGG + Intergenic
1005205103 6:23393766-23393788 AGGAAGGGAGGGAAGGAAAAAGG + Intergenic
1005228821 6:23674953-23674975 ATGTGGGAAGGGAAGAGAACAGG - Intergenic
1005317256 6:24615485-24615507 ATGTGTGGAGGGGAAGAAAAGGG + Intronic
1005349382 6:24919143-24919165 ATGTGAGCAGAGAAGGAAAGAGG - Intronic
1005366949 6:25088137-25088159 ATTTGGGGATGTAAGGAAAAGGG + Intergenic
1005615983 6:27573774-27573796 ATGTGAGGAAGGAAAGAAAAAGG + Intergenic
1005774062 6:29110059-29110081 AAGTGGGAGGGGCAGGAAAATGG - Intergenic
1005809683 6:29506345-29506367 ATGGGGGAAGAGATGGAAAAAGG - Intergenic
1006136548 6:31899633-31899655 ATATGTGGAGGGAGGGAAAAGGG - Exonic
1006553599 6:34846112-34846134 AGGAGGGAAGGGAAGGGAAAGGG - Intronic
1007425609 6:41744185-41744207 ATATTGGCAGGGAAGGCAAAGGG + Intronic
1008542570 6:52558082-52558104 GTGGGGGTAGGGCAGGAGAAGGG - Intronic
1008987665 6:57564372-57564394 ATTTGGGGAGGGAAAGAGAAAGG - Intronic
1009176269 6:60462977-60462999 ATTTGGGGAGGGAAAGAGAAAGG - Intergenic
1009324425 6:62332364-62332386 CTGTGGGTAGGAATGTAAAATGG - Intergenic
1009537896 6:64913399-64913421 AAGTGAGCAGGGAAGGAGAAAGG - Intronic
1009907685 6:69889807-69889829 ATGTGGGTGGGGAAAAATAAGGG + Intronic
1010977674 6:82334548-82334570 ATGTGGAAATGAAAGGAAAAGGG - Intergenic
1011030476 6:82917487-82917509 ATGCCGATAGGGAAGGAAAGAGG + Intronic
1011084222 6:83521485-83521507 GTGAGGGAAGGGAAGGAGAAGGG - Intronic
1011511211 6:88103355-88103377 ATGTGGGTGGGGAAGCAGGATGG - Intergenic
1012976408 6:105785069-105785091 ATCTCCGTAGGGAAGGAAACAGG - Intergenic
1013105065 6:107020026-107020048 AGGAGGGTAAGGAAGGAGAATGG + Intergenic
1013566925 6:111374502-111374524 CAGTGGGTAGGGAAGCAGAAAGG + Exonic
1013882447 6:114921498-114921520 TTGTGGGGAGGGAAGGATAGGGG - Intergenic
1014080449 6:117280952-117280974 TTGAGGGAGGGGAAGGAAAAGGG + Intergenic
1014207863 6:118676322-118676344 ATGAGGGTAGGGTTGGGAAAAGG - Intronic
1014237571 6:118976936-118976958 ATGCTAGTAGGGATGGAAAATGG + Intronic
1014614999 6:123587743-123587765 ATTTGGGTAGGTAAAGCAAAAGG + Intronic
1015745598 6:136506411-136506433 ATGTGGGGAGGGAAGGGCATTGG + Intronic
1016283494 6:142447159-142447181 ATGGAAGGAGGGAAGGAAAAAGG - Intergenic
1017063045 6:150504179-150504201 AGGAAGGAAGGGAAGGAAAAAGG + Intergenic
1017240438 6:152162377-152162399 ATGATGGTAGAGAGGGAAAAAGG - Intronic
1017295817 6:152792710-152792732 AAGTGTGGAGGGAAGAAAAAAGG + Intergenic
1017732058 6:157325337-157325359 ATGTATGAGGGGAAGGAAAAAGG - Intergenic
1018207263 6:161447097-161447119 GTGTGGGGTGAGAAGGAAAATGG - Intronic
1018304352 6:162439303-162439325 AAGGGGGAAGGGAAGGGAAAAGG - Intronic
1019004630 6:168785975-168785997 AAGGGGGAAGGGAAGGAACATGG + Intergenic
1019187908 6:170231720-170231742 ATCTGGGGTGGGGAGGAAAAAGG - Intergenic
1019200468 6:170310239-170310261 GTGTGGGTAGGAAAGGCCAAGGG + Intronic
1019242930 6:170685134-170685156 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1019717067 7:2543974-2543996 ATGGGGGAAGAGAGGGAAAAGGG + Intronic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1020882171 7:13775927-13775949 AAGGAGGTGGGGAAGGAAAATGG - Intergenic
1021214996 7:17904983-17905005 ATGAGGGAAGGAATGGAAAAAGG + Intronic
1021410012 7:20319870-20319892 GAGTGGGTAGAGAAGGAAACTGG - Intergenic
1021781619 7:24112660-24112682 ATGTGAGAAGAGAAGTAAAATGG - Intergenic
1021889119 7:25170136-25170158 ATGTTGGTAGGAATGTAAAATGG - Intronic
1021972370 7:25978084-25978106 AAGTGGGCAGGGAAAGAAAAAGG + Intergenic
1022161731 7:27717734-27717756 AGGAAGGGAGGGAAGGAAAAGGG - Intergenic
1022206043 7:28164736-28164758 ATGGGGGCAGGGGAGGAGAATGG - Intronic
1022282694 7:28927017-28927039 GTGGGGCTTGGGAAGGAAAAAGG + Intergenic
1022796246 7:33733910-33733932 ATTGGTGTTGGGAAGGAAAATGG - Intergenic
1023076239 7:36485575-36485597 AGGGAGGGAGGGAAGGAAAAAGG - Intergenic
1023820434 7:43977618-43977640 AGGAGGGAAGGGAAGGAAAGGGG - Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024236501 7:47402780-47402802 AAGTGGTTAGGGAAGGGAAAAGG + Intronic
1024485988 7:49920129-49920151 ATTTGGATATGGAAGCAAAATGG + Exonic
1024562296 7:50654747-50654769 AGGTAGGTAGGGAAAGAGAATGG - Intronic
1024737791 7:52323656-52323678 AAGGGGGAAGGGAAGGGAAAGGG - Intergenic
1025775697 7:64558932-64558954 AAGTGGGAGGGGAAGAAAAAAGG + Intronic
1026833287 7:73622988-73623010 ATTTGGGGAGGGAGGGAGAAGGG + Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027417633 7:77990156-77990178 GCGTGGGTAGGGAAGGACCAGGG + Intergenic
1027471717 7:78582284-78582306 ACGTGGGAAGTGAAGGAGAATGG + Intronic
1027905911 7:84181120-84181142 ATTTGAGGAGGGAAAGAAAAGGG - Intronic
1028194820 7:87894064-87894086 AGGTTGGTGGGGAAGGTAAAAGG - Intronic
1028245647 7:88473517-88473539 ATGTTGGAAGGGCAGGAACAAGG + Intergenic
1028462481 7:91111206-91111228 ATTTGGGTAGAGAAGGAAAAAGG - Intronic
1028947651 7:96599070-96599092 AAGAAGGAAGGGAAGGAAAAAGG + Intronic
1029379608 7:100204582-100204604 ATGTGGGAAAGGGAGGAACACGG - Intronic
1029748723 7:102531140-102531162 AGGAGGGAAGGGAAGGAAAGGGG - Intergenic
1029766670 7:102630224-102630246 AGGAGGGAAGGGAAGGAAAGGGG - Intronic
1030114660 7:106054131-106054153 AGGTGGGTAGGGAAGCAGAGAGG + Intergenic
1030328636 7:108249091-108249113 ATGTGTGTTGGGGAGGCAAAAGG + Intronic
1030524586 7:110637680-110637702 CAGTAGGCAGGGAAGGAAAAGGG + Intergenic
1030566423 7:111163648-111163670 ATGAGGGTAGGAAGGGATAAGGG + Intronic
1030635178 7:111940010-111940032 AGGTGGGTAGAGAAGAACAATGG - Intronic
1030824040 7:114132990-114133012 ATGAAGGCAGGGAAGGAAACAGG + Intronic
1031730862 7:125299191-125299213 ATGTGGATGGGGAAGGATAAGGG - Intergenic
1031829667 7:126610989-126611011 GTGTGGTAAGTGAAGGAAAAGGG - Intronic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1033092207 7:138396309-138396331 AAGTGCAAAGGGAAGGAAAATGG - Intergenic
1033444965 7:141412640-141412662 ATGAGGGAAGGAAAAGAAAATGG + Intronic
1033639387 7:143246703-143246725 ATGTGGGAAGGGAAGGGATATGG - Intronic
1033843944 7:145409413-145409435 TAGTAGGTGGGGAAGGAAAAGGG - Intergenic
1034465154 7:151223648-151223670 ATGGGGGTAGGGAAGGAGGGAGG + Intronic
1034545817 7:151788198-151788220 CTGTGGGTGGGAAAGTAAAATGG - Intronic
1034808192 7:154106795-154106817 ATGTGGGGAGGGACGGATGAAGG + Intronic
1035487162 7:159234951-159234973 ATCAAGGTAGGGAAGGAGAAGGG - Intergenic
1035505191 8:123028-123050 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
1035753516 8:2012312-2012334 AGGAGGAGAGGGAAGGAAAATGG + Intergenic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036488139 8:9198673-9198695 TTGTAGGTAAGGAAGCAAAATGG - Intergenic
1036537619 8:9665903-9665925 ATGAGGTTAGGGAGGGGAAAAGG - Intronic
1036635527 8:10547654-10547676 GAGTGGGAAGGGAAGGGAAAAGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037456511 8:19069366-19069388 ATGGGGGAAGGGAAAGGAAAAGG + Intronic
1037564463 8:20105852-20105874 ATGTGGGGAGGGAGGGACAGTGG + Intergenic
1038379709 8:27081122-27081144 ATGTGTATATGGAAGGGAAAAGG + Intergenic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1040804473 8:51378497-51378519 ATGTGGGTGGGGCCAGAAAAGGG + Intronic
1040847246 8:51856401-51856423 ATGTTGGTGGGAATGGAAAATGG + Intronic
1041195682 8:55399537-55399559 ATGTGGTTAGGGATGGGAATAGG - Intronic
1041573928 8:59371076-59371098 AGGAGGGAAGGGAAGGAAAGAGG - Intergenic
1041853167 8:62417087-62417109 ATGTAGGTGGGGAAGGTTAATGG - Intronic
1041928926 8:63266639-63266661 ATGTGGCTGGGGAAGGAAGTAGG - Intergenic
1042622890 8:70725316-70725338 ATGGGGGAGGGAAAGGAAAATGG + Intronic
1043285258 8:78519921-78519943 ATCTGGTTGGGGAAGGAAGATGG - Intronic
1043996328 8:86822267-86822289 AGGTGGGTTGGAAAGAAAAATGG + Intergenic
1044324455 8:90844022-90844044 AGGTGGGTAGAAAAGGAAAATGG + Intronic
1044459528 8:92428757-92428779 ATGTGGGTGGGGTCGGATAAGGG - Intergenic
1044758989 8:95496893-95496915 ATCTGGGGTGGGAAGAAAAAGGG - Intergenic
1044794365 8:95881615-95881637 TTGGGGGTAGGGAGGAAAAAGGG + Intergenic
1045514290 8:102843367-102843389 ATGTGGATTGGAAAGAAAAATGG + Intronic
1046055149 8:109070618-109070640 ATGTGGGTAGGGTCAGATAACGG - Intergenic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1046303956 8:112337280-112337302 ATGTGTGTGGGGAAGGGAAGGGG - Intronic
1046362629 8:113182985-113183007 ATGTGGGTAGGCAAATAAAGAGG + Intronic
1046409903 8:113828125-113828147 ATATAGGTAGGGAAAGAAGAAGG - Intergenic
1046779160 8:118196598-118196620 ATGTGCCTAGAGAAGGAAAAGGG - Intronic
1047353478 8:124097910-124097932 AGGTGAGGAGGGAAGGAAATGGG - Intronic
1048350205 8:133609769-133609791 AGGTAGGTAGAGAAGGAACATGG + Intergenic
1048536902 8:135305014-135305036 ATGTGTTTAGTGATGGAAAACGG - Intergenic
1048599649 8:135906237-135906259 CTGTGGGCAGGCGAGGAAAAAGG - Intergenic
1048941205 8:139402376-139402398 AAAAAGGTAGGGAAGGAAAATGG - Intergenic
1048959967 8:139568291-139568313 ATATGTGTAGGGGAGGCAAAGGG - Intergenic
1048966350 8:139617703-139617725 ATGTGTGATGGGAAAGAAAACGG + Intronic
1049011271 8:139889268-139889290 ATGTGGGCGGGGCAGGGAAATGG + Intronic
1049645987 8:143735822-143735844 GGGTGGGTAGGGAAGGACCAGGG - Intergenic
1050218017 9:3350458-3350480 TTGTTGGGAGGGATGGAAAATGG + Intronic
1050298891 9:4236426-4236448 ATGTGGAAAAGGGAGGAAAAGGG - Intronic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1051424978 9:16923947-16923969 ATGTGGGTAGGGTCAGATAAGGG - Intergenic
1051493026 9:17688345-17688367 ATGTAGTTTGGGATGGAAAATGG + Intronic
1051549678 9:18315075-18315097 ATGTGGGTAGGGTCAGATAAGGG - Intergenic
1051968793 9:22862825-22862847 ATGTGGGTAGGGCCAGATAAGGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052275382 9:26669883-26669905 AGGGGGGAAGGGAAGGGAAATGG - Intergenic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053199801 9:36144651-36144673 ATGTGGGCAGGGCAGGGATATGG - Intronic
1053466831 9:38314688-38314710 TTGGAGGGAGGGAAGGAAAATGG - Intergenic
1054800912 9:69347369-69347391 ATGTTGGTAGGGAAGGTAACGGG - Intronic
1054850583 9:69842978-69843000 GTGGGGGTGGGGAAGGAAAGAGG + Intronic
1055430822 9:76241602-76241624 ATGTGAGAAGGGAAGAAAGAAGG - Intronic
1056540543 9:87567389-87567411 ATGGGGGTAGGGAAGGGAATGGG + Intronic
1057406562 9:94776712-94776734 ATATGGGTGCGGAAGGATAATGG - Intronic
1057424188 9:94935415-94935437 AGGTGGAAAGGGAAGGGAAATGG + Intronic
1057588034 9:96347159-96347181 ATGTGGGTAGGTAAGAAATTTGG - Intronic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1058185949 9:101855000-101855022 ATCTTGGGAGGGAAGGTAAAAGG - Intergenic
1059150783 9:111947947-111947969 ATATGGGTAGGAACAGAAAAAGG - Intergenic
1059226444 9:112677474-112677496 CTGTTGGTAGGGATGTAAAATGG - Intergenic
1059421600 9:114195920-114195942 AGGTGGGTGAGGCAGGAAAACGG - Intronic
1059542397 9:115144015-115144037 AAGGGGGAAGGGAAGGACAAAGG - Intronic
1059562625 9:115349939-115349961 AAGTGAATAGAGAAGGAAAAAGG + Intronic
1059975814 9:119715762-119715784 AGGTGGGGAGGGAGGGAAAGGGG + Intergenic
1060349038 9:122841497-122841519 ATGGGGATAAGCAAGGAAAATGG + Intergenic
1061084371 9:128390572-128390594 AGGTGGGAAGGGAGAGAAAACGG - Exonic
1061526867 9:131172871-131172893 ACTTGGGGAGGGAAGAAAAAGGG + Intronic
1061940309 9:133880378-133880400 AGGCGGGCAGGGAAGGACAATGG + Intronic
1203603121 Un_KI270748v1:34358-34380 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1186093659 X:6077049-6077071 ATGTAGGAATGAAAGGAAAAAGG - Intronic
1186239944 X:7555215-7555237 AGGGAGGAAGGGAAGGAAAAAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186720149 X:12295592-12295614 ATGTGGGGATGCAAGTAAAATGG - Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187264423 X:17718393-17718415 AGGAAGGAAGGGAAGGAAAAAGG + Intronic
1187264440 X:17718485-17718507 AGGAAGGGAGGGAAGGAAAAAGG + Intronic
1187507410 X:19888172-19888194 CTGTTGGAGGGGAAGGAAAAGGG + Intergenic
1187841071 X:23488881-23488903 AGGTGAGGAGGGAAGGAAATGGG + Intergenic
1188164561 X:26845957-26845979 ATGCAAGTAGGGAAGTAAAAAGG - Intergenic
1188842169 X:35029727-35029749 GAGATGGTAGGGAAGGAAAAGGG + Intergenic
1188870776 X:35368190-35368212 AAGTGGGTAGGGGAGAAATAGGG + Intergenic
1189288197 X:39866885-39866907 GTGGGGGTGGGGGAGGAAAAGGG - Intergenic
1189320000 X:40082216-40082238 TTGGGGGTGGGGAAGGAAAGGGG - Intronic
1189381815 X:40507533-40507555 ATTTGGGGAAGCAAGGAAAAAGG - Intergenic
1189518445 X:41740328-41740350 ATGCTGGTTGGGAAGGAAAAGGG - Intronic
1189576428 X:42358779-42358801 ATGTGGGGAGGGGAGGATAAAGG - Intergenic
1190502646 X:51095179-51095201 ATGGGGGTGGGGAAGAGAAAGGG - Intergenic
1190527485 X:51342553-51342575 ACTTTGGAAGGGAAGGAAAACGG + Intergenic
1191707318 X:64106782-64106804 ATATAGGTAGGCAAGAAAAATGG - Intergenic
1192261357 X:69507328-69507350 CAGAGGGTTGGGAAGGAAAAGGG + Intronic
1192432991 X:71125235-71125257 ATGTGGGTTGGGAAAGGGAAGGG + Intronic
1192560908 X:72127370-72127392 ATCTGGGAAAGGAAGGAAGAGGG + Intronic
1192582936 X:72299756-72299778 ATGAGGCAAGGGTAGGAAAACGG - Intronic
1193023634 X:76821059-76821081 AAGAGAGTAGGGAAGGACAAAGG - Intergenic
1193181282 X:78460132-78460154 TGGTGGATAGGGAAGGAAATGGG - Intergenic
1193493679 X:82183843-82183865 ATGTGTGTATAGCAGGAAAAGGG + Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1195021963 X:100837746-100837768 AAGTAGAAAGGGAAGGAAAAAGG - Intronic
1195378948 X:104253709-104253731 ATGAGGCTAGCGAAGGAAAGGGG + Intronic
1195677098 X:107514879-107514901 AGGTGGGGAGGTAAGGGAAAGGG + Intergenic
1195703061 X:107719254-107719276 GTATGGGAAGGGAAGGCAAAAGG + Intronic
1195804080 X:108743111-108743133 AAGTGGGGAGGGAAGGGAAGAGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196213842 X:113027412-113027434 ATTTGGGTAGGGCAGGGACAGGG + Intergenic
1196759831 X:119191064-119191086 GTTTGAGTAGGGAAGGAGAAAGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197004886 X:121483377-121483399 ATTTGGGTAGTGAAGGAATAGGG - Intergenic
1197444987 X:126542426-126542448 CTGTTGGTAGGGATGTAAAATGG + Intergenic
1197837538 X:130711552-130711574 ATAAGGGAAGGGAAGGCAAAGGG + Intronic
1197927334 X:131660622-131660644 GTGTGTGTAGGGAAAGAAAGAGG - Intergenic
1197994671 X:132360415-132360437 ATGTGGGAAGTGAAGAAAAGGGG + Intergenic
1198022215 X:132670437-132670459 ATGTGTGTGGGCATGGAAAAAGG + Intronic
1198095320 X:133374391-133374413 AGGTAGGTAGGGAAAGAGAAAGG + Intronic
1198810729 X:140533711-140533733 ATTTGGGTAGGAGAGGAAAACGG + Intergenic
1199309258 X:146303572-146303594 AGGTGCGTAGGGAAGAAGAAAGG - Intergenic
1201051434 Y:9939962-9939984 ATGAGAGTAGGGAAGTGAAAGGG + Intergenic
1201227105 Y:11828725-11828747 GTGTGGGCAGGGTAGGGAAAGGG - Intergenic
1201303152 Y:12527577-12527599 ATGCAGGAAGGGAAGGAGAAAGG + Intergenic
1201573836 Y:15440950-15440972 GTGTGGGTAGGGATGGCAAGGGG + Intergenic
1201581055 Y:15512555-15512577 ATTTGGGTAGGTAAACAAAAAGG - Intergenic
1202255532 Y:22916544-22916566 ATGTGGGTAGGGCCCAAAAAAGG - Intergenic
1202385196 Y:24319412-24319434 TGGTGGGGAGGGAAGAAAAAAGG - Intergenic
1202408523 Y:24550293-24550315 ATGTGGGTAGGGCCCAAAAAAGG - Intergenic
1202462259 Y:25119787-25119809 ATGTGGGTAGGGCCCAAAAAAGG + Intergenic
1202485589 Y:25350716-25350738 TGGTGGGGAGGGAAGAAAAAAGG + Intergenic