ID: 963255679

View in Genome Browser
Species Human (GRCh38)
Location 3:143142484-143142506
Sequence CGGCGTTCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963255679_963255686 19 Left 963255679 3:143142484-143142506 CCATCCACCACTGCTGAACGCCG No data
Right 963255686 3:143142526-143142548 GACTTCCACCCCTCCGGATCCGG 0: 31
1: 87
2: 117
3: 65
4: 76
963255679_963255688 24 Left 963255679 3:143142484-143142506 CCATCCACCACTGCTGAACGCCG No data
Right 963255688 3:143142531-143142553 CCACCCCTCCGGATCCGGCAAGG 0: 14
1: 74
2: 165
3: 149
4: 153
963255679_963255684 13 Left 963255679 3:143142484-143142506 CCATCCACCACTGCTGAACGCCG No data
Right 963255684 3:143142520-143142542 GCCGCTGACTTCCACCCCTCCGG 0: 21
1: 71
2: 115
3: 97
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963255679 Original CRISPR CGGCGTTCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr