ID: 963242344

View in Genome Browser
Species Human (GRCh38)
Location 3:143019546-143019568
Sequence AAGTGCCAACATAATTTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 2, 2: 13, 3: 69, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963242344_963242347 25 Left 963242344 3:143019546-143019568 CCTATTAAATTATGTTGGCACTT 0: 1
1: 2
2: 13
3: 69
4: 442
Right 963242347 3:143019594-143019616 TTAAGAAGCAGTTTTAAAAGAGG 0: 1
1: 0
2: 1
3: 50
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963242344 Original CRISPR AAGTGCCAACATAATTTAAT AGG (reversed) Intronic
900812183 1:4814547-4814569 AGGTGTCAAGGTAATTTAATGGG + Intergenic
900895668 1:5481363-5481385 AAGTGCCAACATAGTTTAAGTGG + Intergenic
901901246 1:12365026-12365048 CAGTACCAAGATCATTTAATGGG - Intronic
903150894 1:21407829-21407851 GAGTGCCAAAATCATTCAATGGG - Intergenic
903611231 1:24614877-24614899 GAGTACCAAGATAATTCAATGGG - Intergenic
905115632 1:35637612-35637634 AAATGCCAAAATCCTTTAATAGG + Intronic
905546701 1:38805454-38805476 AGTTGCCAAAATAATTCAATGGG + Intergenic
905842604 1:41196421-41196443 AAGTCCCAAGACCATTTAATGGG + Intronic
906138543 1:43518758-43518780 AAGTGCCAAGGAAATTCAATGGG - Intergenic
907535086 1:55144957-55144979 AAGTGGTATCAAAATTTAATGGG - Intronic
907966535 1:59336244-59336266 ATGTGCCTATATAATTTAATGGG - Intronic
908287353 1:62621913-62621935 AAGAGAAAATATAATTTAATGGG - Intronic
908430985 1:64057269-64057291 GAGTGCCAAGACAATTCAATGGG - Intronic
908855668 1:68424359-68424381 AAGTGCTAAGAAAATTCAATGGG - Intergenic
909122804 1:71625959-71625981 CAGTGGCAACATATTCTAATAGG + Intronic
909125517 1:71663558-71663580 AAATGCAAAAATAATTCAATGGG - Intronic
909226305 1:73027821-73027843 GTGTGCCAAGATAATTAAATGGG + Intergenic
909550260 1:76891844-76891866 AAATGCCAAGACAATTGAATAGG - Intronic
910344659 1:86222446-86222468 AAGTAGCTGCATAATTTAATGGG + Intergenic
910521801 1:88131018-88131040 AACTGCATAGATAATTTAATAGG + Intergenic
910782784 1:90958693-90958715 AAGTGCCAAGACCATTCAATGGG + Intronic
910932233 1:92454029-92454051 AACTACCAAGATAATTCAATGGG - Intergenic
911485812 1:98503720-98503742 AAGTGATAAAATAATTTCATTGG + Intergenic
911683966 1:100752182-100752204 TATTGCCGACATAATATAATTGG + Intergenic
911825240 1:102475666-102475688 AAGTGCTAAAACAATTTAATGGG + Intergenic
912064120 1:105713998-105714020 GAGTGCCAAGACAATTCAATGGG - Intergenic
913105658 1:115611996-115612018 ATGTGCCAACATAATTTATGAGG - Intergenic
913301948 1:117380633-117380655 GAGTGCCAATATTATTCAATAGG - Intronic
913572677 1:120136696-120136718 AAGAGCCAAGACAATTCAATGGG + Intergenic
914293521 1:146297610-146297632 AAGAGCCAAGACAATTCAATGGG + Intergenic
914554565 1:148748393-148748415 AAGAGCCAAGACAATTCAATGGG + Intergenic
916263490 1:162866817-162866839 AAACACCAATATAATTTAATGGG + Intronic
916772624 1:167927066-167927088 ATGTGCCAACAGAACTGAATTGG + Intronic
917001787 1:170368478-170368500 AAGTGCCAAGGTATTTCAATGGG + Intergenic
918090023 1:181282406-181282428 AAGTGCCAAGGGAATCTAATAGG - Intergenic
918172761 1:182013180-182013202 AAGTGCCCACATAATATTCTAGG + Intergenic
918587093 1:186200734-186200756 AAGTGCCAAGGCAATTCAATGGG - Intergenic
918687692 1:187439424-187439446 AATTGCCAACATAATTAAATGGG - Intergenic
918810589 1:189114157-189114179 ACGTGCCAATAAAATTCAATAGG - Intergenic
918984309 1:191603361-191603383 AAGTGCCAATATAATTTTAGGGG - Intergenic
919039437 1:192364224-192364246 AAGTGCCAAAATAATCTTAAAGG - Intronic
919275296 1:195407224-195407246 AAGTGCAATAATAATTTAAAGGG + Intergenic
919394706 1:197030750-197030772 TAGTGCAAACTTTATTTAATGGG + Intergenic
919570992 1:199247230-199247252 AAATGAAAACATAATTTAAGAGG + Intergenic
921038922 1:211410589-211410611 AAGCGTCAAGATAATTCAATGGG + Intergenic
921970667 1:221145932-221145954 AAGTGCCAAGGCAATTCAATGGG - Intergenic
922253596 1:223872261-223872283 AAGGGCCAAGATAATTAAACAGG - Intergenic
922375943 1:224965947-224965969 AATTGAAAAAATAATTTAATTGG + Intronic
922394900 1:225187994-225188016 AAATGCCAAGATCATTTAGTGGG - Intronic
923053762 1:230408590-230408612 AGGTGTCAAAATAATTCAATGGG + Intronic
923218532 1:231872202-231872224 AAGTACTTACATAATTCAATAGG - Intronic
924220434 1:241869286-241869308 ATGTGCCAAGACAATTAAATGGG + Intronic
924489362 1:244520401-244520423 AAGTTCCAAAACAATTCAATGGG - Intronic
1062806121 10:420701-420723 AATTGCCGGCATAATTAAATTGG + Intronic
1063989941 10:11550004-11550026 AGTTGCCAACATAATTGAAGTGG + Intronic
1064736889 10:18391164-18391186 AAATGCCAACTTAATTAACTTGG - Intronic
1064894534 10:20219713-20219735 ATGAGCCAACATAGTTTAAAAGG - Intronic
1065011076 10:21421370-21421392 AAGGGCCAACATTATTGAAAAGG + Intergenic
1066095345 10:32066930-32066952 GAGTGACAACATAATTAAACTGG - Intergenic
1066493148 10:35914371-35914393 AAGTGTCTACATAATTTATTTGG + Intergenic
1066569511 10:36755545-36755567 AAGTGTCTACATAAATTATTTGG - Intergenic
1066578164 10:36849280-36849302 ATGTGCTAAAATAATTAAATTGG - Intergenic
1066666440 10:37787553-37787575 AAGTGCCAAGATACTTCAAGAGG + Intronic
1067159328 10:43809828-43809850 AGGTGCCAAGATATTTTATTGGG + Intergenic
1067513644 10:46916975-46916997 AGGTGCCAAGATAATATAATGGG - Intronic
1067648608 10:48134859-48134881 AGGTGCCAAGATAATATAATGGG + Intergenic
1067770863 10:49123686-49123708 GAGTGCCAAGATAATTTAATGGG - Intergenic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1068200053 10:53772302-53772324 AAGTACCAAAATAACTCAATTGG - Intergenic
1068473281 10:57492536-57492558 AAGTGCCAAGAAAATACAATGGG + Intergenic
1068657641 10:59591580-59591602 AGGTGCCAACAGTATTGAATTGG - Intergenic
1069200456 10:65608639-65608661 AAGTGAGAACATAAGATAATTGG - Intergenic
1069205425 10:65676828-65676850 AAGTGCAAAGACAATTCAATAGG - Intergenic
1069206425 10:65693526-65693548 AATAGCCAATATATTTTAATTGG + Intergenic
1069523633 10:69147672-69147694 AGGTGCCAAAACAATTCAATGGG - Intronic
1071995595 10:91145735-91145757 GAGTGCCAAGACAATTCAATGGG + Intergenic
1072281944 10:93873643-93873665 AGTGGCCAACCTAATTTAATGGG - Intergenic
1072825557 10:98602683-98602705 AAGTGCCAAGATGATTAAATGGG + Intronic
1072837553 10:98732509-98732531 AGGTGCCAAGATAAGTAAATGGG + Intronic
1073171629 10:101514755-101514777 AGATGCCAAGATAATTCAATGGG - Intronic
1073874496 10:107906503-107906525 AAGTGCCAAGAGAATTAAAGAGG + Intergenic
1074579396 10:114704171-114704193 ACCTGCCAACATAATTTATTTGG + Intergenic
1074957099 10:118402472-118402494 AGATGCCAAGGTAATTTAATGGG - Intergenic
1075272684 10:121066595-121066617 AAGTGCCAAGACCATTCAATGGG - Intergenic
1076628542 10:131838331-131838353 AAGTGCAAAGACAATTCAATGGG + Intergenic
1076772795 10:132676019-132676041 AACTCCTTACATAATTTAATTGG + Intronic
1077437912 11:2552347-2552369 AGGTGCCAAAGTAATTCAATGGG - Intronic
1077908505 11:6554206-6554228 ATGTGCCAAGATAATTCAATGGG + Intronic
1078626067 11:12959493-12959515 TGGTGCCAAAGTAATTTAATGGG - Intergenic
1078664623 11:13314295-13314317 AAGTGCCAGCATAGTTTACCTGG + Intronic
1079559010 11:21798643-21798665 AAATGCCAACATGCTTTCATTGG + Intergenic
1079600816 11:22311671-22311693 AAGTGTCAAAAAAATTCAATAGG + Intergenic
1079706143 11:23621673-23621695 AATTGCCAAGAGAATTTAAAAGG - Intergenic
1080506709 11:32921975-32921997 AGGTGCCAAGACAATTCAATAGG + Intronic
1080994177 11:37580195-37580217 AAGTGACAACACAATAGAATGGG + Intergenic
1081067931 11:38570767-38570789 AATAGCCAACATAATATAAGAGG + Intergenic
1081412720 11:42778650-42778672 AAATGCTCACATAATTTAAATGG - Intergenic
1081443393 11:43104831-43104853 ATGTACCCAGATAATTTAATAGG - Intergenic
1081692986 11:45090646-45090668 AATTACCAAGATAATATAATGGG + Intergenic
1082236919 11:49829122-49829144 TATTGACAACATAAATTAATAGG - Intergenic
1082644834 11:55709790-55709812 CAGTGCCAAGATTATTCAATAGG - Intergenic
1084094231 11:66900006-66900028 GAGCGCCAAGACAATTTAATGGG - Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1084628526 11:70329022-70329044 AAGTACCAGTTTAATTTAATTGG - Intronic
1085149856 11:74242242-74242264 AGGTGCCAAGACAATTAAATGGG - Intronic
1086313566 11:85564524-85564546 AAGTGGCAAAATACTTTAATGGG - Intronic
1087506485 11:99030676-99030698 AAGTGAAAAAATAATATAATTGG - Intronic
1087509970 11:99079565-99079587 AAGTGACCTCACAATTTAATTGG + Intronic
1087906012 11:103698511-103698533 TAGTGCCAAGACAATTCAATGGG - Intergenic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1088867818 11:113865572-113865594 GAGTGCCAACACCATTTGATGGG + Intronic
1089871485 11:121676736-121676758 AACTGCCAAGGTAATTCAATGGG - Intergenic
1090282923 11:125473271-125473293 AGATGCCAAAACAATTTAATGGG + Intronic
1090729937 11:129562242-129562264 AAGAACCAACATCATTTAAATGG + Intergenic
1091882035 12:3987429-3987451 AAATGTCAAGGTAATTTAATGGG + Intergenic
1092037856 12:5355496-5355518 AAGTGCCAAGACAATTCAATGGG + Intergenic
1092340560 12:7672415-7672437 AGGTGCCAAGATAATCCAATGGG - Intergenic
1093322472 12:17730228-17730250 GAGTGCCAAGATTATTCAATGGG + Intergenic
1093760199 12:22901309-22901331 AAAGGCCAATACAATTTAATGGG + Intergenic
1093868157 12:24253611-24253633 AAGTCTCAATATAATTGAATGGG + Intergenic
1095620812 12:44251227-44251249 AAGTATCATCATAATTTAATGGG + Intronic
1096762892 12:53857943-53857965 AAGTGCCAAGACAATTCAGTGGG + Intergenic
1097135661 12:56852589-56852611 GAGTGCCAAGACAATTCAATAGG - Intergenic
1097582783 12:61479678-61479700 AATTCCGAACATAATTTAGTGGG + Intergenic
1098566005 12:71936713-71936735 ACGTGCCAAGACAATTCAATGGG - Intergenic
1099378884 12:81931232-81931254 AAGTATCAACATATTTTGATAGG - Intergenic
1100075347 12:90774343-90774365 ATGTGCCAAGATAATTTAACAGG - Intergenic
1100491379 12:95082136-95082158 AACTTCCAAAATAAATTAATTGG - Intronic
1100741048 12:97593882-97593904 AGGAGACAACATAAATTAATGGG + Intergenic
1100897820 12:99204411-99204433 AAGAGATAACATAAATTAATGGG + Intronic
1102326160 12:111986479-111986501 GGGTGCCAAGATCATTTAATGGG + Intronic
1105540960 13:21316692-21316714 AAGTGCCAAGAATATATAATGGG - Intergenic
1105887849 13:24657707-24657729 AAGTGCCTACATAAATTATCTGG - Intergenic
1106566530 13:30889398-30889420 AAGTGCAGACATAACTTGATTGG - Intergenic
1107067912 13:36236374-36236396 GAGTGCCAAGAGCATTTAATTGG + Intronic
1107918029 13:45172716-45172738 AGGTGCCAAGAGAATTCAATGGG - Intronic
1108311018 13:49190689-49190711 AACTTCCAACACAATTTAATGGG - Intronic
1108941933 13:55966094-55966116 AAATGCCAACATTACATAATGGG + Intergenic
1109060147 13:57606783-57606805 AAGTCTCAACATAATCAAATTGG - Intergenic
1109093786 13:58084700-58084722 AAGTGGCAACTCAATTTAATAGG + Intergenic
1109680978 13:65752267-65752289 AAGTCCCAACAAAATATAACAGG - Intergenic
1109734279 13:66461109-66461131 AAATGCTAAAATAAATTAATCGG + Intronic
1109887413 13:68559818-68559840 AAGGACCAAGGTAATTTAATGGG - Intergenic
1110400589 13:75086542-75086564 GAGTGCCAAGACACTTTAATGGG + Intergenic
1110453606 13:75665176-75665198 AATTACTAACAAAATTTAATAGG - Intronic
1111725762 13:92006251-92006273 ATGTACCAAAATAATTTAAGTGG + Intronic
1112759934 13:102683637-102683659 AGGTGCCAAAGTAATTCAATGGG - Intergenic
1113237655 13:108298585-108298607 AAATGCCAACATAATATTAAAGG - Intronic
1113631401 13:111887688-111887710 AGGTGCCAAGACAATTCAATGGG - Intergenic
1115430079 14:33307163-33307185 AAGTGACATTATAATTAAATTGG - Intronic
1115710683 14:36047569-36047591 GATTAACAACATAATTTAATGGG + Intergenic
1116061910 14:39934280-39934302 AAGTGCCAGCTTAATAAAATAGG - Intergenic
1116754806 14:48933964-48933986 AGGTGCCAAAGTAATTCAATGGG + Intergenic
1117010503 14:51466518-51466540 AAGTGCCAAAATGATTCAATGGG - Intergenic
1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG + Intronic
1117640801 14:57797449-57797471 CAGTGACAATATATTTTAATGGG - Intronic
1117762500 14:59045334-59045356 AAGTGCTAAGACTATTTAATGGG - Intergenic
1118218948 14:63837171-63837193 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1118359965 14:65047611-65047633 AAGTGCCCTTATAATTTAAATGG - Intronic
1118392918 14:65310972-65310994 AAGTGCTAACAGAAATAAATAGG + Intergenic
1119523832 14:75306506-75306528 AAGTGCCAAGACCATTCAATGGG - Intergenic
1120635761 14:86949002-86949024 AAGTGCCAAGAAAGTTCAATGGG - Intergenic
1121367568 14:93328484-93328506 AGGTGCCAAGACCATTTAATGGG + Intronic
1121581171 14:95032423-95032445 TGGTGCCAAGATAATTCAATGGG - Intergenic
1121726337 14:96154164-96154186 AAGTGCCGATATAATCCAATGGG + Intergenic
1121912545 14:97804540-97804562 ATGTGCCAAAATAATTCAACTGG + Intergenic
1123792933 15:23740831-23740853 AAGTTCCAAAACAATTCAATGGG - Intergenic
1124823504 15:33070581-33070603 AGATGCCAACACAATTTCATGGG + Intronic
1125890642 15:43263536-43263558 AGGTGCCAAGACAATTCAATGGG + Intronic
1126770860 15:52054463-52054485 AAGTGTCAAGATAATTCAGTGGG - Intronic
1128946217 15:71823526-71823548 GAGTGGCAAAATAATTTAAATGG + Exonic
1130121952 15:81057891-81057913 AAGTGCCAAAACAATTCAATGGG - Intronic
1130450902 15:84050759-84050781 AAATCCCTTCATAATTTAATGGG - Intergenic
1130790448 15:87149974-87149996 AATGGACAAAATAATTTAATGGG + Intergenic
1132425724 15:101715068-101715090 AAGTACAAACATAAACTAATAGG + Intronic
1134873532 16:17675159-17675181 AGGTGCCAAAATAATTTAATGGG - Intergenic
1135235762 16:20754323-20754345 GTGTGCTAACATAATTAAATAGG + Intronic
1135542368 16:23341191-23341213 AGGTGCCAAGACAATTAAATGGG + Intronic
1136281666 16:29216686-29216708 AAGTGCCCACATAACTTGTTGGG + Intergenic
1138005803 16:53336352-53336374 GAGTGCCAAGACAATTCAATGGG + Intergenic
1138486340 16:57346845-57346867 GAGTGCCAAGATAATTCAATGGG + Intergenic
1140171195 16:72606793-72606815 AAGTGCCAAGATAATTCAATGGG + Intergenic
1140866461 16:79066654-79066676 AGGTGCCCACTTAATTCAATCGG + Intronic
1141061025 16:80870483-80870505 AAGTTCCAATTTAATTCAATGGG + Intergenic
1142086037 16:88182615-88182637 AAGTGCCCACATAACTTGATGGG + Intergenic
1143690161 17:8555507-8555529 ATGTGTCAAGGTAATTTAATAGG + Intronic
1144636765 17:16915021-16915043 AAGTGCCAAGATCATTCAATGGG + Intergenic
1146027910 17:29338709-29338731 ATGTGCCAAGATGATTCAATGGG + Intergenic
1146600243 17:34208260-34208282 GGGTGCCAAGATAATTCAATGGG - Intergenic
1147058200 17:37850814-37850836 ATGTGCCAAGACCATTTAATGGG - Intergenic
1148402344 17:47376769-47376791 AAGTGACAACTAAATGTAATGGG - Intronic
1150073984 17:62176791-62176813 AAGTGCCAAAATAATTCAATAGG + Intergenic
1153844398 18:9035904-9035926 AGGTGCCAAGGTAATTTAACGGG + Intergenic
1153870551 18:9315667-9315689 AAGTGCCAATGAAATTCAATGGG + Intergenic
1153936597 18:9931768-9931790 AAGAGAAAACAAAATTTAATTGG - Intronic
1154233206 18:12577021-12577043 AAGTGCCAAGGTAGTTCAATGGG + Intronic
1154326698 18:13396160-13396182 AAATGCCAACATAAATTGAGAGG - Intronic
1155805138 18:30160489-30160511 AACAGCCAACATAATACAATTGG - Intergenic
1155805234 18:30162669-30162691 AACAGCCAACATAATACAATTGG - Intergenic
1156210813 18:34940230-34940252 AGGTGCCAACATAATCCAATGGG + Intergenic
1156735214 18:40248895-40248917 AGATGCCAAAGTAATTTAATTGG - Intergenic
1157099254 18:44714692-44714714 AAGTACCTACAGAGTTTAATGGG + Intronic
1157686778 18:49649172-49649194 AAGTGCCAAGACAAGTCAATAGG + Intergenic
1157709162 18:49837108-49837130 AAGTGTCTACATAAGTTAACAGG + Intronic
1158111617 18:53946350-53946372 CAGTTCCAACATAATCTTATGGG + Intergenic
1158138670 18:54233139-54233161 AAGTTCAAAGATAATTTACTGGG - Intergenic
1158295226 18:55989248-55989270 AAGTTCCAAAATTATTTAAATGG - Intergenic
1158799217 18:60886598-60886620 TAGTGCGTACATAATTTAAAAGG + Intergenic
1158827079 18:61234632-61234654 AAGTAGTAACATAATTTAATTGG - Intergenic
1159071937 18:63633915-63633937 AAGGGCCAAGAACATTTAATGGG + Intergenic
1159110368 18:64048888-64048910 AAGTGCCAAAATATATTAACAGG - Intergenic
1159701062 18:71628301-71628323 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1160252548 18:77215877-77215899 AAATGCCAAGATAATTCAATGGG - Intergenic
1161388581 19:4009577-4009599 AAGGGTCAACTTGATTTAATTGG - Intronic
1162240552 19:9350080-9350102 GAGTGCCAAGACAATTCAATGGG - Intronic
1163825634 19:19522892-19522914 AGGTGCCAAGATAATTCAATGGG - Intronic
1165107681 19:33483012-33483034 AAGTTTCAACATATTTTAAAGGG + Intronic
1165271967 19:34716798-34716820 AAGTGCCAAGAACATTTATTGGG + Intergenic
1165638051 19:37360189-37360211 AGGTGCCAAGGTAATTCAATGGG - Intronic
1166417161 19:42604160-42604182 GAGTGTCAAGATAATTTAATGGG - Intronic
1166969364 19:46553801-46553823 GAGTGCCAAGATCATTTAATGGG - Intronic
926449071 2:12980480-12980502 AAGTGCCAAGCTAATTTAATTGG + Intergenic
926903481 2:17783722-17783744 GAGTGCCAAGACAATTCAATGGG + Exonic
927342150 2:21994677-21994699 AAGTGCAAACAAAATATTATGGG - Intergenic
927347847 2:22068642-22068664 AGGTAGCAAGATAATTTAATGGG + Intergenic
927815378 2:26211419-26211441 GAGTGCCAACATGATGTCATGGG + Intronic
928050068 2:27983236-27983258 GGGTGCCAACACAATTCAATGGG - Intronic
928075379 2:28259835-28259857 AGGTGCTAAGGTAATTTAATGGG - Intronic
928460166 2:31464983-31465005 AAATGGCAATATCATTTAATGGG + Intergenic
929359443 2:41067715-41067737 AAGTACCAACATTATTCTATTGG + Intergenic
930812301 2:55555325-55555347 GAGTGCCAAGACAATTTGATGGG - Intronic
931305906 2:61028295-61028317 AAATGCAATCTTAATTTAATAGG + Intronic
932085942 2:68761114-68761136 GGGTGCCACGATAATTTAATGGG + Intronic
932557501 2:72838002-72838024 GAGTGACAAGATAATTCAATAGG - Intergenic
933107062 2:78343696-78343718 AAGTGCCAACATATGGTATTTGG + Intergenic
933355499 2:81205344-81205366 AAGTGACAACATAAAGTATTTGG + Intergenic
933413414 2:81953087-81953109 AGGTGCCAAGACAATTCAATGGG + Intergenic
933624224 2:84580462-84580484 AAATGCCAACATAATATGAATGG - Intronic
933855451 2:86409547-86409569 GAGTGCCAAGATCATTTAATGGG + Intergenic
934776669 2:96942873-96942895 GGGTGCCAACAGAATTCAATAGG + Intronic
935195442 2:100812021-100812043 AAGTACCAAGACAATTCAATGGG - Intergenic
935241694 2:101184056-101184078 ATGTCCCAAGACAATTTAATGGG - Intronic
935519613 2:104088186-104088208 AAGTGCCAAGATGATTTAATGGG - Intergenic
935613490 2:105051309-105051331 AAGTGATAAAATAATTCAATGGG - Intronic
935728855 2:106048026-106048048 AGGTGCCAAGATAATTTAGTGGG - Intergenic
936889964 2:117358062-117358084 CGGTGCTAACACAATTTAATGGG - Intergenic
937327351 2:120998722-120998744 AAGTGCCAAGGCAATTCAATAGG + Intergenic
937749949 2:125463581-125463603 ATGTGCCAAGATAAATAAATGGG + Intergenic
938770044 2:134493882-134493904 AGGTGCCAAGGTAATTCAATGGG - Intronic
938877083 2:135543235-135543257 CAGTGCCAAGACAATTCAATGGG - Intronic
939831113 2:147072028-147072050 AAGTGACAACATACATTATTTGG + Intergenic
940256115 2:151731232-151731254 AAGAGGCAACATTATTTAAATGG + Intronic
940570309 2:155423995-155424017 AAGTGCCAACAGCATTCACTGGG - Intergenic
941201067 2:162511563-162511585 AAGTGCCTACAAAATAAAATTGG + Intronic
941488150 2:166107685-166107707 GGGTGCTAACATAATTTAATTGG + Intronic
941861171 2:170282641-170282663 AAATGTCATCATATTTTAATAGG + Intronic
942259383 2:174142757-174142779 ATGTGGCAACATAATTCAACTGG + Intronic
943550619 2:189334950-189334972 AGGTGTCAAGATAATTTAATAGG + Intergenic
943848542 2:192685867-192685889 AAAGGGAAACATAATTTAATAGG + Intergenic
943941219 2:194000645-194000667 AAATGCAAGCGTAATTTAATGGG + Intergenic
944009138 2:194951895-194951917 GAGTGCCAAGATAATGAAATGGG + Intergenic
944457028 2:199905885-199905907 AAGTGCCAAGATAATTCAATGGG - Intergenic
945237805 2:207648485-207648507 AGGTGCCAAGAGAATTCAATGGG + Intergenic
945485576 2:210391756-210391778 AATTGGCAAAATAATTTGATTGG + Intergenic
946293659 2:218765613-218765635 AAGAGGCAACATGATATAATGGG - Intergenic
946350895 2:219151524-219151546 AACTGCTAAAATAATTTCATAGG + Intronic
947407197 2:229790919-229790941 AAGTACCTACAAAATTAAATTGG - Intronic
948246852 2:236493407-236493429 AAGTGCTGACATAACTTACTAGG - Intronic
948579658 2:238976745-238976767 AAGTGCCAAGATAATTCAATGGG + Intergenic
948610880 2:239166163-239166185 AAGTTCCACCTTAATGTAATGGG - Intronic
1169651871 20:7877882-7877904 AAGTGCCTACACAATGTATTTGG - Intergenic
1169733943 20:8816479-8816501 AAGTCCTAAAATAATTTAATGGG + Intronic
1170235228 20:14096105-14096127 GTGTGCCAATATAATTTACTAGG - Intronic
1170273655 20:14557099-14557121 GAGTGCCAAGACAATTCAATGGG + Intronic
1170992548 20:21316553-21316575 AGGTGTCAAGATCATTTAATGGG - Intronic
1172961518 20:38803912-38803934 GAGTGCCAAGACAATTTAATGGG - Intergenic
1173213673 20:41058827-41058849 AAACGCCAAGACAATTTAATGGG + Intronic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1177165371 21:17596547-17596569 AAGTGCCAAAGCAATTCAATGGG - Intronic
1177795511 21:25774692-25774714 AGGTGCCAAGGTAATTCAATAGG + Intergenic
1178101781 21:29277636-29277658 AAGTGCCAAAGTAAATCAATGGG + Intronic
1179077817 21:38140530-38140552 ATGAGCCATCATAATTCAATTGG - Intronic
1179434832 21:41353535-41353557 CAGTGCCAAGATTATTTAATGGG + Intronic
1181835079 22:25598926-25598948 AAATGCCAAGACAATTTAGTGGG + Intronic
1182584497 22:31336444-31336466 AATTGCCACTATCATTTAATGGG - Intronic
1184237885 22:43194925-43194947 GAGTGCCAAAACCATTTAATGGG - Intergenic
949325605 3:2860230-2860252 ATGTGCCAACACAAATTGATTGG + Intronic
950735002 3:14999769-14999791 AGGTGCCACGATAATTCAATAGG - Intronic
950801954 3:15559698-15559720 AAGTGTCACCAGTATTTAATGGG - Intergenic
951026627 3:17837946-17837968 AAATGCAAACAAAATTGAATAGG - Intronic
951274402 3:20668132-20668154 AATTTCCAACCTAATTTAAACGG - Intergenic
952318157 3:32250137-32250159 GAGTGCCAAGATAATTCAATGGG - Intronic
952497231 3:33926395-33926417 AAGTGCCTTCATATTTTAGTGGG + Intergenic
952969054 3:38639286-38639308 AAGTGCCAAATGAATTTAGTTGG + Intronic
953484363 3:43281154-43281176 AATTGCCAAGGCAATTTAATTGG + Intergenic
953842861 3:46403757-46403779 GAGTGCCAGCAAAATTTACTAGG + Intergenic
954187422 3:48928640-48928662 AAGTTCCAATAAAATTTATTTGG - Intronic
955227272 3:57071188-57071210 GAGTGTCAAAACAATTTAATGGG + Intronic
955304103 3:57812336-57812358 GGGTGCCAAGATCATTTAATGGG - Intronic
955441430 3:58959531-58959553 AAGTGCTAAAGCAATTTAATGGG - Intronic
955480072 3:59381042-59381064 GATTGCCAACAAAATTTAATTGG + Intergenic
955535402 3:59918159-59918181 TAGTTCTAACATAATTTAAAAGG - Intronic
955669577 3:61389334-61389356 ATGTGACAAAATAATTAAATGGG + Intergenic
956733221 3:72215785-72215807 ATGTGTCAACATAGTTTCATTGG - Intergenic
956852927 3:73247673-73247695 ACGTGTTAAAATAATTTAATTGG - Intergenic
957727147 3:84082248-84082270 AACTGCCAAGATAGTTAAATAGG - Intergenic
957782177 3:84833973-84833995 AGGTGGGAACATAATTTGATAGG - Intergenic
958252586 3:91287772-91287794 AGGTGCCAAAATAATTCAGTGGG + Intergenic
958551327 3:95617502-95617524 AATTGAGAACTTAATTTAATTGG + Intergenic
959351126 3:105265133-105265155 AATTTCTAACAGAATTTAATAGG + Intergenic
961113764 3:124310638-124310660 GAGTGCCAATATCATTTTATGGG + Intronic
961409671 3:126710209-126710231 AGGTTCCAAGATAATTCAATGGG - Intronic
961672629 3:128545932-128545954 AAGTGTCAATATATTTTAAAGGG + Intergenic
962433331 3:135341127-135341149 GAGTACCAAGATAATTCAATGGG + Intergenic
962871819 3:139502920-139502942 AAGTGCCACTATGATTCAATGGG + Intergenic
963242344 3:143019546-143019568 AAGTGCCAACATAATTTAATAGG - Intronic
963343259 3:144063213-144063235 AATTTTCAACATAATTTAAATGG - Intergenic
963880747 3:150525570-150525592 AAGTTTAAACATATTTTAATAGG + Intergenic
964035753 3:152194628-152194650 AAGGGCCAACAGGATCTAATTGG - Intergenic
964537662 3:157742119-157742141 AAATGCCAGGATAATTCAATGGG + Intergenic
964725617 3:159811549-159811571 AGGTGCCAAGGTAATTCAATGGG - Intronic
965162699 3:165154987-165155009 AAGTAGCCACATAATTTATTTGG - Intergenic
965435927 3:168651334-168651356 AAGTGCCAACAGACTATATTTGG - Intergenic
966364727 3:179173225-179173247 AGGTGCCAAGGTAATTCAATGGG + Intronic
967004087 3:185367192-185367214 GGGTGCCAAGACAATTTAATGGG - Intronic
968197668 3:196722121-196722143 AGGTACCAACGTAATTTAATGGG - Intronic
968543805 4:1185033-1185055 AAGTGCCAAGACCATTCAATGGG + Intronic
969434193 4:7175425-7175447 AAGTGCCAAAACAATTCAATGGG - Intergenic
969540599 4:7786486-7786508 ATGTGCCATCCTAATTTTATAGG - Intronic
970231819 4:13918686-13918708 AAGTGCCAACTTACTCTATTAGG - Intergenic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG + Intergenic
972551434 4:40138668-40138690 GAGTGCCAAGAAAATTCAATGGG - Intronic
972955514 4:44385427-44385449 AAGTGCCAACACTATTCAATGGG + Intronic
973089410 4:46113598-46113620 ATGGGCAAATATAATTTAATGGG - Intronic
974008214 4:56581897-56581919 GAGTGTCAAGATAGTTTAATGGG + Intronic
974029861 4:56766895-56766917 AACTGCCAAGACAATTCAATGGG + Intergenic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
974394042 4:61312142-61312164 AAGTGCAAAGGCAATTTAATAGG + Intronic
974770704 4:66408384-66408406 AACTGCCATCTTATTTTAATAGG + Intergenic
975125036 4:70772523-70772545 AAGTGAAAACATTATTTATTGGG - Intronic
975688419 4:76941430-76941452 AAGTGCCAAGATAATTCTATGGG - Intergenic
975994083 4:80294256-80294278 ATGTGGCAACATAAATAAATGGG - Intronic
976017244 4:80572184-80572206 AAGAGCCAAAATAGTTTAATCGG - Intronic
976049327 4:80993154-80993176 AAGAGCCAACAGAAAGTAATGGG - Intergenic
976415754 4:84772633-84772655 TATTGCCTACAAAATTTAATAGG - Intronic
976516488 4:85973788-85973810 GAGTGCCAAGAAAATCTAATGGG - Intronic
977086952 4:92612228-92612250 AAGTGCCAAAATAATTCAACAGG - Intronic
977921972 4:102655525-102655547 CAGGGCCAAAAGAATTTAATGGG + Intronic
978253610 4:106665128-106665150 ATGTGGCAAGATAATTCAATGGG - Intergenic
978277746 4:106972534-106972556 AAGTGACAACTTACTTTTATTGG - Intronic
979008866 4:115340709-115340731 ACTTCCCAACACAATTTAATAGG + Intergenic
979089572 4:116465050-116465072 AAGTGCCAGCAGAATGTAAAAGG + Intergenic
979420518 4:120499609-120499631 ATGTACCAAGATAATTCAATGGG - Intergenic
979781470 4:124656304-124656326 AAATGCCAAAGTAATTCAATGGG + Intergenic
980431239 4:132699227-132699249 AAATGCCAAAACAATTAAATGGG + Intergenic
980723339 4:136725389-136725411 CAATGCCAACATGATTCAATTGG + Intergenic
981572649 4:146169394-146169416 AAGTGCCTACATCAATTATTTGG + Intergenic
981965625 4:150598821-150598843 ACTTGACACCATAATTTAATAGG + Intronic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
982034083 4:151328230-151328252 GGGTGCCAACATAATTCAACAGG + Intergenic
982806361 4:159769711-159769733 AAGTGCCAAGGTAATTGTATTGG + Intergenic
983053201 4:163072129-163072151 AAGTGATAAAATATTTTAATTGG - Intergenic
984003421 4:174279724-174279746 AGGTGTCAAGATCATTTAATGGG + Intronic
984217371 4:176931076-176931098 GAGTGCCAACTTGATTTAGTTGG - Intergenic
984559829 4:181255172-181255194 ATGTGCCAACACAATTTTAAGGG + Intergenic
984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG + Intergenic
984893997 4:184519050-184519072 AGGTACCAACATAATTTCATGGG - Intergenic
985059449 4:186061802-186061824 AAGTGCCAACAAAAAATCATAGG - Intergenic
986760195 5:10873050-10873072 AAATGCCAAGATAATTAAAAAGG - Intergenic
986979464 5:13430139-13430161 AAGATCCAACATGATTAAATAGG + Intergenic
988822697 5:34903270-34903292 AGGTGCCAACTTATTTTACTAGG - Intergenic
989390199 5:40892385-40892407 AAGTGCCAAGAATATTCAATGGG + Intergenic
989819801 5:45782714-45782736 AGCTGCCAAGATAATTTAATTGG - Intergenic
992340361 5:75816968-75816990 AAGTACCTACATAAATTATTTGG - Intergenic
993284582 5:85975699-85975721 AAATACAAACATAAATTAATAGG - Intergenic
993415296 5:87621468-87621490 AAGTGCAGACAAAATTCAATTGG - Intergenic
993680871 5:90875915-90875937 TAGTGCCAAAATAATTAAAATGG + Intronic
994464942 5:100114897-100114919 AAGTGTCCACATAAATTATTTGG - Intergenic
995495700 5:112739933-112739955 AAGTCACAACATACTTGAATAGG - Intronic
995523124 5:113029588-113029610 AAGTGCAAATGTAATTTCATGGG - Intronic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
998708105 5:144788211-144788233 ATGTGCTAACACAATTTAATTGG + Intergenic
999566665 5:152870726-152870748 AAGTGTCAAAAGAATTCAATAGG + Intergenic
1003663103 6:8083098-8083120 GAGTGCCAATATAAATTAAAAGG - Intronic
1004914839 6:20321933-20321955 AAGTGACAAAATAATTAGATTGG + Intergenic
1005175332 6:23038233-23038255 AAGTACCAACATAAACCAATGGG + Intergenic
1005214576 6:23510217-23510239 AATTGCCATCATAATTTGAGGGG + Intergenic
1005469474 6:26148016-26148038 AAGAGTCAACAAAATTAAATAGG + Intergenic
1005555047 6:26968992-26969014 CAGAGACAACATAGTTTAATTGG - Intergenic
1005596757 6:27386631-27386653 AAGTGCCAAGACCATTCAATGGG + Intronic
1005799196 6:29402610-29402632 AATTGACAAAATAATTGAATAGG + Intronic
1007854735 6:44844122-44844144 AGGTGCCAAGATAACTCAATAGG + Intronic
1007990806 6:46254142-46254164 AAATGTCAACACAATTTAAAAGG + Intronic
1008145207 6:47883304-47883326 AAGTGCCAATATAATTTTTTAGG - Intronic
1009191893 6:60639150-60639172 AGGTGCCAAAATAATTCAGTGGG - Intergenic
1009548585 6:65056006-65056028 AAGTACCTACATAAATTATTTGG + Intronic
1010080636 6:71856910-71856932 AAGTACCCACATAAATTATTTGG + Intergenic
1010421364 6:75680228-75680250 TAGTGCCAACATCATTTAGCAGG - Intronic
1010832211 6:80544406-80544428 AAGTGCCAGAAAAATTTAAAAGG - Intergenic
1012266792 6:97154711-97154733 GAGTGCCAAGACAATTTAATTGG - Intronic
1012482800 6:99686684-99686706 AGATGCCAAAAAAATTTAATGGG - Intergenic
1012610698 6:101215584-101215606 AAGAGTCAACATAATTTAGAAGG + Intergenic
1013143969 6:107369043-107369065 AAGTGCCAAGACAATTCAATGGG + Intronic
1013855124 6:114563261-114563283 TAGTGACAACATAATGTATTGGG + Intergenic
1014297285 6:119635378-119635400 AAGTACCAATGTAGTTTAATGGG + Intergenic
1014732583 6:125051010-125051032 AAATGCTAACATAATTTAGTAGG - Intronic
1015193253 6:130495392-130495414 AAGTGCCAAGGTAACTCAATGGG - Intergenic
1015661436 6:135579398-135579420 AAGTGTCAAGATAATTCAACAGG - Intergenic
1015998829 6:139022089-139022111 GAGTGCCAAGACCATTTAATGGG - Intergenic
1016179675 6:141129606-141129628 AAGTGCCAAGGTAATGAAATAGG + Intergenic
1017583320 6:155891610-155891632 GAATGCCAAGATAATTCAATAGG + Intergenic
1017600881 6:156079772-156079794 CAGTGCCATCATCATTTTATGGG - Intergenic
1018214373 6:161512831-161512853 CTGTGCCACCTTAATTTAATTGG - Intronic
1018994838 6:168702828-168702850 AAGTGCCACCGTAGTTTATTAGG + Intergenic
1021205938 7:17781135-17781157 AGGTGTCAAGGTAATTTAATGGG + Intergenic
1021404825 7:20252897-20252919 AAATGCCAAAATAAATAAATGGG + Intergenic
1023288047 7:38639505-38639527 AAGTGCCAAGATCATTCAATGGG + Intergenic
1023449751 7:40270495-40270517 ATATGCCAACACAATTCAATTGG - Intronic
1024171152 7:46788417-46788439 GAGTGCCAAGATAATTCAATAGG - Intergenic
1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG + Intergenic
1026595104 7:71727953-71727975 AAGTAACTACATAATTTATTTGG - Intergenic
1027476539 7:78638773-78638795 AAGTTCAAAAATAAATTAATTGG - Intronic
1027511199 7:79082486-79082508 GAATGCCAAGATAATTCAATGGG - Intronic
1027887395 7:83926808-83926830 CAGTGCCAAGAAAATTCAATGGG - Intergenic
1028215260 7:88124112-88124134 AAATGCCAACTTAGTTAAATTGG + Intronic
1028278900 7:88895920-88895942 CAGTGTCTACATAATTTATTTGG - Intronic
1029849541 7:103447519-103447541 ATGTGACAAAATAATTTCATAGG - Intergenic
1029950702 7:104581748-104581770 ACATGCCAAAATAATTCAATGGG - Intronic
1030169925 7:106590776-106590798 AAATGCCAACATAAATGTATTGG + Intergenic
1030379207 7:108792954-108792976 AAATGCCTTAATAATTTAATAGG + Intergenic
1030872519 7:114774705-114774727 AAGTCCTAAAATAATATAATTGG + Intergenic
1031862800 7:127001140-127001162 AAGTGCCAAGATAATTTAATAGG + Intronic
1033060598 7:138102738-138102760 AAATGCCAACGCAATTCAATGGG + Intronic
1035549905 8:514331-514353 GAGTGCCAAGACAATTCAATGGG + Intronic
1036734682 8:11301379-11301401 AAGTACCAATACAATTCAATTGG + Intronic
1037308083 8:17526860-17526882 AAGTTTCAACATAATGTATTAGG + Intronic
1037324523 8:17674871-17674893 AAATGACAACATTATTTAACAGG + Intronic
1038330937 8:26608826-26608848 TAAAGCCAACATAATTTGATGGG - Intronic
1038881753 8:31621721-31621743 AAGTGCTAAGGTAATATAATGGG + Intergenic
1039163730 8:34652272-34652294 AGGTGCCAAGATTATTGAATGGG + Intergenic
1040714677 8:50235831-50235853 AACTGCTAACATATTTTACTTGG - Intronic
1040800605 8:51335836-51335858 AAGGGCAAATATAATTTACTGGG + Intronic
1041357833 8:57020553-57020575 AATTGCCAAAATAATTTAATGGG + Intergenic
1041743945 8:61185840-61185862 AAGGACCATGATAATTTAATGGG + Intronic
1041940222 8:63379179-63379201 GATTGCCAAGATCATTTAATGGG - Intergenic
1042805707 8:72768827-72768849 GGGTGCCAAGACAATTTAATGGG - Intronic
1043583632 8:81740963-81740985 AAATACCAAAATAATTTCATAGG - Intronic
1043655648 8:82662460-82662482 ATGTGCCAACATAAGTGCATAGG - Intergenic
1043809144 8:84713219-84713241 AAGTGCCAAGAACATATAATAGG - Intronic
1043953378 8:86334947-86334969 AAGTTCCAAAGTAATTCAATGGG + Intergenic
1044800406 8:95948156-95948178 AAATGGCAACAAAACTTAATTGG - Intergenic
1044910410 8:97052294-97052316 AAGAGTTAACATAATTTAATGGG - Intronic
1045336932 8:101213679-101213701 AAATGCCAATATAACTTTATTGG + Intergenic
1045717016 8:105058758-105058780 AATGGACAACATACTTTAATAGG - Intronic
1045917991 8:107496317-107496339 AAGTGTGTTCATAATTTAATAGG + Intronic
1046000545 8:108415973-108415995 AAGTGCCAAGAAAATTGAATGGG + Intronic
1046429083 8:114098956-114098978 AATTGACAAAATAATTGAATAGG + Intergenic
1047562396 8:126001800-126001822 AAGTGCCAAAGGAATTCAATGGG + Intergenic
1048490602 8:134889165-134889187 ATGTGCCATGATAATTCAATGGG - Intergenic
1049926448 9:413135-413157 GAGTGCCAAAACAATTCAATGGG + Intronic
1052158074 9:25219719-25219741 GAATGCAAACATAATTTACTTGG - Intergenic
1052902847 9:33809337-33809359 AAGTACAGACATTATTTAATAGG + Intergenic
1052951660 9:34218306-34218328 AAGTTCCACCAAAATTTAAATGG - Intronic
1053180315 9:35962586-35962608 AAGTGCCCACACGATTTAAGAGG - Intergenic
1053398104 9:37793456-37793478 AGGTGCCAAGACAATTCAATGGG + Intronic
1053558798 9:39167550-39167572 CAGTGCAAAGTTAATTTAATAGG - Intronic
1053822925 9:41987778-41987800 CAGTGCAAAGTTAATTTAATAGG - Intronic
1054138313 9:61451391-61451413 CAGTGCAAAGTTAATTTAATAGG + Intergenic
1054607649 9:67199587-67199609 CAGTGCAAAGTTAATTTAATAGG + Intergenic
1054711866 9:68518811-68518833 AAGTGCTAACATAATTTAGTTGG + Intronic
1055203984 9:73704663-73704685 AAGTACCAAGACAATTCAATGGG + Intergenic
1055555952 9:77473886-77473908 AGGTGCCAAGCTAATTCAATGGG + Intronic
1055642834 9:78334214-78334236 TAGTGACAAAATAAGTTAATAGG + Intergenic
1056033503 9:82579418-82579440 GAGTGCCAACACCATTCAATGGG - Intergenic
1056510814 9:87303590-87303612 GAGTGCCAAGACAATTTAATGGG + Intergenic
1056984148 9:91345907-91345929 AGGTCCCAAAATAATGTAATGGG + Intronic
1057088430 9:92233735-92233757 AAGTCCCAACATGTTTTATTAGG + Intronic
1057243794 9:93436774-93436796 AACTGCTAACACAATTTGATTGG + Intergenic
1057375536 9:94518779-94518801 AAGAGCCAAAATAATTTCAAAGG - Intergenic
1057628312 9:96698806-96698828 AAGTGCCAAGACCATTTGATGGG + Intergenic
1057703439 9:97380632-97380654 AGGTGCCAAGACAATTTAATGGG - Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1058304211 9:103416754-103416776 GAGTGCCAAGACAATTCAATGGG - Intergenic
1059208723 9:112490672-112490694 CAATGCCAACAAAGTTTAATAGG + Intronic
1059654465 9:116345017-116345039 CAGTGAGAACATAATTGAATGGG + Intronic
1059813309 9:117881852-117881874 AAGTGCCTCCATAAGTTTATGGG - Intergenic
1060450779 9:123736995-123737017 AAATGTCAATATAATTTATTCGG + Intronic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1187421896 X:19142414-19142436 GAGTGCCAAAACAATTCAATAGG + Intergenic
1187962028 X:24575658-24575680 AAGTCCCAGCAGAATTGAATGGG - Intronic
1188402441 X:29762836-29762858 CAGTGCCAGCACAATTTAATTGG + Intronic
1188693949 X:33164869-33164891 AAGTGCCAACTCTAATTAATTGG - Intronic
1188794939 X:34451776-34451798 ATATGCCAAGATAATTCAATGGG + Intergenic
1189553836 X:42121301-42121323 AAGTGCTAAAAAAATTAAATGGG - Intergenic
1189638496 X:43040357-43040379 AATTGGCAAAATAATTTTATAGG + Intergenic
1189647664 X:43151475-43151497 AAGTGCCAAGATAATGGAAAAGG + Intergenic
1190145416 X:47887089-47887111 AAGTGCCAATGTGATTCAATGGG - Intronic
1190159890 X:48024116-48024138 GGGTGCCAAGATCATTTAATGGG - Intronic
1190635491 X:52428882-52428904 AGGTGCCAAGATAATTTAGTGGG - Intergenic
1190639468 X:52468868-52468890 AGGTCCCAAGATAATTTAGTGGG - Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1190835783 X:54099732-54099754 GGGTGCCAAGATAATTCAATGGG - Intronic
1190841278 X:54146859-54146881 AAGTGCAAAGGTAATTCAATGGG + Intronic
1191029590 X:55953697-55953719 AGGTGCCAAAACAATTTAATGGG + Intergenic
1191896106 X:65995054-65995076 AAGTCACAACATAATTGAGTAGG + Intergenic
1192622370 X:72691173-72691195 AGGTGCCAAGATAATTCAATGGG - Intronic
1193404384 X:81083729-81083751 AAGTGCCCACTTCATCTAATTGG + Intergenic
1193667920 X:84346610-84346632 AGGTGCAAAAAGAATTTAATAGG + Intronic
1194679240 X:96831428-96831450 AAGTGCCAACAGACTGTAAATGG - Intronic
1195331347 X:103804262-103804284 GACTGCCAGGATAATTTAATGGG - Intergenic
1195780516 X:108458314-108458336 AAGTATCAAGGTAATTTAATGGG - Intronic
1195972230 X:110485692-110485714 AAGTGCCAGGATCATTCAATGGG - Intergenic
1196043904 X:111235799-111235821 GAGTGCCAACACTATTCAATGGG + Intergenic
1196067436 X:111480125-111480147 GAGTGCCAAGACAATTCAATGGG - Intergenic
1196281359 X:113826866-113826888 AGGTGCCAAGAAAATTCAATGGG + Intergenic
1197091229 X:122539928-122539950 AACTGCCAATATAATTCACTGGG + Intergenic
1197499567 X:127227286-127227308 AAATGCAAACTTAATGTAATAGG - Intergenic
1198297256 X:135299880-135299902 GGGTGCCAAAACAATTTAATAGG - Intronic
1198315158 X:135458086-135458108 GAGTGCCAAGATAATTCAATAGG - Intergenic
1198383999 X:136110348-136110370 AGGTGCAAAGACAATTTAATGGG - Intergenic
1199141282 X:144316538-144316560 AAATGCCAAGATAATTTAATGGG + Intergenic
1199289296 X:146088714-146088736 AAGTGGCAACATGATTTAAGAGG - Intergenic
1199503867 X:148539718-148539740 AAGTGTTAACATTCTTTAATGGG + Intronic
1199722879 X:150555280-150555302 AGGTGCCAAGACAATTCAATGGG + Intergenic