ID: 963262511

View in Genome Browser
Species Human (GRCh38)
Location 3:143207123-143207145
Sequence CATAACCAGCACCACGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963262511_963262514 19 Left 963262511 3:143207123-143207145 CCTATGCCGTGGTGCTGGTTATG No data
Right 963262514 3:143207165-143207187 CACATTTCAATTCTCTGAACTGG No data
963262511_963262516 24 Left 963262511 3:143207123-143207145 CCTATGCCGTGGTGCTGGTTATG No data
Right 963262516 3:143207170-143207192 TTCAATTCTCTGAACTGGGTTGG No data
963262511_963262515 20 Left 963262511 3:143207123-143207145 CCTATGCCGTGGTGCTGGTTATG No data
Right 963262515 3:143207166-143207188 ACATTTCAATTCTCTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963262511 Original CRISPR CATAACCAGCACCACGGCAT AGG (reversed) Intergenic
No off target data available for this crispr