ID: 963269912

View in Genome Browser
Species Human (GRCh38)
Location 3:143276198-143276220
Sequence CTCTAACAGTAGTAACTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963269912_963269913 6 Left 963269912 3:143276198-143276220 CCATCTAGTTACTACTGTTAGAG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 963269913 3:143276227-143276249 ATAGCCCAACTCCAGTTCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963269912 Original CRISPR CTCTAACAGTAGTAACTAGA TGG (reversed) Intronic
912227814 1:107755319-107755341 CTCCAACAGTAGAAACTTGAAGG + Intronic
920852427 1:209637401-209637423 CTCCAAAAGAAGTATCTAGAAGG + Intronic
922478953 1:225925218-225925240 TTCTATCAGTAGTAAATATAAGG + Intergenic
1066498070 10:35961792-35961814 CTTTAACAGTAGAAACTACGTGG + Intergenic
1070369834 10:75771721-75771743 CTCAAAAAGTAGGAACTGGAAGG - Intronic
1072444389 10:95485790-95485812 CTCTATTTGTAGTCACTAGATGG + Intronic
1072629760 10:97137464-97137486 CTCTAACAGTAGAAAATATGGGG - Intronic
1073888893 10:108073884-108073906 ATATAACAGTAGAAACTAGGAGG - Intergenic
1078771384 11:14355848-14355870 GTTTAGCAGTAGTAACTGGAGGG - Intronic
1078795513 11:14588351-14588373 CTCTAACAGGAGTAGGTGGAGGG + Intronic
1082906786 11:58316580-58316602 CTCTAGAACTGGTAACTAGAGGG - Intergenic
1084139770 11:67218356-67218378 CTCTAAGCGTAGTATCTAGCAGG - Intronic
1086803850 11:91214324-91214346 CTCTAACAATAGTTAAAAGAAGG - Intergenic
1091022878 11:132116562-132116584 CCCTCATAGTAGTAACTATAGGG + Intronic
1105203453 13:18199211-18199233 CTCAAAAAGTAGTAACTATGAGG - Intergenic
1107388921 13:39942929-39942951 TTCTGACAGCAGTCACTAGAGGG + Intergenic
1107939993 13:45374928-45374950 CTCTGACAGAAGTAACAAGAAGG - Intergenic
1109825761 13:67719400-67719422 CTCTAGGAGTAAGAACTAGAAGG + Intergenic
1110118123 13:71845644-71845666 CTCTGACAGTATTAACGAGATGG + Intronic
1111509793 13:89246183-89246205 ATCCAACTGTAGTAACTACAGGG + Intergenic
1113320822 13:109230344-109230366 CTCAAACTGAGGTAACTAGATGG + Intergenic
1114614682 14:24062131-24062153 CCCTCACAGTAGCAACTAGCAGG + Intronic
1114979576 14:28146183-28146205 CACTACCAGCAGTAACTGGAAGG + Intergenic
1118039872 14:61904997-61905019 CTGTAACAGAAGCAATTAGATGG - Intergenic
1118425824 14:65660520-65660542 ATCTAAGAGTAGAAACTAAAGGG - Intronic
1120784494 14:88519981-88520003 CTCTACCAGAAGTACCTAGAGGG + Intronic
1124052607 15:26211879-26211901 CTCTTCCAGTAGAAACTATAGGG + Intergenic
1124397430 15:29315977-29315999 ATCTAAGAGTAGTTACTATAGGG + Intronic
1125856588 15:42955879-42955901 CTCTTACAGAAGTAACTAATAGG + Intronic
1126317059 15:47381554-47381576 CTGTAACAGGAGTGACTTGAGGG + Intronic
1126723905 15:51611635-51611657 CTATCACAGTACTAACTAGGTGG + Intronic
1131664404 15:94555229-94555251 CTCTAAGAGTAGTGAGTAAAGGG + Intergenic
1133587648 16:7211493-7211515 CTCTATCACTAGTAAATACAGGG + Intronic
1136919517 16:34252199-34252221 CTCTATTTGTAGTAACTGGAAGG + Intergenic
1147924676 17:43939021-43939043 CTCTCACAGCAGAAACTACAGGG - Intergenic
1148673817 17:49433253-49433275 CTCAGACAGAAGTGACTAGAGGG + Intronic
1155483229 18:26312414-26312436 CTGTAACCATGGTAACTAGAGGG + Intronic
1158247537 18:55448693-55448715 CTACAACTGTAGTAACTACACGG - Intronic
1163164273 19:15484557-15484579 CTGTAACAGTAGTAGCGAGCGGG - Intronic
1164094672 19:21996516-21996538 CTCTGACTTTAGTAACTAAAAGG + Intronic
1165025021 19:32954294-32954316 CTCTAAAAACAGAAACTAGAAGG - Intronic
929239166 2:39636009-39636031 TTCTAACAGTAGTAAGTTGTGGG + Intergenic
935826993 2:106962084-106962106 CTCTACCAGTTGTAACCAGCAGG - Intergenic
946926661 2:224633239-224633261 CACAAACAGGAGTAACTATATGG - Intergenic
1170213789 20:13871470-13871492 TTCTTACTGTAGTCACTAGAGGG - Intronic
1176714521 21:10338866-10338888 CTCAAAAAGTAGTAACTATGAGG + Intergenic
1177244528 21:18505647-18505669 CTAGAACAGTAGTTACCAGAGGG - Intergenic
1179026164 21:37680502-37680524 CTCTCACGGAAGTATCTAGAAGG - Intronic
949508910 3:4751643-4751665 CTCTAACAGAAGTTAATAAAGGG - Intronic
954891226 3:53930947-53930969 TGTTAACAGTAGAAACTAGAGGG - Intergenic
961616123 3:128182624-128182646 CTCGAACAGTAGTGTCTGGAAGG + Intronic
963269912 3:143276198-143276220 CTCTAACAGTAGTAACTAGATGG - Intronic
963423493 3:145093083-145093105 CTCTAACCTTCATAACTAGAAGG - Intergenic
964468245 3:157022560-157022582 CACTAACTTGAGTAACTAGATGG + Intronic
964513783 3:157483030-157483052 CTATAACAGTAATAACTATGTGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
978318481 4:107466426-107466448 CAGTAACAGTAATAACCAGATGG + Intergenic
979231891 4:118355646-118355668 TTCTTACAGTTGTAACAAGATGG - Intergenic
980968961 4:139551485-139551507 CTCCCTCAGAAGTAACTAGAGGG - Intronic
983454417 4:167944830-167944852 CTCTTACAGTAGTATCTATTTGG + Intergenic
985569340 5:636042-636064 CTCTAACAGTATTAAGCGGAGGG - Intronic
988834370 5:35016820-35016842 CTCTTACAGTAGTACAGAGATGG + Intronic
994526404 5:100910956-100910978 CTCTAAGAGTAACAATTAGATGG + Intergenic
995153919 5:108886765-108886787 CTCTAACAATAATAACTCCATGG - Intronic
996343546 5:122465201-122465223 CTCTAACAGTAGCAACTCACAGG - Intergenic
998250690 5:140550178-140550200 CTGTAACAGTAGTATCTCAAGGG + Exonic
999723325 5:154415189-154415211 ATCTAAAAGTAGTTACTACAAGG - Intronic
1005146486 6:22696686-22696708 TACTCACAGTAGTAACCAGATGG - Intergenic
1007086846 6:39154284-39154306 CTCTAAGAGTGGGATCTAGAAGG + Intergenic
1008434495 6:51459235-51459257 CTGTAACATTACTACCTAGAAGG - Intergenic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1009327456 6:62370534-62370556 CTCTAACAAAAGGATCTAGATGG + Intergenic
1012022933 6:93948661-93948683 CTCTAACAGTATAAAATAGATGG - Intergenic
1012127269 6:95446044-95446066 ATATAAAAGTATTAACTAGATGG - Intergenic
1013159286 6:107525891-107525913 CTCCAACAGGAGTAACAGGACGG - Intronic
1013553216 6:111230688-111230710 CTCTTTCAGTAATAACTACAGGG - Intronic
1017404045 6:154097227-154097249 CTTTAATAATAGTAATTAGAGGG - Intronic
1024580193 7:50794423-50794445 CTCTAACAGTAACACCTAGAGGG - Intergenic
1026893320 7:73995876-73995898 CCCAAACAGAAGGAACTAGAAGG + Intergenic
1027970429 7:85073624-85073646 TGCAAACAGTAGTAACTATATGG - Intronic
1028499763 7:91506719-91506741 ATCTAAAAGTAGTAAATAGGAGG + Intergenic
1028788967 7:94831617-94831639 ATCTGACAGTAGGAACTAGTTGG - Intergenic
1031479646 7:122262875-122262897 CTCTAACACTAGGACCTAGGAGG - Intergenic
1037467354 8:19173094-19173116 TTTTAACAGAAGTAACTTGATGG - Intergenic
1040620527 8:49086817-49086839 TTCTAACAGCAATAACTACATGG - Intergenic
1041310804 8:56514530-56514552 CTCTAAAAGTAGAAACCAGGGGG + Intergenic
1043237711 8:77889681-77889703 ATCTAAGAGTAGAAATTAGATGG - Intergenic
1043809833 8:84724436-84724458 CTCTAACATAACTAAGTAGATGG - Intronic
1045859021 8:106794978-106795000 CTCTAACAGTAGAGACCAGGAGG + Intergenic
1049967520 9:792736-792758 CTTTAACAGTACTGACTGGAAGG - Intergenic
1051585461 9:18722303-18722325 CTCAAAAAGAAGTATCTAGAAGG - Intronic
1052585545 9:30423764-30423786 CTCTAAAAGCAGTAACTGGTTGG + Intergenic
1052774234 9:32717817-32717839 CTCTAACCATAGCAACGAGACGG - Intergenic
1053190820 9:36066150-36066172 TTCTAACACTGGTATCTAGATGG + Intronic
1056882429 9:90408811-90408833 CACGACCAGTGGTAACTAGAGGG + Intergenic
1193919903 X:87412325-87412347 GTCCAACAGTATTTACTAGATGG - Intergenic
1199473485 X:148220759-148220781 CTGCAACAGTAGGAGCTAGAAGG - Intergenic