ID: 963242473

View in Genome Browser
Species Human (GRCh38)
Location 3:143021251-143021273
Sequence AATACCTTACTGTAACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963242473 Original CRISPR AATACCTTACTGTAACAAAC TGG Intronic
904403303 1:30270914-30270936 GATACATTAGTGTAAGAAACAGG - Intergenic
907110402 1:51921731-51921753 AATACATTGCTGTAAAAAAGTGG + Intronic
911032184 1:93500880-93500902 AATACCTTGTTTAAACAAACAGG - Intronic
912038882 1:105359131-105359153 AATACCTTACTCTAGCAATGTGG - Intergenic
912084996 1:105989798-105989820 AATACCTTAGTGTAGCAGAAAGG + Intergenic
921912462 1:220565083-220565105 AATACCTTACTGAAATATAAAGG - Intronic
1067960001 10:50837544-50837566 AATACCTCACGGTAAAGAACTGG + Intronic
1073796937 10:106998741-106998763 AATACCTCATTTTAAAAAACTGG + Intronic
1075272482 10:121064430-121064452 AATACCTTACATTACAAAACGGG + Intergenic
1075749890 10:124758335-124758357 AATACCAAACTGTAAAAACCAGG - Intronic
1077925622 11:6679859-6679881 TCTACCTTACTGTAAAGAACTGG + Intergenic
1080909104 11:36577164-36577186 AATAACTAACTGTAGCTAACAGG - Exonic
1083387891 11:62325523-62325545 AATAAATTACTAGAACAAACAGG + Intergenic
1084866866 11:72065942-72065964 AATACTGTACTGTAAGAACCAGG + Intronic
1092657565 12:10703049-10703071 AATGTCTTACTGGAACAAAAAGG - Intronic
1093607157 12:21106067-21106089 AAGAGTTTACTGAAACAAACAGG + Intronic
1094252595 12:28381775-28381797 AATACCTCACTATAATAAAATGG - Intronic
1095323217 12:40855725-40855747 TATAGCTTAATGTAACAGACGGG + Intronic
1095932705 12:47644418-47644440 AATATATTACAGTAACACACAGG + Intergenic
1096172314 12:49482057-49482079 AAAACCTTACTTTAATCAACTGG - Intronic
1098230549 12:68368524-68368546 GATTCCTTTCTGTAACATACAGG + Intergenic
1099579224 12:84420676-84420698 AATCCCTTAATGTATCAAATTGG - Intergenic
1099946133 12:89246387-89246409 AATACCTTAGGTTAAGAAACAGG - Intergenic
1100519366 12:95358445-95358467 AATACCTTCCTAGAACAAAAGGG - Intergenic
1101191795 12:102341868-102341890 ATTACATTACTGTAACTAACTGG - Intergenic
1105464380 13:20624242-20624264 AATCCTTTATTATAACAAACTGG - Intronic
1106586818 13:31064567-31064589 AAGCCCTTACTGGAACACACAGG + Intergenic
1109581558 13:64345718-64345740 AATATCTAACTGTAGCAATCAGG + Intergenic
1110468482 13:75830232-75830254 AATAATTTACTGTAAGAACCTGG + Intronic
1111056990 13:82963978-82964000 AATACCTTAATGTACCATAAGGG - Intergenic
1122509125 14:102251621-102251643 AAAAAATTACTGTAACAAACAGG + Intronic
1124952932 15:34340121-34340143 AATACATTACTGAAACATATAGG - Intergenic
1125572774 15:40733696-40733718 AATAAACTAATGTAACAAACAGG - Intergenic
1126337405 15:47602171-47602193 AATTCTATACAGTAACAAACAGG + Intronic
1128317030 15:66667413-66667435 AATACCTCACTGTGAGAAGCAGG + Intronic
1131129229 15:89885041-89885063 AATAACTTAATGTAACATCCAGG + Intronic
1131728590 15:95254474-95254496 AAAACTGTAGTGTAACAAACAGG + Intergenic
1135198535 16:20416058-20416080 AAAACATTACTGAAATAAACTGG + Intronic
1138402643 16:56759990-56760012 AATACCTTAAGGTAAAAAAATGG - Intronic
1139017883 16:62711896-62711918 AAGAGCATACTGTAACACACGGG + Intergenic
1140700571 16:77577758-77577780 AATTCCTTGCTAAAACAAACAGG + Intergenic
1141837062 16:86548205-86548227 AATTCCTTATTGTAAGAAAAGGG - Intronic
1150596129 17:66606926-66606948 TATAACTTACAGTAAAAAACAGG + Intronic
1151091364 17:71443799-71443821 AATACCAAACTGTATCAAAATGG - Intergenic
1153028892 18:695060-695082 AATACATTATTGGAAAAAACTGG - Intronic
1154074897 18:11190549-11190571 AATACATTACTGAAACAAAATGG + Intergenic
1154260009 18:12822816-12822838 AATTCATTACTGTTACAAAAAGG + Intronic
1154558908 18:15799189-15799211 AATACCTTCCCGTAACAACTAGG + Intergenic
1154559105 18:15801901-15801923 AATATCTTCCTGTAACAACTAGG + Intergenic
1154566618 18:15905555-15905577 AATATCTTCCTGTAACAACTAGG + Intergenic
1154573200 18:15995166-15995188 AATATCTTCCTGTAACAACTAGG + Intergenic
1154602195 18:16391860-16391882 AATATCTTCCTGTAACAACTAGG + Intergenic
1154624104 18:16692739-16692761 AATATCTTCCCGTAACAAATAGG + Intergenic
1154693393 18:17642296-17642318 AATATCTTCCCGTAACAACCAGG + Intergenic
1154695232 18:17667729-17667751 AATATCTTCCTGTAACAACTAGG + Intergenic
1154706459 18:17821439-17821461 AATATCTTCCTGTAACAACTAGG + Intergenic
1154720307 18:18011403-18011425 AATATCTTCCCGTAACAAATAGG + Intergenic
1154731715 18:18167917-18167939 AATACCTTCCCGTAACAACTAGG + Intergenic
1154741539 18:18302418-18302440 AATATCTTCCCGTAACAAATAGG + Intergenic
1154745304 18:18353996-18354018 AATATCTTCCTGTAACAACTAGG + Intergenic
1154759946 18:18554680-18554702 AATACCTTCCCGTAACAACTAGG + Intergenic
1154764181 18:18612844-18612866 AATATCTTCCTGTAACAACTAGG + Intergenic
1154785289 18:18902732-18902754 AATATCTTCCTGTAACAACTAGG + Intergenic
1154787433 18:18932239-18932261 AATATCTTCCTGTAACAACTAGG + Intergenic
1154789300 18:18958166-18958188 AATATCTTCCTGTAACAACTAGG + Intergenic
1154795836 18:19047716-19047738 AATATCTTCCTGTAACAACTAGG + Intergenic
1154802458 18:19138796-19138818 AATATCTTCCTGTAACAACTAGG + Intergenic
1154825771 18:19459663-19459685 AATATCTTCCTGTAACAACTAGG + Intergenic
1154837449 18:19621143-19621165 AATATCTTCCCGTAACAAATAGG + Intergenic
1154872693 18:20107313-20107335 AATACCTTCCCGTAACAACTAGG + Intergenic
1154901523 18:20504259-20504281 AATATCTTCCCGTAACAAATAGG + Intergenic
1155016243 18:21843205-21843227 AATACTTTACCCTAACAATCTGG - Exonic
1155992583 18:32294714-32294736 AAAACCTTACAGTAAGACACTGG - Intronic
1156903083 18:42324045-42324067 AATATTTTAATGTGACAAACTGG - Intergenic
1157415420 18:47498307-47498329 TAAACCTTACTGGAACAAACAGG - Intergenic
1157766914 18:50305369-50305391 AATATCTGATTGTAACAAAAAGG - Intergenic
1165107509 19:33481195-33481217 AATAACATACAGTAACAAATTGG + Intronic
931669287 2:64632171-64632193 AAAACCTTGCTGTTACAAATTGG - Exonic
933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG + Intergenic
939484574 2:142794597-142794619 AATACCTATCTGTGACAGACAGG - Intergenic
939642539 2:144657874-144657896 AATATCTGACTGTAACAGAAGGG + Intergenic
1173119590 20:40276513-40276535 AATCCCTTCCTGTTCCAAACTGG - Intergenic
1179468083 21:41591295-41591317 AACACCTTACAGACACAAACAGG + Intergenic
952033024 3:29167563-29167585 AATATCTTACAGAAACAAAGAGG - Intergenic
953517942 3:43615266-43615288 AATATCTTGCAGTAGCAAACAGG + Intronic
954938033 3:54344875-54344897 AAGACCTTACTGATAAAAACAGG + Intronic
956178660 3:66498745-66498767 AAAACCTAACTGTAACTAAAGGG + Intronic
956968080 3:74487383-74487405 AACACATTACCGTAAAAAACAGG + Intronic
959456912 3:106573852-106573874 AATGCCTGACTGTACCAATCAGG + Intergenic
960322592 3:116254576-116254598 ATAACCTTACTGAAACAAAACGG - Intronic
960467107 3:118009903-118009925 AATATATTACTATAACAAAAAGG - Intergenic
962133986 3:132713179-132713201 AATACCTCACTGTAAGAAAATGG - Exonic
962954206 3:140249173-140249195 TAAGCCTTACTCTAACAAACAGG + Intronic
963242473 3:143021251-143021273 AATACCTTACTGTAACAAACTGG + Intronic
963726744 3:148931473-148931495 AATACTTTACAGTAACAAGTAGG + Intergenic
964979289 3:162659518-162659540 AATACTTTTATGTAACAATCAGG - Intergenic
967582969 3:191181205-191181227 AATACAATACTGTCTCAAACAGG + Intergenic
970178952 4:13367670-13367692 ACTGCCTTTCTGTAACAAAAAGG + Intronic
970290581 4:14566836-14566858 AATACATTACTGTGACTCACAGG - Intergenic
971550880 4:27954071-27954093 AATAATTTAATGTAAGAAACTGG + Intergenic
971973219 4:33648068-33648090 TATTCCTTACTATAAGAAACTGG - Intergenic
972969598 4:44556666-44556688 AATTCCTTACACTGACAAACTGG + Intergenic
973014114 4:45115220-45115242 ATTATCTTATTGTAACCAACTGG - Intergenic
973577941 4:52311288-52311310 AATATTTAACTGTTACAAACTGG - Intergenic
973695416 4:53485923-53485945 AATAGCTTACTGCAAGAAAGAGG + Intronic
974724828 4:65785127-65785149 AATACATTATTCTAATAAACAGG + Intergenic
976463244 4:85337198-85337220 CATAAATTACTGAAACAAACTGG - Intergenic
976626207 4:87185952-87185974 ATTACCTGACTTTAAGAAACTGG - Intronic
976867297 4:89745307-89745329 AATACCTGACTGTAACTGGCAGG - Intronic
983189011 4:164734692-164734714 ACTTCCTTACTGTGACAAGCTGG + Intergenic
991036971 5:62137115-62137137 CATATTTCACTGTAACAAACAGG - Intergenic
994691444 5:103024973-103024995 AATACCTGAATCTACCAAACTGG - Intronic
996982142 5:129511549-129511571 AATATATTATTTTAACAAACTGG + Intronic
997904058 5:137797146-137797168 AATACCTTATTAGAAAAAACTGG - Intergenic
998863489 5:146470449-146470471 AATACCTTGCTATACCAATCAGG - Intronic
999059444 5:148617787-148617809 AATTCATTACTGTAAGAACCAGG - Intronic
1008375919 6:50791629-50791651 AATTCATTGCTGTCACAAACTGG - Intergenic
1010904945 6:81476056-81476078 AATACATGAGTGTAAGAAACCGG - Intergenic
1011474454 6:87737079-87737101 AATAGCTTAGTGTTACAAAACGG + Intergenic
1012005123 6:93704245-93704267 AATAACTAACTGTAATAAACCGG - Intergenic
1012610223 6:101208743-101208765 AAAACATTTCTGTAACAAAGAGG + Intergenic
1015679886 6:135794467-135794489 AATATCAAAATGTAACAAACTGG + Intergenic
1017864715 6:158433023-158433045 AATACATTCCTGTAACAATTAGG - Intronic
1018143024 6:160858718-160858740 AACACCGTGCTGTAACAACCAGG + Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1023008190 7:35898495-35898517 AATACCCTAGTGTAACAAAACGG + Intronic
1023015556 7:35966638-35966660 AATACCCTAGCGTAACAAAATGG + Intergenic
1027353575 7:77335571-77335593 AATTCCTTAATGTAACCCACTGG - Intronic
1027659179 7:80968387-80968409 AATGCATGACTGTAACAAATAGG + Intergenic
1030759890 7:113337483-113337505 AATACCTTGCAGTCATAAACAGG + Intergenic
1031115544 7:117664077-117664099 AAAAACTAACTGTAACAAATAGG - Intronic
1035012305 7:155730047-155730069 AATACCTTGCTATTACAAACAGG + Intronic
1035514713 8:222979-223001 AATACCAAACTGTTACAAATAGG - Intergenic
1035839573 8:2795801-2795823 AATAACTGACAGTGACAAACAGG - Intergenic
1040083967 8:43320063-43320085 GATACCTTACTTAAAAAAACAGG + Intergenic
1055489514 9:76790284-76790306 AATTCATTATTGCAACAAACTGG - Intronic
1055965782 9:81863799-81863821 AAAAGCTTATTGTAACAGACAGG - Intergenic
1057516050 9:95722292-95722314 TATTCATCACTGTAACAAACAGG + Intergenic
1058601946 9:106679848-106679870 AATTTCTTCCTATAACAAACAGG - Intergenic
1060705875 9:125800564-125800586 AACACCTCAGTGAAACAAACTGG + Intronic
1185781328 X:2849604-2849626 AATGCCTTTCTGTATCAATCTGG + Intronic
1187290549 X:17949264-17949286 AGCAACTTACTGTAACAAAATGG + Intergenic
1188726134 X:33584804-33584826 AAATCCTTACTGTAACACAGAGG + Intergenic
1192481526 X:71490406-71490428 AATTCCTTAGTATAACAGACAGG - Intronic
1195378480 X:104250217-104250239 AATACCTTACTTTAGAAAAAGGG + Exonic
1196054243 X:111338136-111338158 AATGCCTTACTGTAGTCAACAGG - Intronic
1198715774 X:139556540-139556562 AAGACCTTAGTGTAACATCCTGG - Intronic
1199118311 X:144018839-144018861 ATTACATTACTGTAACCTACAGG + Intergenic
1199940788 X:152625705-152625727 TATACCTCACTATACCAAACTGG + Intergenic
1200456979 Y:3405730-3405752 AATACATTGGTGTAACTAACAGG - Intergenic