ID: 963239326

View in Genome Browser
Species Human (GRCh38)
Location 3:142987566-142987588
Sequence TAGCTTCTGAGGGTCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963239326_963239333 -4 Left 963239326 3:142987566-142987588 CCACCCCTGACCCTCAGAAGCTA 0: 1
1: 0
2: 1
3: 21
4: 253
Right 963239333 3:142987585-142987607 GCTAAAGATGGCTTTCCTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963239326 Original CRISPR TAGCTTCTGAGGGTCAGGGG TGG (reversed) Intronic
901032734 1:6317595-6317617 TGCCTGCTGAGGGTCAGGGCAGG - Intronic
901190863 1:7408999-7409021 TGTCTGCTGAGGGCCAGGGGAGG - Intronic
902279753 1:15365756-15365778 TATCTCCTGAGTGTCAGGAGGGG - Intronic
902336436 1:15757572-15757594 TGGTTTATGAGGGTCAGAGGAGG - Intronic
906034436 1:42741532-42741554 TGCCATCTGAGGGTCAAGGGTGG + Intergenic
907456501 1:54579721-54579743 TACCTTGTGAGAGGCAGGGGCGG + Intronic
907487766 1:54789119-54789141 CAGCTTTTGAGGGTCAGAGCTGG + Intronic
908850903 1:68374895-68374917 TAGCTGCTGAGGATAAGGAGGGG - Intergenic
912460328 1:109826613-109826635 TAGCTGCTGAGGGACACAGGTGG - Intergenic
912714021 1:111969258-111969280 CAGGTTCTGAGGGTGAAGGGTGG - Intronic
917962502 1:180155597-180155619 TAGCTGCTGTGGGTCAGTGCTGG + Intronic
918482397 1:184992568-184992590 TAGGTTCCGAGGGTAAGGAGGGG + Intergenic
918825163 1:189314730-189314752 TAGGTTCTGAGGGACAGCAGAGG - Intergenic
920971649 1:210748277-210748299 TTGTTTCTGATGGTCAGGGTTGG - Intronic
922481997 1:225945566-225945588 TGGCTTCAGGGGGTCAGGGCAGG - Intergenic
923512210 1:234662306-234662328 TACCTTCTGAGGGCGAGAGGCGG + Intergenic
1062968173 10:1626223-1626245 TAGCGTCTGAGGTCCAGTGGAGG - Intronic
1064835110 10:19517852-19517874 GTGCTTCTGAGGGTCATGGGAGG + Intronic
1066237702 10:33502413-33502435 TTGCTTCTCTGGGTCAGGGGAGG - Intergenic
1067936081 10:50613268-50613290 TAGCCTCCCTGGGTCAGGGGTGG - Intronic
1069545566 10:69325648-69325670 CAGCTACTGGGGGGCAGGGGGGG - Intronic
1069834828 10:71301892-71301914 CAGCTTCTGAGGGTGGGGTGGGG - Exonic
1069954179 10:72039831-72039853 TAGGTTCTGAGGGTCTTGTGTGG + Intergenic
1071877202 10:89854161-89854183 TACCTTGTGAGGGTGAAGGGCGG - Intergenic
1072527946 10:96290579-96290601 CAGCTTCTGAGTGGCAGTGGGGG - Intergenic
1072689508 10:97562532-97562554 TACCTTCTTAAGGGCAGGGGAGG + Intronic
1072913770 10:99524574-99524596 TAGCTTCAGAGGGTCGGGAGTGG + Intergenic
1073737071 10:106361086-106361108 TATTATCTGAGGCTCAGGGGAGG + Intergenic
1074082150 10:110176432-110176454 TTTCTTCTGAGGGCCAGGCGGGG - Intergenic
1074967744 10:118507258-118507280 TAGCTACTGGGGGTGGGGGGGGG + Intergenic
1076111166 10:127860870-127860892 CAGGCTCTGAGGGACAGGGGTGG - Intergenic
1076585275 10:131542835-131542857 AAGCTCCTGAGGACCAGGGGTGG + Intergenic
1077190390 11:1253627-1253649 TCCCTGCTGAGGGTCTGGGGAGG + Intronic
1077280924 11:1745114-1745136 ACCCTTCTGAGGGTCAGGGACGG - Intronic
1077375616 11:2203998-2204020 CAGCTTCAAAGGGCCAGGGGAGG + Intergenic
1078258627 11:9683282-9683304 CAGCTGCTGGGGGTGAGGGGTGG + Intronic
1078429915 11:11280862-11280884 TAGCTTCTAAGGGACAGGATGGG - Intronic
1080409880 11:32013656-32013678 AATCTTCAGAGGGTCGGGGGAGG - Intronic
1080583995 11:33665672-33665694 TACCTTCAGAAGGCCAGGGGGGG - Intronic
1082848332 11:57743974-57743996 TGGCTTCTGAGGCTTAGGGAAGG + Exonic
1083207817 11:61163406-61163428 TTGTTTCTGAGGGTTAGGGAGGG + Intergenic
1083584005 11:63843364-63843386 TAGTTTCTGAGGCCCAGAGGTGG - Intronic
1085043526 11:73340646-73340668 TAGCTTGAGAGGGTCAGATGAGG + Intronic
1085172105 11:74458224-74458246 TGGGTTCTGATGGTCAGGGAAGG - Intronic
1085255328 11:75169428-75169450 TGGCCTCTGAGGGTCAGGCCAGG + Intronic
1087225131 11:95590813-95590835 GAGCTCCTTAGGGTCAGGGCAGG + Intergenic
1088868632 11:113873048-113873070 TAGCTTCTGAGTGTCAGGGAAGG + Intronic
1089461109 11:118654309-118654331 TAGCCTCTGGAGGTCAGAGGTGG - Intronic
1089681441 11:120121179-120121201 TGTCATCTGAGGGTCAGGTGGGG - Intronic
1092019497 12:5189132-5189154 TAGCTTGAGAGGGTCAAGGAAGG + Intergenic
1094141668 12:27188160-27188182 TAGCTTCTGAGGCTGAGGGTGGG - Intergenic
1094484341 12:30912351-30912373 TAGATCATGAGGGTCAGGGTAGG - Intergenic
1096532947 12:52253353-52253375 TTGCTTATGAGGCTCAGGGTGGG + Intronic
1096820705 12:54231830-54231852 TAGCTTTTGGGGGTGGGGGGTGG + Exonic
1098948595 12:76615714-76615736 TAGCTTTTGAGGTTCATTGGAGG - Intergenic
1099892090 12:88602424-88602446 CAGGTCCTGAGGGTTAGGGGAGG - Intergenic
1102426772 12:112849933-112849955 CTGCCTCTGGGGGTCAGGGGAGG + Intronic
1103192585 12:119014730-119014752 TAGCTTCAGAGGGTTGGGAGGGG + Intronic
1103600996 12:122054546-122054568 TAGCTGCTGAGGGCCCTGGGAGG - Intronic
1107988722 13:45798463-45798485 TTGCTTCTGGGAGTCAGGGCAGG + Intronic
1109205846 13:59481915-59481937 TACCTACTGAGGGTCAGGAATGG + Intergenic
1111333966 13:86796802-86796824 TAGATTCTAAGGGTCAAGGAAGG - Intergenic
1113943590 13:114031775-114031797 TAGCTCCTGAGGCTCCGGGAAGG + Intronic
1115120203 14:29928328-29928350 TACCTTCGGAGGGTCAAGGGAGG + Intronic
1116659509 14:47691187-47691209 GAGCTCCTGAGTGTCAGGGGAGG - Intergenic
1118709194 14:68505933-68505955 CTGCTGCTGAGGGTCAGGTGGGG + Intronic
1121353435 14:93193070-93193092 AAGCTGCTGAGGGCCAGGAGTGG - Intronic
1121471712 14:94160507-94160529 TTACTTCTAAGGGTCAGGGCAGG - Intronic
1122737058 14:103848769-103848791 TGGCCTCTGAGGGACAGGGGTGG - Intergenic
1122777760 14:104129884-104129906 AAGCTTCTGGGGGTGAGAGGAGG - Intergenic
1123014016 14:105365044-105365066 GAGCCTGTCAGGGTCAGGGGTGG + Intronic
1129035232 15:72645096-72645118 AAGGTTCTCAGGGTCAGGGAAGG - Intergenic
1129214652 15:74092120-74092142 AAGGTTCTCAGGGTCAGGGAAGG + Intergenic
1129763011 15:78142558-78142580 TAGCCTCTGAGGGCCTGGGCAGG - Intronic
1129787168 15:78317115-78317137 TTGCTTCAGAGGGTCAGGCAGGG + Intergenic
1129993987 15:79989223-79989245 CAGCATCTGAGTGGCAGGGGTGG - Intergenic
1130227205 15:82068225-82068247 TAGCCTCTCAGAGTCAGGGCAGG + Intergenic
1131288870 15:91087294-91087316 TAGACTCTAAGGGGCAGGGGTGG - Intergenic
1132292073 15:100710816-100710838 TAGGAACTGAGGCTCAGGGGAGG + Intergenic
1132535122 16:475087-475109 CAGCATCTGAGGGTAAGAGGAGG + Intronic
1133606871 16:7396086-7396108 CAGCTTGTAAGTGTCAGGGGAGG + Intronic
1134261292 16:12653088-12653110 TAGCTTGTGAGTGTCAGAGTTGG - Intergenic
1135033739 16:19059506-19059528 TAGCTCCAGAGGGTCATGGCTGG + Intronic
1135407814 16:22210689-22210711 TAACTCCTGGGGTTCAGGGGAGG + Intronic
1135430509 16:22378469-22378491 AAGTTTTTGAGGGTCAGGCGTGG + Intronic
1136037053 16:27548592-27548614 CATATTGTGAGGGTCAGGGGAGG - Intronic
1137614216 16:49837360-49837382 TAGGTTGTGGGGGTCTGGGGAGG - Intronic
1138630370 16:58289495-58289517 TAGTGACTGAGGGGCAGGGGAGG + Intronic
1138821356 16:60263918-60263940 TAGCATCCTGGGGTCAGGGGTGG + Intergenic
1139194878 16:64907148-64907170 AAGACTCTGAGAGTCAGGGGAGG - Intergenic
1139493752 16:67301456-67301478 AGGCTTCTCAGGGGCAGGGGAGG - Intronic
1140919886 16:79527685-79527707 AAGCTTGTGAGGGTGTGGGGTGG + Intergenic
1143023831 17:3929767-3929789 TAGGGTCTGGGGGTCAGTGGGGG - Intronic
1143479430 17:7220021-7220043 CAGCTGCTGAGGCTCGGGGGCGG + Intronic
1144040869 17:11410146-11410168 TAGCTTCAGTGAGTCAGGGCTGG - Intronic
1144710243 17:17396784-17396806 TAGCTTCTGTGGGTCTTGGCTGG - Intergenic
1145280889 17:21466178-21466200 TCCCTTCCAAGGGTCAGGGGAGG + Intergenic
1145781151 17:27564279-27564301 TAGCTACTGAAGGCCAGGTGCGG - Intronic
1148203581 17:45765807-45765829 TGGCTTCTGGGGGACAAGGGCGG + Intergenic
1148460733 17:47837815-47837837 TAGCTTCTGCTGGCCTGGGGTGG - Exonic
1148716507 17:49719749-49719771 GAGCTGCTGAGGGTGAGTGGCGG - Exonic
1148859372 17:50596120-50596142 TCGAGTCTGAGGCTCAGGGGAGG + Intronic
1151477553 17:74352556-74352578 CAGGGTCTGAGGGTCAGGGCTGG + Intronic
1151556049 17:74847273-74847295 TAGCTGCTGGGGGTGGGGGGGGG - Intronic
1151758240 17:76086809-76086831 AAGCTTCAGAGGGACAGGAGGGG + Intronic
1152685222 17:81690589-81690611 TGCCTTCTGTGGGGCAGGGGAGG + Intronic
1156234001 18:35183411-35183433 TTGCTGCTGCAGGTCAGGGGCGG + Intergenic
1156878473 18:42045595-42045617 TAGTTTCTGAAGGCCAGGGCTGG + Intronic
1158146869 18:54323780-54323802 CTGCTTCTGTGGGACAGGGGTGG + Intergenic
1158817671 18:61122309-61122331 GAGCTTCTGTGGATCTGGGGAGG + Intergenic
1160684253 19:426285-426307 CAGCTTCTTAGGGTCAGGATGGG + Intronic
1161286703 19:3472140-3472162 TCGCTGCTGAGGGTGAGTGGGGG - Intergenic
1161939776 19:7395147-7395169 TAGCTACTGTGGATCTGGGGGGG + Intronic
1162752566 19:12838062-12838084 TGGTCTCTGAGGGTCAGGAGAGG + Intronic
1163510710 19:17733485-17733507 TAGTCTCTGAGGGTCGAGGGTGG - Intronic
1164516783 19:28943562-28943584 TAGCCTGTGAGTGTCAGGGCAGG - Intergenic
1164933964 19:32196936-32196958 TAGCTTCTGAGGGCGAGAGCAGG - Intergenic
1165953795 19:39489342-39489364 TAGGATCTCAGGCTCAGGGGAGG + Intronic
1166705183 19:44904434-44904456 AAGATTCTGCGGGTCAGGGGAGG - Intergenic
1166715428 19:44964059-44964081 CAACTTCTGAGGGTCAGGCAGGG - Intronic
1167022404 19:46887868-46887890 TGACTTCTGTGGGTCAGGGAAGG - Intergenic
1167207997 19:48115528-48115550 TGGATTTTGAGAGTCAGGGGAGG - Exonic
1168466663 19:56607802-56607824 CAGTTTCTGAGGGTCAGGAATGG + Intronic
925461344 2:4065742-4065764 TTCCTTCTGAGGTTGAGGGGAGG - Intergenic
925981370 2:9180079-9180101 AAGCCTGGGAGGGTCAGGGGAGG - Intergenic
926721414 2:15964136-15964158 TGGCTTCTGGGGGCCAGGTGTGG + Intergenic
928011002 2:27607656-27607678 AAGCTTCTTAGGGCCAGGCGTGG - Intronic
931633770 2:64323837-64323859 TAGTTAATGAGGGTCAGGGCTGG - Intergenic
932431037 2:71673618-71673640 TGGCATCTCAGGGTCAGGGTGGG - Intronic
932745190 2:74328252-74328274 TGACTTCTGAGGCTCAGTGGCGG + Intronic
934679687 2:96274474-96274496 TAGCTTCCGAGGCTCAGTGTTGG + Exonic
935154512 2:100471147-100471169 TAGCTTCTAGGGAACAGGGGTGG + Intronic
935820524 2:106887860-106887882 TAGCGACTGAGGGTGTGGGGTGG - Intergenic
937656160 2:124379341-124379363 CAGCTGCTGGGGGTCAGGGGAGG - Intronic
938056458 2:128219027-128219049 TAGTTGCTGAGAGACAGGGGCGG - Intergenic
938696803 2:133842097-133842119 TGGCCTCTGAGGCTCAGGGGTGG + Intergenic
941838210 2:170049528-170049550 TATCTCCTGAGGATAAGGGGGGG + Intronic
943904368 2:193478746-193478768 TACATTATGAGGATCAGGGGAGG + Intergenic
945007667 2:205425702-205425724 AAGCTTCTGAGAGTCAGGCGTGG - Intronic
946078812 2:217098605-217098627 CACCTTCTGATGGTCAGTGGGGG + Intergenic
947595551 2:231409565-231409587 TGGCTTCTGAGGATGAGGAGGGG - Intergenic
948109757 2:235445180-235445202 AAGCTGCTGGGGGGCAGGGGTGG - Intergenic
948856932 2:240734621-240734643 TAACTTCTCAGGGGCATGGGGGG + Intronic
1170849278 20:19989564-19989586 TATTTTCTGAGGGCCAGGCGTGG - Intronic
1173016997 20:39234762-39234784 AGGGTTCTGAGGGTCATGGGAGG + Intergenic
1173192896 20:40889561-40889583 TAGCTTCTGCATGTCACGGGAGG - Intergenic
1173298304 20:41778830-41778852 GAGCTTGATAGGGTCAGGGGAGG - Intergenic
1173824690 20:46040692-46040714 GAGATTCTGAGGGGCAGGGAGGG - Intronic
1174113474 20:48211911-48211933 TAGCCTGTGATGGTCAGGGAGGG - Intergenic
1174150392 20:48482261-48482283 TAGCTTCTGTGAGGCAGGGCTGG - Intergenic
1174267107 20:49339964-49339986 TCAGTTCTGAGGGTCTGGGGAGG - Intergenic
1176152490 20:63599178-63599200 TAGCTCCGGGGGGTCAGGAGCGG - Intronic
1176152499 20:63599207-63599229 TAGCTCCGGGGGGTCAGGAGCGG - Intronic
1176218176 20:63957941-63957963 CAGCGTCAGAGGGTCGGGGGAGG - Exonic
1178631109 21:34262198-34262220 TGTTTTCTGGGGGTCAGGGGTGG - Intergenic
1178670301 21:34584211-34584233 TATCTTTTGAGGGCCAGGGAGGG - Intronic
1178833356 21:36074877-36074899 TTACCTCTGAGGGTGAGGGGAGG + Intronic
1181100169 22:20533608-20533630 GAGCTTCGGAGGGTCAGAGTGGG - Intronic
1183231910 22:36587794-36587816 AAGCTTCTGAGGATTAGCGGAGG + Intronic
1183552477 22:38498732-38498754 TAGCTTCTAAGGGCCAGGCTAGG + Intronic
1183687304 22:39368524-39368546 TAGCTTCGGAGGGACTGGGCGGG - Intronic
1184398758 22:44261505-44261527 CAGCTTCTGAGGGGCAGAGCCGG - Intronic
1184465689 22:44668163-44668185 TTGCTTCTGTAGGTCCGGGGTGG + Intergenic
949568383 3:5266782-5266804 AAGCTTCTTAGGGACATGGGTGG + Intergenic
949616036 3:5754712-5754734 TTGTTTCTGAAGGACAGGGGAGG + Intergenic
949971808 3:9413623-9413645 TAGCTTCTTCGGGTGGGGGGAGG + Intronic
950794060 3:15496281-15496303 TAGCTTCAGGGAGTCAGGGGAGG - Intronic
950915401 3:16639875-16639897 TAGCTTTTGAGGGTAAAAGGGGG - Intronic
951858445 3:27224271-27224293 TGGCTTCTTAGGGTGAGGGCTGG + Intronic
953373516 3:42409530-42409552 TGGCTTCTGGGGGAGAGGGGAGG - Intronic
954144214 3:48626373-48626395 GAGGTTCTGAGAGTCAGGGGAGG - Intronic
955720679 3:61877349-61877371 TAACTTCTGAGGGCCAGGCCAGG - Intronic
957261959 3:77913375-77913397 TTGCTTCTGAGGGTAAGGATGGG + Intergenic
958798796 3:98733099-98733121 CAGCCTCTGAGGCTCAGGGTTGG + Intronic
959412118 3:106037172-106037194 TATCTGCTTGGGGTCAGGGGTGG + Intergenic
961941492 3:130642088-130642110 TTGCTTCAGGAGGTCAGGGGGGG + Intronic
962298608 3:134216500-134216522 TAGCTACTGACGGCCAGGCGCGG + Intronic
963239326 3:142987566-142987588 TAGCTTCTGAGGGTCAGGGGTGG - Intronic
964167382 3:153725159-153725181 AAGTTTCTCAGGGTCAGGCGCGG - Intergenic
965965895 3:174488827-174488849 TAGCTTCCAAAGGTTAGGGGGGG - Intronic
967197297 3:187039511-187039533 CTGCTTCTGAAGGTCAGTGGAGG - Intronic
969498116 4:7537648-7537670 GAGCCTCTGAGGGTCTGGTGGGG + Intronic
969912029 4:10456546-10456568 TTCCTTGAGAGGGTCAGGGGTGG - Intronic
970410972 4:15807534-15807556 CAGCTCCTGAGTGTCAGGGGGGG + Intronic
970724037 4:19022096-19022118 TAGCTCCTGATGGTCAGAGCTGG - Intergenic
976835248 4:89364917-89364939 AAGCCTATGAGGGTCAGGGCAGG + Intergenic
977684878 4:99836372-99836394 AAGCTTCTGGTAGTCAGGGGAGG + Intronic
978428798 4:108610511-108610533 TAGATTCTGTGGGTCTGGGATGG - Intergenic
978757805 4:112323134-112323156 TAGGCTCTGAGGAGCAGGGGTGG - Intronic
979978876 4:127230222-127230244 CAGCTTCTGAGAGCCATGGGTGG + Intergenic
980828822 4:138105149-138105171 TAGCATCTGAAGGCCAGGTGTGG + Intergenic
981694003 4:147541242-147541264 GAGCTTCTGAAGGACATGGGTGG - Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
984807455 4:183764615-183764637 TAGGTTCTGAAGGTCAGTGCAGG - Intergenic
984843109 4:184086626-184086648 CAGGTTCAGAGGGTCTGGGGTGG - Intergenic
984850945 4:184152110-184152132 GAGCTTCTGAAGGCCAGGGCAGG - Intronic
988270233 5:29004523-29004545 TAGATTCTGGGGGGCAGGGGTGG - Intergenic
991686765 5:69189074-69189096 TGGCTTCTGAAGATCAGGGACGG - Intergenic
997761649 5:136454331-136454353 AGGCTTCTGGGGGTCAGAGGGGG + Intergenic
998027800 5:138835014-138835036 TACCTTCTTAAGGGCAGGGGAGG + Intronic
998204512 5:140149291-140149313 ATTCTTCTGAGGGACAGGGGTGG - Intergenic
999312292 5:150559210-150559232 CAGCTTCTGAGGGACAGAGGAGG + Intergenic
1001365114 5:171129506-171129528 CAACTTCTGTGGGTCAGGGGAGG + Intronic
1001565960 5:172699678-172699700 TAACCTGAGAGGGTCAGGGGAGG + Intergenic
1001759848 5:174198431-174198453 CACCTACTGAGTGTCAGGGGTGG + Intronic
1002540239 5:179902100-179902122 GAGCTTCCGAGGGTGAGGGCAGG - Intronic
1006060357 6:31414386-31414408 TGGGTTGTGAGGGTCAGGAGAGG + Intronic
1006918152 6:37609408-37609430 TAGCTTCTGAGGGACAAGAAAGG - Intergenic
1007111458 6:39315428-39315450 TGGCCTGTGAGGGTCAGGGGAGG + Exonic
1007757918 6:44112655-44112677 TGGCTTCTGAGAGTCAGAGTAGG - Intergenic
1007828220 6:44617682-44617704 TTGCTTCTGTGGGTCAAGGAGGG + Intergenic
1011936293 6:92782515-92782537 TAGTTTTTGAGGGTCAGGAGTGG + Intergenic
1012624912 6:101393517-101393539 TAGCTCCTGTGGTCCAGGGGTGG + Intergenic
1016751365 6:147633992-147634014 TAGTTTCTGAGGGTTGGGGTTGG - Intronic
1017086010 6:150713596-150713618 TAATTGCTGAGGGTCAGGTGTGG + Intronic
1017315025 6:153020889-153020911 TAGATTCTGAGGTTCAGTGTGGG + Intronic
1018399740 6:163411081-163411103 TAGCTGCAGAGGGTCGGGTGCGG - Intergenic
1019386589 7:760151-760173 TGTCTTCTGTGGGTCAGGGCGGG + Intronic
1024363475 7:48494015-48494037 TGGCTACTGGGTGTCAGGGGAGG + Intronic
1026221313 7:68399950-68399972 CAGCTTCTGAGAGTAATGGGAGG + Intergenic
1026839865 7:73664387-73664409 TATCTGCTGAGGGACAGGAGTGG + Intergenic
1029475526 7:100781436-100781458 GAGCTTCTCAGGGCCAGTGGAGG + Intronic
1030577386 7:111305896-111305918 TAGCTTCTGAGGAAAAGTGGTGG + Intronic
1033256308 7:139804603-139804625 TAGCTCCTGTGTGTCATGGGAGG + Intronic
1034290952 7:149931215-149931237 TGGCTTCTGTAGGTCAGGGAGGG + Intergenic
1034302435 7:150028626-150028648 CAGCTGCTGAGTGTCAGGTGGGG - Intergenic
1034803625 7:154068691-154068713 CAGCTGCTGAGTGTCAGGTGGGG + Intronic
1034815234 7:154166558-154166580 TGGCTTCTGTAGGTCAGGGAGGG - Intronic
1034889973 7:154831067-154831089 TGGCTTCTGAGGGTGAAGGAGGG - Intronic
1035972412 8:4264506-4264528 GAGCTTCTCAGCTTCAGGGGGGG - Intronic
1037742274 8:21617116-21617138 TAGATGGTGAGGGTCAGGGTAGG - Intergenic
1038434047 8:27522303-27522325 GAGCTGCTGTGGGTCGGGGGAGG + Intronic
1039110977 8:34040680-34040702 TTGCTTCTGAGGGTGAAGGTTGG + Intergenic
1045189206 8:99866472-99866494 TAGATTCTGAGAGTCAGAGAGGG - Intronic
1045436902 8:102172961-102172983 GAGATTTGGAGGGTCAGGGGAGG - Intergenic
1046968554 8:120194397-120194419 TAGATTTTGGGGGTAAGGGGGGG - Intronic
1047298967 8:123596613-123596635 AAGCTTCTGAGGGTGAGGCCAGG + Intergenic
1047497861 8:125421316-125421338 AAGCTTCTGAAGGTCAGAGCTGG - Intergenic
1047953256 8:129953245-129953267 CAGCTTGGGAAGGTCAGGGGAGG + Intronic
1050504494 9:6333288-6333310 TAGCTTGTGAGAGCCAGGGTTGG + Intergenic
1050999557 9:12264344-12264366 TAGTATCTGAAGGTCAGGGTAGG + Intergenic
1052937236 9:34102962-34102984 CAGCTACTCAGGGACAGGGGTGG + Intronic
1055221897 9:73945264-73945286 CAGCTTCTCAGGGTGAGGGCTGG + Intergenic
1055479059 9:76692071-76692093 TACCTTCTGAGGATGAGAGGAGG + Intronic
1056122470 9:83503110-83503132 TAGGTTCTGGGGGTTAGGGCAGG - Intronic
1058935035 9:109762520-109762542 TCCCTTCTGTGGGTCTGGGGTGG - Intronic
1059390776 9:113998457-113998479 TAGCATCTCAGGGTCAAGAGGGG + Intronic
1059392185 9:114006200-114006222 TGGGTTCTGAGGGACAGGAGGGG + Intronic
1062132637 9:134908112-134908134 TAACTTCTGAGGCTCAGATGAGG + Intronic
1062280942 9:135751370-135751392 GAGCTTCTGCAGGTCAGGGAAGG + Intronic
1062563406 9:137151641-137151663 TAACTTCTGAGAGTCTGGCGGGG - Intronic
1062634779 9:137484998-137485020 TAGCCTCTGAGGGTTGGGGGAGG - Intronic
1185501115 X:598150-598172 TACCTTCTTAAGGGCAGGGGAGG + Intergenic
1185501209 X:598586-598608 TACCTTCTTAAGGGCAGGGGAGG + Intergenic
1185501228 X:598687-598709 TACCTTCTTAAGGGCAGGGGAGG + Intergenic
1185501259 X:598822-598844 TACCTTCTTAAGGGCAGGGGAGG + Intergenic
1185501333 X:599159-599181 TACCTTCTTAAGGGCAGGGGAGG + Intergenic
1185501398 X:599462-599484 TACCTTCTTAAGGGCAGGGGAGG + Intergenic
1187019429 X:15364849-15364871 CAGCTTTTGAGGCTCAGTGGAGG - Intronic
1187688862 X:21843587-21843609 GAGAATGTGAGGGTCAGGGGTGG + Intronic
1190119364 X:47647898-47647920 CAGCTTCAGATGGTCAGGGAGGG + Intronic
1191785961 X:64917421-64917443 TAGGGTCTGAGGGGCAGGGGAGG - Exonic
1192004829 X:67199329-67199351 CAGCTTCTGAGAGCCAGAGGAGG + Intergenic
1192807729 X:74524834-74524856 TAGCTTCTTGGGGCCAGGTGGGG - Intronic
1197335370 X:125204743-125204765 TTTCTCCTGAGGGTGAGGGGTGG + Intergenic
1197741213 X:129895795-129895817 AAACTTCTGAGGGCCAGGTGTGG - Intergenic
1198606850 X:138349554-138349576 TAGCTTCTGATAGTCAGCAGAGG + Intergenic
1199697559 X:150353559-150353581 TAACTGCTGAGCGTCAGGGCTGG - Intergenic
1200142640 X:153909644-153909666 TAGATTCTGAAGGTCTGGGCTGG - Intronic
1200217266 X:154373583-154373605 TGGGGTCTGAGGGCCAGGGGTGG - Intronic
1200683938 Y:6244154-6244176 TTGCAGCTGAGGGGCAGGGGCGG + Intergenic
1201048697 Y:9910232-9910254 TTGCAGCTGAGGGGCAGGGGCGG - Intergenic
1201791142 Y:17841646-17841668 TAGCTTTTGAGGGTTAGAGATGG + Intergenic
1201810412 Y:18064343-18064365 TAGCTTTTGAGGGTTAGAGATGG - Intergenic
1202352754 Y:24011294-24011316 TAGCTTTTGAGGGTTAGAGATGG + Intergenic
1202518025 Y:25658821-25658843 TAGCTTTTGAGGGTTAGAGATGG - Intergenic