ID: 963252970

View in Genome Browser
Species Human (GRCh38)
Location 3:143119620-143119642
Sequence CGTCGCTGCGCCTCGGGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963252970_963252989 11 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252989 3:143119654-143119676 CTCGGCGTTGGGGGCGGGGGCGG 0: 1
1: 1
2: 7
3: 78
4: 823
963252970_963252995 25 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252995 3:143119668-143119690 CGGGGGCGGGGCCGGCGAAGGGG 0: 1
1: 1
2: 10
3: 131
4: 1088
963252970_963252992 17 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252992 3:143119660-143119682 GTTGGGGGCGGGGGCGGGGCCGG 0: 2
1: 3
2: 99
3: 822
4: 4149
963252970_963252984 5 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252984 3:143119648-143119670 AGCCGGCTCGGCGTTGGGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 137
963252970_963252980 -1 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252980 3:143119642-143119664 GGTGGGAGCCGGCTCGGCGTTGG 0: 1
1: 0
2: 1
3: 27
4: 140
963252970_963252985 6 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252985 3:143119649-143119671 GCCGGCTCGGCGTTGGGGGCGGG 0: 1
1: 0
2: 2
3: 30
4: 198
963252970_963252996 26 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252996 3:143119669-143119691 GGGGGCGGGGCCGGCGAAGGGGG 0: 1
1: 1
2: 17
3: 176
4: 1648
963252970_963252982 1 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252982 3:143119644-143119666 TGGGAGCCGGCTCGGCGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 136
963252970_963252993 23 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252993 3:143119666-143119688 GGCGGGGGCGGGGCCGGCGAAGG 0: 1
1: 5
2: 50
3: 566
4: 3784
963252970_963252983 2 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252983 3:143119645-143119667 GGGAGCCGGCTCGGCGTTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 140
963252970_963252981 0 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252981 3:143119643-143119665 GTGGGAGCCGGCTCGGCGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 100
963252970_963252988 8 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252988 3:143119651-143119673 CGGCTCGGCGTTGGGGGCGGGGG 0: 1
1: 0
2: 2
3: 22
4: 304
963252970_963252994 24 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252994 3:143119667-143119689 GCGGGGGCGGGGCCGGCGAAGGG 0: 1
1: 0
2: 14
3: 136
4: 963
963252970_963252998 30 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252998 3:143119673-143119695 GCGGGGCCGGCGAAGGGGGAGGG 0: 1
1: 0
2: 3
3: 58
4: 748
963252970_963252987 7 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252987 3:143119650-143119672 CCGGCTCGGCGTTGGGGGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 196
963252970_963252997 29 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252997 3:143119672-143119694 GGCGGGGCCGGCGAAGGGGGAGG 0: 1
1: 1
2: 14
3: 192
4: 1536
963252970_963252979 -7 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252979 3:143119636-143119658 AGCGACGGTGGGAGCCGGCTCGG 0: 1
1: 0
2: 1
3: 6
4: 83
963252970_963252990 12 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252990 3:143119655-143119677 TCGGCGTTGGGGGCGGGGGCGGG 0: 1
1: 1
2: 6
3: 104
4: 1033
963252970_963252991 13 Left 963252970 3:143119620-143119642 CCAGCCCCCGAGGCGCAGCGACG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 963252991 3:143119656-143119678 CGGCGTTGGGGGCGGGGGCGGGG 0: 1
1: 1
2: 27
3: 312
4: 1775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963252970 Original CRISPR CGTCGCTGCGCCTCGGGGGC TGG (reversed) Exonic
900204952 1:1427736-1427758 CGTCGGGGCGCCCCGGGGGGCGG - Exonic
904237047 1:29122819-29122841 CGCCCCTGCGCCTCGGGATCCGG + Intronic
904591559 1:31618067-31618089 CCTTCCTGCACCTCGGGGGCTGG - Intronic
907312042 1:53544360-53544382 CCTCACTGTGCCCCGGGGGCCGG - Intronic
912305181 1:108560044-108560066 CGCCTCAGCGCCTCGGGGGTCGG - Intergenic
912514738 1:110210644-110210666 CGGCGCCGAGCCTGGGGGGCGGG - Intergenic
912682662 1:111739097-111739119 CGTCCCGGCTCCCCGGGGGCCGG + Intronic
922124909 1:222712521-222712543 CGGGGCGGGGCCTCGGGGGCGGG - Exonic
922725622 1:227921783-227921805 CGGGGCCGTGCCTCGGGGGCAGG - Exonic
922739408 1:228006963-228006985 CGGCGCTGCGCCAGGTGGGCCGG - Intergenic
922851157 1:228735308-228735330 CGCGGCGGCGCCTCGGGCGCGGG + Exonic
1062843856 10:689897-689919 CGTCACGGGGCCGCGGGGGCAGG + Intergenic
1064230694 10:13528180-13528202 CCTCGGGGCGCCTCCGGGGCAGG - Intronic
1073147816 10:101292066-101292088 AGGCGCTGCCCCGCGGGGGCGGG - Intergenic
1075485402 10:122818611-122818633 CGCCCCTGCGCCTGGCGGGCGGG + Intergenic
1078245875 11:9573315-9573337 CCTCGCTGCTCCTCCGGTGCTGG - Intergenic
1085485605 11:76860778-76860800 CGCCGCTGGGCCGCGGGGCCGGG - Intergenic
1092246687 12:6867855-6867877 CGTCGGTGCGTCGAGGGGGCAGG + Intronic
1096623471 12:52879029-52879051 CGTCCCTGCCCCTCCGAGGCTGG - Intergenic
1100391724 12:94150040-94150062 CTCCGCGGCGCCCCGGGGGCAGG - Intronic
1103507599 12:121452507-121452529 GGGCGCTGCTCCCCGGGGGCCGG - Intronic
1103623760 12:122204069-122204091 CAGCGCTGCGCGTCGGGCGCGGG - Intronic
1104568281 12:129903882-129903904 GGCCGCTGCGCCTCGGGGCTCGG + Intergenic
1119487715 14:75002735-75002757 CGCCCCCGCGCCTCGGGGGCTGG - Intergenic
1126666875 15:51083533-51083555 CGTCGCTGCTGCTCGCTGGCTGG - Intronic
1126990974 15:54374778-54374800 CCTGGCTGCGCCTCGCCGGCTGG + Intronic
1128017089 15:64356921-64356943 TGAGACTGCGCCTCGGGGGCGGG + Intronic
1128309081 15:66619443-66619465 GGTTGCTGCGCCTCCGGGGCTGG - Intronic
1129541110 15:76347378-76347400 CGGCGCTCCGGCTCGAGGGCGGG - Intergenic
1133052294 16:3124136-3124158 CGGCGCTGCCCCTCTGGGCCGGG + Intergenic
1136453740 16:30369397-30369419 CATCTCTGGGCCTCGAGGGCAGG - Exonic
1142292042 16:89197614-89197636 TGTGGCTGCGGCTCGGGGTCAGG - Intronic
1144497526 17:15757894-15757916 CCTCGCTGGGCCTCAGGTGCAGG - Intergenic
1144652106 17:17013737-17013759 CCTCGCTGGGCCTCAGGTGCAGG + Intergenic
1145160890 17:20572944-20572966 CCTCGCTGGGCCTCAGGTGCAGG - Intergenic
1145859385 17:28195135-28195157 CGTGGCTGCACCTGGGGGGAGGG + Exonic
1146169264 17:30620825-30620847 CTTCGCTGGGCCTCAGGGGGAGG + Intergenic
1146170298 17:30626624-30626646 CTTCGCTGGGCCTCAGGGGGAGG - Intergenic
1150782200 17:68133375-68133397 CTTCGCTGGGCCTCAGGGGGAGG + Intergenic
1151767577 17:76140221-76140243 GGTCGGTGCCCCCCGGGGGCAGG + Exonic
1152886827 17:82856746-82856768 CCTCGCTGCGCATCCAGGGCGGG + Intronic
1152886837 17:82856790-82856812 CCTCGCTGCGCATCCAGGGCGGG + Intronic
1152886858 17:82856878-82856900 CCTCGCTGCGCATCCAGGGCGGG + Intronic
1156275913 18:35582218-35582240 CCTCGCGGCGCCACGGGGGAGGG + Intronic
1157753011 18:50194985-50195007 CGTAGCTGCGCCGCCGCGGCGGG - Exonic
1160242102 18:77131980-77132002 CTGCGCTTCGCCCCGGGGGCAGG + Intronic
1160864281 19:1250230-1250252 CCTCGCCGCGCCTCCGGGACAGG - Exonic
1162470864 19:10871461-10871483 GGGCGCTGCGCCACGGGGCCGGG + Intergenic
1163023511 19:14496138-14496160 CGCAGCGGCGCCTGGGGGGCGGG + Intronic
1164069211 19:21750820-21750842 CGTCTCTGCTCCTCTGGGCCGGG - Intronic
1164639067 19:29811802-29811824 CGTCCCTGCGCCTCGCGGGCCGG + Intergenic
1165639340 19:37370958-37370980 CGCGCCTGCGCCACGGGGGCAGG - Intergenic
1166367287 19:42284159-42284181 CGGCGCTGAGCCTCGGGCCCGGG + Intronic
1167596802 19:50432331-50432353 GGTCCCTGCGCCTCCGGGGAGGG - Intergenic
1167866977 19:52336633-52336655 CGGCGCTGCGCTTCAGGGGCCGG - Intronic
1168332706 19:55579330-55579352 CGGCGCAGCGCAGCGGGGGCTGG + Exonic
932404177 2:71502924-71502946 CGTGGCTGGGCCTCTGGGGAGGG + Intronic
933811851 2:86037499-86037521 CGTCGCTGAGTCACGGGGGCAGG - Intronic
934026256 2:88003589-88003611 CCCCACTGAGCCTCGGGGGCCGG - Intergenic
934966756 2:98730804-98730826 AGCGGCTGGGCCTCGGGGGCGGG - Intronic
941686789 2:168456099-168456121 AGTCGCTGCGCCCTGGGCGCAGG - Intronic
944801222 2:203239337-203239359 CGTCGCTACCCCTCAGGCGCCGG + Intronic
946006246 2:216527335-216527357 AGTCCCAGCTCCTCGGGGGCCGG - Intronic
946376032 2:219309357-219309379 CGTCGCTGCGGCTCCGGCCCGGG - Exonic
949000482 2:241610276-241610298 CGGGGCTGCGCTTCCGGGGCGGG - Intronic
1169118675 20:3082959-3082981 CGACGGTGCGCGGCGGGGGCGGG - Exonic
1169212940 20:3777851-3777873 CGGCGCTGGGCCTTGGGGGGCGG - Exonic
1172661876 20:36573926-36573948 CGGCGCTGCGCTCCGGGGGCCGG + Intronic
1176005884 20:62861979-62862001 CGTGGCTGGGCCGTGGGGGCGGG - Intergenic
1176143212 20:63554094-63554116 TGACGCTGCGGCCCGGGGGCGGG - Exonic
1181458030 22:23070600-23070622 CGCCGCTGAGCCTCAGGGGTCGG + Intronic
1183671686 22:39276564-39276586 GGACACTGCGCCTGGGGGGCGGG - Intergenic
1184333096 22:43838257-43838279 CCTCGCTCCTCCTCAGGGGCTGG + Intronic
1184759532 22:46536923-46536945 CGTCGGCGCGTCTCGGGCGCGGG - Exonic
1185258565 22:49849467-49849489 GGTCGCGGCGCCTCCGGGGTGGG + Intergenic
950282541 3:11719955-11719977 CCTGGCGGGGCCTCGGGGGCGGG - Intronic
954152033 3:48662593-48662615 CGTGGCGGGGCCTCGGGGGACGG - Exonic
963228855 3:142889365-142889387 CGTCTCTGGGCGTCGGGGCCCGG - Intergenic
963252970 3:143119620-143119642 CGTCGCTGCGCCTCGGGGGCTGG - Exonic
966846553 3:184135154-184135176 CTACCCTGCGCCTCAGGGGCCGG + Intronic
968514308 4:1009885-1009907 CGTCGCGGCCCCTGGCGGGCGGG - Intergenic
968545117 4:1194390-1194412 CGTCGCTGTCCCCCGGGGGCTGG - Intronic
968556445 4:1248504-1248526 CGTGGCTGGGCCTGCGGGGCCGG - Intronic
973916111 4:55636266-55636288 CCTGGCTGTGCCTCGGGGCCCGG + Exonic
973993709 4:56436076-56436098 CGTCTCTGCGCCTGCGCGGCGGG + Intronic
985681636 5:1258864-1258886 CTTGGCCGAGCCTCGGGGGCAGG - Intronic
1002196579 5:177504614-177504636 CGTCGCTGCCACTCGGGTGAGGG - Exonic
1002896386 6:1382708-1382730 CGGGGCTGCGCGGCGGGGGCTGG - Intergenic
1004280460 6:14275735-14275757 CGTCCCTGCGCATCAGGGGCAGG - Intergenic
1006183960 6:32169959-32169981 CGTCGCTTCACCTCGGGTGAGGG - Exonic
1006369174 6:33633734-33633756 TTTCGCTTCGCCGCGGGGGCGGG + Intronic
1006737506 6:36284995-36285017 GGTCACTGCTCCTCGGAGGCTGG + Intronic
1007423832 6:41734815-41734837 CGGCGCCACGCCCCGGGGGCTGG - Intronic
1008932428 6:56954817-56954839 CGAGGCTGCGACTCGGCGGCTGG + Intergenic
1016923196 6:149317023-149317045 CGCCGCAGCGCCCCGGGGTCCGG + Intronic
1017146505 6:151240231-151240253 CGTCGCAGCGCCTCTGGTCCCGG + Intronic
1017672519 6:156779630-156779652 GGTCGGGGCGCCCCGGGGGCCGG + Intronic
1017738209 6:157381909-157381931 CGGCGCCGCGGCTCGGGGGGCGG + Exonic
1017899530 6:158707304-158707326 CGTCCCTGGCCCTCCGGGGCAGG + Intronic
1019057012 6:169231323-169231345 CGTCGCTGGGCTTCTGGCGCTGG - Intronic
1019194533 6:170273412-170273434 CAGCGCTGCGGCTCGGCGGCGGG - Intergenic
1019475260 7:1241343-1241365 CGCCGCTGCGACTCCGGGGCGGG + Intergenic
1019892364 7:3956509-3956531 GGTCGCTGTGCCTGGGGAGCAGG - Intronic
1026017341 7:66681862-66681884 CGCTGCTGCGCATCGGGAGCCGG + Intronic
1028621433 7:92833341-92833363 CGCCGCGGCGCCGCTGGGGCGGG + Exonic
1031966535 7:128031605-128031627 CGCCGCTGGTCCTCGGGGGCCGG - Intronic
1033406575 7:141074821-141074843 CCTGGCTGAGCCTCGGGGCCAGG + Intronic
1034578841 7:152025612-152025634 CGTCACCGCGGCGCGGGGGCGGG + Intergenic
1034911739 7:155003165-155003187 CGGCGCTCCCCCTCGGTGGCCGG - Intergenic
1035719818 8:1783602-1783624 CCTCGCCGCGCTGCGGGGGCTGG + Exonic
1035747908 8:1974537-1974559 CGCCGCTGCGCCCGGGGTGCGGG + Intronic
1037787151 8:21909885-21909907 CGTCGCTGCGTCTCTGGAGAGGG - Exonic
1048152120 8:131904213-131904235 CGTTGCTGGGCCGCGGAGGCCGG - Exonic
1048345129 8:133570391-133570413 GGTCACTGCGTCTCGCGGGCTGG - Intronic
1049548877 8:143247171-143247193 CGACGCTGCGCGTCCTGGGCCGG - Exonic
1053240096 9:36487904-36487926 CGCGGCCGCGCCTCAGGGGCGGG - Intergenic
1056687167 9:88776242-88776264 CGAAGCTGCCCCTCAGGGGCTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1059234504 9:112750696-112750718 GGCCGCGGCGCCTCGGGGGCGGG + Intergenic
1061807707 9:133145651-133145673 CCTCTCTGAGCCTCAGGGGCTGG - Intronic
1062292879 9:135805130-135805152 CCTCGCTGCGCCTGGAAGGCAGG + Intergenic
1200100986 X:153688975-153688997 CGCCGCTGCCGCTCGGTGGCCGG + Intronic