ID: 963250644

View in Genome Browser
Species Human (GRCh38)
Location 3:143100046-143100068
Sequence CTTTGAATCAGGAGGAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963250637_963250644 28 Left 963250637 3:143099995-143100017 CCTTTGACAGCAAGAATCAGTGA No data
Right 963250644 3:143100046-143100068 CTTTGAATCAGGAGGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963250644 Original CRISPR CTTTGAATCAGGAGGAACCA TGG Intergenic
No off target data available for this crispr