ID: 963253058

View in Genome Browser
Species Human (GRCh38)
Location 3:143119916-143119938
Sequence TACCGGGGGCGGGTTGGGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963253047_963253058 -1 Left 963253047 3:143119894-143119916 CCTCGTTGGCCAGAAGCGCTGGT 0: 1
1: 0
2: 0
3: 6
4: 78
Right 963253058 3:143119916-143119938 TACCGGGGGCGGGTTGGGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 91
963253052_963253058 -10 Left 963253052 3:143119903-143119925 CCAGAAGCGCTGGTACCGGGGGC 0: 1
1: 0
2: 0
3: 0
4: 64
Right 963253058 3:143119916-143119938 TACCGGGGGCGGGTTGGGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963253058 Original CRISPR TACCGGGGGCGGGTTGGGTC GGG Exonic
901109905 1:6785802-6785824 CCCCGGGGGCGGGCTGGGGCCGG + Intronic
902335526 1:15752194-15752216 TCTCGGGGGTGGGTTGGGGCAGG + Intergenic
902384648 1:16069487-16069509 CACTGGGGGCCGGTGGGGTCGGG - Intronic
903012892 1:20343464-20343486 CACCGGGGGCGGGTGGGGAAGGG - Intronic
903545947 1:24123469-24123491 TGCCTGGGCCCGGTTGGGTCTGG + Intronic
904799415 1:33082072-33082094 TGCTGGGGGCGGGTTGTGACGGG + Intronic
906688577 1:47778183-47778205 TACAGATGGTGGGTTGGGTCGGG - Intronic
907512243 1:54970430-54970452 AACCGGGGGCGGGGAGGGGCAGG - Intergenic
915734135 1:158074115-158074137 TCCTGGGGGAGGGGTGGGTCAGG - Intronic
1066278178 10:33889051-33889073 TAGCGGGGGGCGGTGGGGTCGGG - Intergenic
1075748613 10:124744696-124744718 GACAGCGGGCGGGTGGGGTCGGG + Intronic
1076678025 10:132158088-132158110 TGCCGGGGGCGGGGCGGGGCGGG - Intronic
1077063313 11:627021-627043 CACTGGGGGCGGGTGGGGCCCGG + Intronic
1086104837 11:83136145-83136167 TACTGGGGGCTGGGTGGGTTAGG - Intergenic
1089892327 11:121894029-121894051 TACCTGGGGGTGTTTGGGTCAGG + Intergenic
1092218390 12:6697670-6697692 CACGGGGGGCGGGCTGGGGCTGG + Exonic
1101256705 12:102984829-102984851 TGCCTGGGCAGGGTTGGGTCGGG + Intergenic
1101870573 12:108562433-108562455 TCTCGGGGGCGGGCGGGGTCGGG - Intergenic
1105022699 12:132828190-132828212 TACCGGGCGGTGGTTGGGTGGGG - Intronic
1108575463 13:51786591-51786613 TTGCGGGGGCGGGTGGGGCCTGG - Intronic
1117029220 14:51651823-51651845 TCGGGGGGGCGGGTCGGGTCGGG + Intronic
1118292682 14:64540670-64540692 TCCCGGGAGCGGATTGGGTCTGG + Intronic
1120127682 14:80765325-80765347 TTCTGGGGGAGGGTTGGGGCTGG + Intronic
1125523003 15:40358481-40358503 TACCTGGGGCGGGGAGGGTCTGG - Intronic
1128907792 15:71483743-71483765 TGTCGGGGGAGGGTGGGGTCGGG - Intronic
1129190367 15:73933942-73933964 CACAGGGTGAGGGTTGGGTCTGG + Intronic
1129645850 15:77431794-77431816 TACCAGGGGTGGGGTGGGGCTGG - Intronic
1134084286 16:11345854-11345876 GAACGGGGGCGGGGCGGGTCTGG + Intronic
1135837029 16:25835749-25835771 TGCCGGGGGCTGATTGGGTTTGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1150218577 17:63483569-63483591 TACTGGGGGTGGGTGGGGTGGGG - Intergenic
1150592856 17:66578549-66578571 TACCTGGGGCTGGTTTGGTTTGG + Intronic
1160734190 19:654359-654381 CACCGGGGGCGCGGTGGCTCAGG + Intronic
1160829924 19:1099043-1099065 TACATGGGGCGGGGAGGGTCAGG + Intergenic
1161306698 19:3572895-3572917 TGCCGGGGGCGGGGAGGGGCGGG + Intronic
1165770025 19:38374655-38374677 TACCCGGGGCGGGCTGAGGCAGG + Exonic
1166250756 19:41569506-41569528 TGCGGGGGGCGGGTTGGGGAAGG + Intronic
1167074262 19:47239532-47239554 GACCGGGGCCGGGTGGGGGCTGG + Intergenic
928724182 2:34151696-34151718 TACCGGGGGTGGGGTGGTTGGGG + Intergenic
930716095 2:54595539-54595561 GAGCTGGGGCGGGCTGGGTCTGG - Intronic
931858231 2:66326604-66326626 TACCAGGGGCTGGTGGGGTGAGG + Intergenic
932480469 2:72036115-72036137 TGCAGGGGGTGGGTTGGGTCAGG + Intergenic
933295829 2:80490272-80490294 TACCGGGGGGGGGGTGGGGGGGG - Intronic
940901454 2:159130036-159130058 TACCGGGGGCGGCGGGGGACTGG + Intronic
948268613 2:236656912-236656934 TCCTGTGGGAGGGTTGGGTCAGG + Intergenic
948717109 2:239872068-239872090 TCCTGTGGGAGGGTTGGGTCAGG - Intergenic
1171499968 20:25585630-25585652 GAGAGGGGGCGGGTCGGGTCCGG + Intergenic
1173449266 20:43148101-43148123 TACCCTGGGCTGGTTGGGTGGGG + Intronic
1173708589 20:45135314-45135336 TACCTGGGTGGGGTTGGGCCTGG + Intergenic
1174555650 20:51393683-51393705 TGCCCGGGGCAGGTGGGGTCGGG + Intronic
1174561242 20:51432242-51432264 GACCGGGGGCGGGCCAGGTCTGG + Exonic
1176278193 20:64286405-64286427 TGCCGGGCGGGGGTTGGGTTGGG - Intronic
1176380716 21:6111058-6111080 TACGGGGGGCGGGCCGGGGCGGG + Intergenic
1178104120 21:29299237-29299259 TACCCGGGGCGGGCGGGGGCTGG + Intronic
1179742756 21:43427182-43427204 TACGGGGGGCGGGCCGGGGCGGG - Intergenic
1181289255 22:21778363-21778385 AACGGGGGGCGGGGGGGGTCCGG + Intronic
1185080161 22:48705237-48705259 TGCCGGGGGTGGGGTGGGGCAGG + Intronic
1185317726 22:50186105-50186127 GGCCGGGGGCGGGGGGGGTCAGG + Intronic
1185370044 22:50456723-50456745 TACCTGGGGCTGGCTGGGCCCGG + Intronic
952899425 3:38099766-38099788 GACCGGGGGCGGGGTGGGGGTGG + Intronic
961319653 3:126063940-126063962 CCCCGGGGGGGGGTTGGATCTGG - Intronic
961827573 3:129606866-129606888 TCCCGGGGGCGGGCGGGGCCGGG - Intergenic
963253058 3:143119916-143119938 TACCGGGGGCGGGTTGGGTCGGG + Exonic
966854773 3:184186394-184186416 TCCCGGGGGCTGGTTGGGTCTGG + Intronic
966875751 3:184320703-184320725 TACCTGGGGAGGGGTGGGTGTGG - Exonic
966918594 3:184598066-184598088 TGCCTGGGGCGGTTGGGGTCAGG + Intronic
967627496 3:191703190-191703212 TACCGGGGGTGGGTTAGGATGGG - Intergenic
968737276 4:2303952-2303974 CACCAGGGGCGGGATGGGCCGGG + Intronic
976136200 4:81938583-81938605 TTGGGGGGGCGGGGTGGGTCTGG - Intronic
984646731 4:182228060-182228082 AACCAGGAGCGGGTTGGGGCAGG + Intronic
984901462 4:184590438-184590460 TTCCGTGGGCTGGTTGGGCCTGG - Intergenic
992795899 5:80255295-80255317 TACCGAGCCAGGGTTGGGTCGGG + Intronic
997521608 5:134527155-134527177 TGCCGGGGGCGGGGCGGGGCCGG - Intronic
1001649931 5:173309102-173309124 TACCTGGGGTGGGTTGGGGGGGG - Intergenic
1003046508 6:2737968-2737990 TGCCGGGGGCGGGTGGGGGGGGG + Intronic
1004421794 6:15477172-15477194 TACCGGGGGCATGTTGTGTAAGG + Intronic
1004517970 6:16336746-16336768 TTCCTGGGGGTGGTTGGGTCAGG + Intronic
1005303700 6:24494730-24494752 TCCCGGGGGAGGGTTGGGTTCGG - Intronic
1009016946 6:57916318-57916340 TACCCGGGGTGGGTGGGGTGGGG + Intergenic
1017436634 6:154421724-154421746 TACCAGGGGAGGGTTGGGGGCGG - Intronic
1019711346 7:2519552-2519574 TACCCGGGGCGGGGGGGGTGCGG + Intronic
1020144815 7:5634302-5634324 TTCTGGGGGTGGGTTGGGGCTGG + Intronic
1020418023 7:7968765-7968787 TGCCGGGGGCGGGGTGCGGCTGG + Intronic
1023287148 7:38631541-38631563 GAGCGGGGGCGGGATGCGTCGGG + Exonic
1031421163 7:121553152-121553174 TGGCGGGGGCGGGTGGGGTGGGG - Intergenic
1031597922 7:123669272-123669294 TATAGGGGGCGGGTTGGGGGAGG + Intergenic
1039874992 8:41577991-41578013 TGCCGGGGGCGGGGCGGGGCAGG - Intronic
1054905697 9:70412562-70412584 TCCCGGGGGCGGGGCGGGACAGG + Intronic
1057694341 9:97312681-97312703 AACCGGGGGTGGGTTGGGGTGGG - Intronic
1062426952 9:136510519-136510541 TGGCCGGGGAGGGTTGGGTCAGG - Intronic
1062615452 9:137394027-137394049 TGCCGGGGACGGGCTGGGGCGGG - Intronic
1186493441 X:9992995-9993017 TCCCGGGGGCCGGTTGTGTGCGG - Intergenic
1189636412 X:43015277-43015299 TGTGGGGGGCGGGTAGGGTCGGG - Intergenic
1190691160 X:52914540-52914562 TGCCAGGGGCTGGTTGGGGCAGG - Intergenic
1190694823 X:52941252-52941274 TGCCAGGGGCTGGTTGGGGCAGG + Intronic
1193605902 X:83567414-83567436 ACCCGGGGGAGGGATGGGTCAGG + Intergenic
1197742608 X:129906650-129906672 TTCCGGGGGCGGGGTGGGGGGGG - Intronic