ID: 963254501

View in Genome Browser
Species Human (GRCh38)
Location 3:143131299-143131321
Sequence CCTTAAGTAATGCAGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963254499_963254501 -7 Left 963254499 3:143131283-143131305 CCATTCACTTACTTAGCCTTAAG No data
Right 963254501 3:143131299-143131321 CCTTAAGTAATGCAGATAAATGG No data
963254498_963254501 18 Left 963254498 3:143131258-143131280 CCATGCTTGTTGGATATAAATAA No data
Right 963254501 3:143131299-143131321 CCTTAAGTAATGCAGATAAATGG No data
963254497_963254501 21 Left 963254497 3:143131255-143131277 CCACCATGCTTGTTGGATATAAA No data
Right 963254501 3:143131299-143131321 CCTTAAGTAATGCAGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963254501 Original CRISPR CCTTAAGTAATGCAGATAAA TGG Intergenic
No off target data available for this crispr