ID: 963271166

View in Genome Browser
Species Human (GRCh38)
Location 3:143287080-143287102
Sequence AAGTGGGACCAGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 1, 2: 7, 3: 59, 4: 555}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963271166_963271173 7 Left 963271166 3:143287080-143287102 CCTCCTTCCTTCTGGTCCCACTT 0: 1
1: 1
2: 7
3: 59
4: 555
Right 963271173 3:143287110-143287132 TGTGTGTGTGTGTGTGGAGCGGG 0: 7
1: 192
2: 1527
3: 5639
4: 16122
963271166_963271175 25 Left 963271166 3:143287080-143287102 CCTCCTTCCTTCTGGTCCCACTT 0: 1
1: 1
2: 7
3: 59
4: 555
Right 963271175 3:143287128-143287150 GCGGGGTGCAGAATAACTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 76
963271166_963271172 6 Left 963271166 3:143287080-143287102 CCTCCTTCCTTCTGGTCCCACTT 0: 1
1: 1
2: 7
3: 59
4: 555
Right 963271172 3:143287109-143287131 GTGTGTGTGTGTGTGTGGAGCGG 0: 75
1: 919
2: 4109
3: 10738
4: 14412
963271166_963271171 1 Left 963271166 3:143287080-143287102 CCTCCTTCCTTCTGGTCCCACTT 0: 1
1: 1
2: 7
3: 59
4: 555
Right 963271171 3:143287104-143287126 TGTGTGTGTGTGTGTGTGTGTGG 0: 3779
1: 5173
2: 8013
3: 13571
4: 22268
963271166_963271174 8 Left 963271166 3:143287080-143287102 CCTCCTTCCTTCTGGTCCCACTT 0: 1
1: 1
2: 7
3: 59
4: 555
Right 963271174 3:143287111-143287133 GTGTGTGTGTGTGTGGAGCGGGG 0: 1
1: 62
2: 839
3: 3605
4: 10180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963271166 Original CRISPR AAGTGGGACCAGAAGGAAGG AGG (reversed) Intronic
900181993 1:1315252-1315274 ATTTGGGCCCAGAACGAAGGGGG + Intronic
900242445 1:1623516-1623538 AAGTGGGGCCAGCAGGACGGCGG + Exonic
900397527 1:2459305-2459327 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397532 1:2459321-2459343 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397579 1:2459481-2459503 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397584 1:2459497-2459519 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397589 1:2459513-2459535 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397594 1:2459529-2459551 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397599 1:2459545-2459567 AAGGAGGACCACCAGGAAGGAGG - Intronic
901470097 1:9450097-9450119 AGATGGGGCCAGAAGGCAGGGGG + Intergenic
901798009 1:11691697-11691719 GAGCGGGACTGGAAGGAAGGGGG - Intergenic
902161241 1:14532088-14532110 AAGTGGTGCAAGAAGGAAGGTGG + Intergenic
902270293 1:15299541-15299563 AGGTGGGACAGGAAGGCAGGTGG + Intronic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902987913 1:20166601-20166623 GAGAGGGACGAGAAAGAAGGTGG - Intronic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903758795 1:25683619-25683641 AGCTGGGACCTGAAGGAAGATGG + Intronic
903956868 1:27031864-27031886 AAGTGGGGAGAGACGGAAGGAGG - Intergenic
904600245 1:31668928-31668950 GAGTGGGAACAGAAGGCAGTGGG - Intronic
905323138 1:37131797-37131819 AAGTGGGGAAGGAAGGAAGGGGG - Intergenic
905374701 1:37512071-37512093 AAGTGGGAAAAAAAGGTAGGGGG + Intronic
906350952 1:45058807-45058829 AAGTAGGAGGAGAAGGAAGTGGG + Intronic
906607550 1:47182509-47182531 AAGTGGGGCCAGAAGGTAGGAGG - Intergenic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
907736481 1:57117818-57117840 AACTAGGACCAGAAGGGAAGTGG - Intronic
907798608 1:57742375-57742397 ATGTGGGATCAAAAGGATGGGGG + Intronic
907824220 1:57999916-57999938 AAGAAGGAAAAGAAGGAAGGAGG + Intronic
908670770 1:66544982-66545004 ATGTAGGACAGGAAGGAAGGAGG - Intronic
909033877 1:70574554-70574576 AAGTGGTAAAAGGAGGAAGGAGG - Intergenic
909154892 1:72061639-72061661 AGCTGGAACAAGAAGGAAGGGGG + Intronic
909474393 1:76065672-76065694 ATGTGGGACCAGAAAGAGGCGGG + Intergenic
910283421 1:85526867-85526889 AAGTGAGAAGAGAAGGAGGGAGG + Intronic
911032168 1:93500684-93500706 TAGTGGTCCCAGAAGGAAGGGGG + Intronic
912412533 1:109488629-109488651 AGGTGGGAACAGTGGGAAGGAGG + Intronic
913244057 1:116856048-116856070 AATTGGGACCAGCTGGCAGGAGG - Intergenic
913661754 1:121010930-121010952 AAGTGGGACCAGCAGGAGCCTGG - Intergenic
914013127 1:143794110-143794132 AAGTGGGACCAGCAGGAGCCTGG - Intergenic
914164699 1:145167075-145167097 AAGTGGGACCAGCAGGAGCCTGG + Intergenic
914196783 1:145451877-145451899 AAGTGGGAGGAGGAGGGAGGGGG + Intergenic
914206594 1:145536121-145536143 AAGTGAGAAGAGAAGGAGGGAGG - Intergenic
914651751 1:149702719-149702741 AAGTGGGACCAGCAGGAGCCTGG - Exonic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915490386 1:156247228-156247250 AGGTGGGACAAGGAGGTAGGGGG + Intronic
915529164 1:156493556-156493578 AGGGGGGCCCAGAAGGAAGGGGG + Intronic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
917422221 1:174876008-174876030 AAGAGCGAGCACAAGGAAGGAGG - Intronic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918610773 1:186488316-186488338 AAATGGGATGAGAAGGTAGGAGG - Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
919491039 1:198205040-198205062 AAGTAGGAGAAGAAGGAAGGGGG - Intronic
920349490 1:205328541-205328563 AAGTGTGCCCAGGAGGGAGGTGG + Intergenic
920601872 1:207333924-207333946 AAGTGAGACAAAAAGGAAGAGGG + Intronic
920739322 1:208565220-208565242 AAGTTTGACTAGAAGGAGGGGGG + Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921396849 1:214677782-214677804 AAGGGGGAGGAGAAGGGAGGAGG - Intergenic
922229759 1:223675473-223675495 TAGTGGGAGCAAGAGGAAGGAGG + Intergenic
922251842 1:223856495-223856517 GAGTGGGAGCAGAAGGGAGGCGG + Intergenic
922345965 1:224696592-224696614 AAGTGGGACCTGGAGGAGGCTGG + Intronic
922452151 1:225746049-225746071 ACCTGGGACCAGAAGCCAGGAGG - Intergenic
922598445 1:226832086-226832108 AAGTTGGGACAGAAGGAAGATGG + Intergenic
923344821 1:233041520-233041542 AAGTGGGTCCTGTAGGGAGGAGG - Intronic
923372775 1:233328836-233328858 AAGTGGGGCCAGAGGGAGGTGGG + Intronic
924267178 1:242294647-242294669 AAGTGGGAACAGATTGAAAGAGG - Intronic
924931193 1:248733696-248733718 AAGCGAGACCAGAAGGTAGGAGG - Intronic
1063938079 10:11099560-11099582 AAGTGGAAACAGAAGGAAATCGG - Intronic
1064026120 10:11850133-11850155 GTGTGGGACCAGAAGGGAAGTGG + Intronic
1064165087 10:12978955-12978977 ATTTGGGAACAAAAGGAAGGCGG - Intronic
1064285801 10:13990343-13990365 ATGTGGGACAAGGAGGGAGGAGG + Intronic
1065104276 10:22365542-22365564 AAGTGGTACCAGATAGGAGGGGG - Intronic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1066717530 10:38302467-38302489 AAGTGGGAACAGATTGAAAGAGG + Intergenic
1066717639 10:38303859-38303881 AAGTGGGAACAGATTGAAAGAGG + Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067549926 10:47227082-47227104 AAGTGGGACCTGATGGAGTGGGG - Intergenic
1069556007 10:69399080-69399102 AAGGGGGACCAGGAGGAGTGGGG - Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069993528 10:72329105-72329127 AAGTGGGGCCAGAATGGAGCTGG - Intergenic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1072955169 10:99881742-99881764 AAGTGGGACACGAAGGACAGAGG - Intronic
1073116563 10:101094808-101094830 AAGTGGGCACAGGTGGAAGGAGG - Intronic
1073399485 10:103245091-103245113 AAGAGGCACCAGTTGGAAGGTGG - Intergenic
1074157679 10:110812568-110812590 ACGAGCGACCAGAAGGAGGGAGG + Exonic
1074613677 10:115044794-115044816 AAGAGTGACCAGAATTAAGGGGG + Intergenic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1076853560 10:133104607-133104629 AAGGGGGCCCAGAGGGCAGGGGG - Intronic
1077347693 11:2071684-2071706 AGGTGGGAGCAGGAGGGAGGAGG - Intergenic
1078866423 11:15302279-15302301 AAGTGGGAACTTAAGGAAAGAGG + Intergenic
1078877793 11:15415461-15415483 TAGTGGGAGGAGAAGGGAGGAGG + Intergenic
1079410279 11:20181094-20181116 AAGAGGGAGGAGGAGGAAGGAGG - Intergenic
1080655682 11:34256304-34256326 ACCAGGGACCAGAAGGGAGGGGG - Intronic
1080666385 11:34339929-34339951 AGCTGGAACCAGCAGGAAGGAGG + Intronic
1081507629 11:43734628-43734650 GGGTGGGGGCAGAAGGAAGGCGG - Intronic
1081526614 11:43932022-43932044 AAGTGGGCCCATAAGGATGACGG + Intronic
1081690310 11:45073622-45073644 TAGCTGGACCAGAAGGAAGCTGG + Intergenic
1081701405 11:45155085-45155107 GAGTGGGCCCAGCAGGCAGGAGG + Intronic
1082073538 11:47958755-47958777 AAGTGGGACCAAGAGGAGGATGG - Intergenic
1083198928 11:61107902-61107924 AACTGGGGCCAGAAGGAGGGAGG - Intronic
1083570938 11:63762171-63762193 AGGGAGGACCTGAAGGAAGGAGG - Exonic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1083707851 11:64529111-64529133 GAGTTGGACCAGAAGGACGCTGG + Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085390761 11:76180975-76180997 GAGTGGGAGCAGCAGGCAGGAGG - Intergenic
1085752890 11:79177609-79177631 GAGTGGGATAAGGAGGAAGGAGG + Intronic
1086056116 11:82649065-82649087 AAGAAGGAGCAGAAGAAAGGAGG - Intergenic
1088542196 11:110924753-110924775 GATTGGGAGCAGAAGCAAGGTGG - Intergenic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089386998 11:118074946-118074968 AAATGGGAGCAGAAGCCAGGAGG + Intergenic
1089489773 11:118875234-118875256 AAGAGGGAACGAAAGGAAGGAGG + Intergenic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1089643126 11:119860634-119860656 AAGATTGACCAAAAGGAAGGAGG - Intergenic
1089757388 11:120696648-120696670 AAGGGGGACCTGGAGGAAGCTGG + Intronic
1090381666 11:126331815-126331837 AAGTGGGACCAGAAGGCCTGGGG + Intronic
1090900535 11:131026959-131026981 AAGTGGGAACTGAAGAAAGCTGG + Intergenic
1091074196 11:132599426-132599448 AAGGTGGAGGAGAAGGAAGGAGG + Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092708726 12:11311484-11311506 AAGAAGAACCAGAAAGAAGGTGG - Intergenic
1093021970 12:14212364-14212386 GAGTGGGAACAGTAGGAAAGGGG + Intergenic
1093945229 12:25100201-25100223 AAGTTGGAAAGGAAGGAAGGAGG + Intronic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095399328 12:41796310-41796332 AAATGAAACCAGAAGGCAGGAGG + Intergenic
1096615948 12:52833763-52833785 AGGTGGGCCAAGCAGGAAGGAGG - Exonic
1096616948 12:52838653-52838675 AGGAGGAACAAGAAGGAAGGGGG + Intronic
1096751432 12:53761344-53761366 AAGTGGGACCCCAAGGAGGCTGG - Intergenic
1097223370 12:57462882-57462904 GAGGGGCACGAGAAGGAAGGGGG + Intronic
1098164641 12:67681498-67681520 AAGTGGGAGAAGTAGGGAGGGGG + Intergenic
1098275242 12:68806002-68806024 AAGTCGGTCCAGAAGGCAGCCGG + Intergenic
1098340812 12:69449202-69449224 AAGTGTCTCCAGAAGAAAGGAGG + Intergenic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1099186850 12:79524378-79524400 AAATGGGACCAGAATTGAGGAGG + Intergenic
1100406449 12:94276463-94276485 AGGTGGAACCAGAAGGAGGGAGG + Intronic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100915888 12:99421512-99421534 ATGAGGGACCACAAAGAAGGGGG + Intronic
1101054164 12:100895047-100895069 AACATTGACCAGAAGGAAGGTGG - Intronic
1101093640 12:101313726-101313748 GAGTGGGACAGGAAGGAGGGAGG + Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1102230370 12:111257646-111257668 AAGAGGGAGGAGGAGGAAGGAGG - Intronic
1102381143 12:112467884-112467906 AGGTGGGGCCTAAAGGAAGGTGG - Intronic
1102769605 12:115463835-115463857 AAGTTGGAACAGCTGGAAGGAGG + Intergenic
1103238949 12:119397864-119397886 AAGTGGGGCAGGGAGGAAGGGGG + Intronic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1105979273 13:25501862-25501884 GAGTAGGACTAGAAGAAAGGAGG + Intronic
1107333019 13:39321816-39321838 GAGTGGGCCCAGAGGGAATGAGG - Intergenic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107572226 13:41674702-41674724 TAGTGGGACAATAATGAAGGAGG + Intronic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1110227854 13:73138782-73138804 AATCGGAACCAGGAGGAAGGAGG - Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1113322182 13:109244754-109244776 AAGCGGGAACAGAAGGGAGCAGG - Intergenic
1113814419 13:113161539-113161561 AACTGGGCACAGAAGGAAGCGGG + Intronic
1114460269 14:22882210-22882232 AAGGAGGACAAGAAGGAAAGGGG + Intergenic
1114731759 14:25000503-25000525 GAATGGGACCAGAAGACAGGAGG - Intronic
1114904492 14:27109331-27109353 AAGAGGAACCTGAAGGGAGGTGG + Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115434489 14:33357684-33357706 AATTGGGACCAGAATGCAGAAGG - Intronic
1116397844 14:44468335-44468357 GAGTGGGGCCAGAAGGCATGGGG - Intergenic
1116637636 14:47417692-47417714 AATTGGTACCAGAAGGAGTGAGG - Intronic
1117617281 14:57546431-57546453 AGGGGGGACCAGAAGGGAGGAGG + Intergenic
1118055770 14:62078069-62078091 AAGGGGGAGAAGACGGAAGGTGG - Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1119511521 14:75215402-75215424 AGGTGGGACCTGAAAGAAGTGGG + Intergenic
1119728298 14:76935591-76935613 AAGTGGGAAGGGAAGGGAGGGGG - Intergenic
1119889431 14:78172003-78172025 AAGCGGGAACCGAAGGAAGCGGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121028183 14:90632202-90632224 AAGTTAGACCACAAGGAAAGAGG - Intronic
1121377747 14:93430225-93430247 AAGTTGGGGCTGAAGGAAGGAGG - Intronic
1121473221 14:94173404-94173426 GAATGGGACGAGATGGAAGGGGG - Intronic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122373262 14:101241202-101241224 GAGTGGGACCTGCAGGAAGCGGG - Intergenic
1123902674 15:24892372-24892394 AAGTGGCAAGAGTAGGAAGGAGG + Intronic
1124021980 15:25933618-25933640 AAGTGTTACCTGAAGGACGGTGG + Intergenic
1124052213 15:26207961-26207983 AAGTGAGCCCATAGGGAAGGAGG + Intergenic
1124717154 15:32074016-32074038 AAATGGGAACAGGAAGAAGGAGG - Intronic
1124937571 15:34186862-34186884 AGGGAGGACCTGAAGGAAGGGGG + Intronic
1126314470 15:47355174-47355196 AAGTTGGGGCAGAAGGAAAGGGG + Intronic
1126466310 15:48964314-48964336 AAGTCGCACCAGACGGAAGATGG - Intergenic
1126802694 15:52314320-52314342 GGCTGGGACCAGAAGGAAGGAGG + Intronic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1126872304 15:53002611-53002633 AAGTGGTACCAGAAGGAGAGTGG - Intergenic
1127054104 15:55114060-55114082 CCATGGGCCCAGAAGGAAGGGGG + Intergenic
1127602859 15:60555694-60555716 AGGTGGGAAGAAAAGGAAGGTGG + Intronic
1128095856 15:64954995-64955017 AAGTGGAAGAAGAAGGAAAGAGG - Intronic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1129285980 15:74525383-74525405 AAGTTGCACCATCAGGAAGGAGG + Intergenic
1129320097 15:74769953-74769975 AAGTGAAAGCAGAAGCAAGGGGG - Intergenic
1129590168 15:76907698-76907720 AAGTATTTCCAGAAGGAAGGAGG - Intergenic
1129661748 15:77556609-77556631 AACTGGGCCCAGGTGGAAGGTGG - Intergenic
1129825804 15:78634411-78634433 TAGTCGGACCAGAAGGAAGGAGG - Intronic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1129933060 15:79428291-79428313 AAGGGAGAGAAGAAGGAAGGAGG - Intergenic
1130127412 15:81105350-81105372 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1130220507 15:82015392-82015414 CAGTGGGACCAGCCTGAAGGAGG - Intergenic
1132068950 15:98758584-98758606 AGGTGAAACCAGAGGGAAGGGGG - Intronic
1132295642 15:100732336-100732358 AAGGGGGCCCAGAAAGAAAGAGG - Intergenic
1132875415 16:2135007-2135029 AGGTGGGTCCAGAAGAAGGGGGG - Intronic
1133297172 16:4760243-4760265 AAGTAGGACCAGCATGTAGGGGG + Intronic
1133641451 16:7721208-7721230 AAGTGAGACTAGAAATAAGGTGG - Intergenic
1134519569 16:14912353-14912375 AGGTGGGTCCAGAAGAAGGGGGG + Intronic
1134554362 16:15153882-15153904 AGGTGGGTCCAGAAGAAGGGGGG - Intergenic
1134707241 16:16311009-16311031 AGGTGGGTCCAGAAGAAGGGGGG + Intergenic
1134960300 16:18401116-18401138 AGGTGGGTCCAGAAGAAGGGGGG - Intergenic
1135046274 16:19158530-19158552 AAAAGGGAGGAGAAGGAAGGGGG + Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135888452 16:26335237-26335259 AATTGAATCCAGAAGGAAGGAGG - Intergenic
1135922475 16:26663564-26663586 AAGGGGAACTGGAAGGAAGGAGG + Intergenic
1136065154 16:27753746-27753768 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1136247384 16:28983813-28983835 AACTCGGACAAGAAGGAGGGGGG - Exonic
1136496766 16:30649967-30649989 AAGTGGGGCCCGCAGGATGGGGG - Intergenic
1136538269 16:30913290-30913312 AACTGTGAGCTGAAGGAAGGAGG + Intergenic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1137003170 16:35249628-35249650 AGGTGGGGCCTGATGGAAGGTGG - Intergenic
1137218715 16:46426725-46426747 AAGTGAGAAAAGAAGGAAAGAGG - Intergenic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137613617 16:49834857-49834879 AAGTGGGTCAAGGAGGAAGGAGG + Intronic
1137962623 16:52898179-52898201 AAGAGGTACCAGAAGGGAAGTGG - Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138541598 16:57691039-57691061 AAGAAGGAAGAGAAGGAAGGAGG + Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139480509 16:67227943-67227965 AAGTGGGCATAGAAGCAAGGAGG - Intronic
1139946366 16:70645075-70645097 AAGAGGGAAGAGTAGGAAGGAGG + Intronic
1140356919 16:74314410-74314432 AACTGGGAAAAGAAGGATGGAGG - Intergenic
1140504082 16:75459441-75459463 GAGTGGGGCCAGCTGGAAGGAGG - Intronic
1140511517 16:75512243-75512265 AAGTGGGGCCAGCTGGAAGGAGG - Intergenic
1140828603 16:78730316-78730338 AAATGGGAAGAAAAGGAAGGAGG - Intronic
1140997215 16:80272602-80272624 AAGTAGGGAAAGAAGGAAGGAGG + Intergenic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141892579 16:86936406-86936428 ATATGGGACCAGAGGGAGGGAGG + Intergenic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1143707371 17:8708171-8708193 AAGGGAGACCAGAAGGAATTTGG + Intergenic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144837356 17:18163674-18163696 GAGTGGGGCCAGAAGGACAGAGG + Intronic
1145077885 17:19870141-19870163 AAGTGGGGGCAGGAGGCAGGGGG + Intergenic
1145084545 17:19925787-19925809 AAGAGGGACCAGAATAAAGAGGG + Intronic
1145771652 17:27497525-27497547 GAGTGGGACCAGGAGGAAACAGG + Intronic
1145996143 17:29106096-29106118 GAGTGGGACCAGCAGGCACGAGG + Intronic
1146646929 17:34581960-34581982 AAATCAGACCAGAGGGAAGGAGG + Intronic
1146952336 17:36915554-36915576 AAGTGGGTCCAGGAGGAACCTGG + Intergenic
1147421165 17:40322818-40322840 AAGGGGGACCACTAGGAAGGGGG - Intronic
1149367454 17:55960075-55960097 AAGGAGGACGAGAAGGAATGAGG - Intergenic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1150244582 17:63664818-63664840 AAGTGGGAAAAAGAGGAAGGAGG - Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1151354209 17:73548873-73548895 AACTGGGGCCAGAAGGAGGCTGG - Intronic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1152780643 17:82226150-82226172 AACTGGGAACAAAAGGAAGTTGG + Intergenic
1153090998 18:1342674-1342696 AAGAGGGAAAATAAGGAAGGAGG - Intergenic
1153181082 18:2434647-2434669 AGGAGGGACCAGAAAGATGGAGG - Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153859390 18:9185669-9185691 AAGTGGCACAAGAATGGAGGAGG + Intronic
1153917407 18:9758276-9758298 GAGTGGGATCAGCAGGATGGGGG + Intronic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1155209095 18:23586001-23586023 ATGTGGCACCAGAAGAAGGGAGG - Intronic
1155400628 18:25435187-25435209 GAGAGGGACCACCAGGAAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155694669 18:28671115-28671137 AGGAGGGAACACAAGGAAGGAGG + Intergenic
1157283403 18:46360721-46360743 AAGGGGGGCCTGCAGGAAGGAGG - Intronic
1158103827 18:53861495-53861517 AAGGGAGGGCAGAAGGAAGGAGG + Intergenic
1158493317 18:57929871-57929893 AAGTGGCACAAGAAGGTGGGTGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1160753811 19:747605-747627 AATTAGCACCAGGAGGAAGGAGG - Exonic
1161899797 19:7109922-7109944 AACTGGGAGCAGAAAGGAGGAGG + Intergenic
1162133798 19:8543434-8543456 AATTGGGATCAGAAGGTGGGGGG + Intronic
1162228262 19:9242915-9242937 AAGAAAGACAAGAAGGAAGGAGG - Intergenic
1162743468 19:12786347-12786369 CAGTGGGGCCAGCAGGGAGGGGG + Intronic
1163786759 19:19278822-19278844 AAGAGGGAGAAGCAGGAAGGAGG + Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165527935 19:36371961-36371983 AAGGGAGATAAGAAGGAAGGAGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1165944403 19:39433058-39433080 GAGTGGAAGCAGAAGGCAGGGGG - Intergenic
1167145071 19:47676495-47676517 AAGAGGGAGAAGGAGGAAGGAGG - Intronic
1167739520 19:51316037-51316059 AGGTGGGACCAACAGAAAGGAGG + Intronic
1168056069 19:53866111-53866133 GAGGGGGACCTGCAGGAAGGCGG - Intergenic
926068926 2:9868676-9868698 AAGTGGATCCAGAAAGAAGGAGG + Intronic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
926643846 2:15266742-15266764 AAGTAGGTAGAGAAGGAAGGAGG - Intronic
926688179 2:15714581-15714603 ACGTGGGATCAGCAGGAATGAGG + Intronic
926987843 2:18643445-18643467 AAGAGGGAGAAGAAGGAAGCAGG + Intergenic
927259901 2:21077907-21077929 AAATCAGACCAGAATGAAGGTGG + Intergenic
927294256 2:21435535-21435557 AAGTGTGAGCTGAACGAAGGGGG - Intergenic
927319733 2:21729215-21729237 AAGATGGACTAGAAGGAAGAAGG - Intergenic
927686421 2:25174484-25174506 AAGGAAGACAAGAAGGAAGGAGG + Intergenic
927836802 2:26405508-26405530 ATGTGGCACCTGAAGGTAGGTGG + Intronic
928160921 2:28923819-28923841 AAGTGGGACCCAAAGGTAGCTGG + Intronic
929005224 2:37387214-37387236 AGGAGGGACCAGAAAGATGGAGG - Intergenic
929287269 2:40149605-40149627 AAGTGTGACAAGATGGAAAGAGG + Intronic
930256575 2:49100294-49100316 AACTGGTACCAAAAAGAAGGTGG + Intronic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930892857 2:56411406-56411428 AAGTTGGAGCAGAAGGAAATAGG + Intergenic
931264853 2:60651686-60651708 AGGTGGGACCATAAGAAAGAAGG + Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932218634 2:69983465-69983487 GGGAGGGACCAGAAGGCAGGAGG + Intergenic
932365989 2:71153946-71153968 CAGTTGGACCGAAAGGAAGGGGG - Intergenic
932368213 2:71166619-71166641 AACTGGGCCTAGAGGGAAGGGGG - Intergenic
932730668 2:74219830-74219852 AAGTGGGATGAGAAGGAAGGTGG + Intronic
933382478 2:81567008-81567030 AAGTAGGAAGAGAAAGAAGGAGG - Intergenic
933994266 2:87656274-87656296 AAGAGGGACCCGAAGTAAAGAGG - Intergenic
934046788 2:88179093-88179115 AACTGTGAGGAGAAGGAAGGTGG + Intronic
934331830 2:92075394-92075416 AAGTGAGAAAAGAAGGAAAGAGG + Intergenic
934658765 2:96132110-96132132 AAGTGGGACCCCAAGGTAGCAGG - Intronic
934708266 2:96499671-96499693 AAGAGGGGCCTGAAGGAAGGTGG - Intronic
935296671 2:101655988-101656010 AAGTGGGGCCAGGGGGAGGGGGG - Intergenic
935379359 2:102435306-102435328 AAGTGGAAACAGAAAGAAGGTGG + Intronic
936299596 2:111294639-111294661 AAGAGGGACCCGAAGTAAAGAGG + Intergenic
936855527 2:116953245-116953267 TGGTGGGACCAGAAGGAAGGAGG + Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937479209 2:122241579-122241601 AAGGGTGAGAAGAAGGAAGGAGG + Intergenic
939152128 2:138485511-138485533 AAGTGGGAGCTGAGAGAAGGAGG + Intergenic
941158595 2:162008983-162009005 AAGAGGGAAGGGAAGGAAGGAGG - Intronic
942360637 2:175168237-175168259 GAGGGGCGCCAGAAGGAAGGTGG - Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
943642719 2:190376574-190376596 AAGTGGGGACAGAAGGAATTAGG + Intergenic
943708293 2:191059892-191059914 AAGTGGTATAAAAAGGAAGGTGG - Intronic
944522503 2:200586374-200586396 AAAGGGGAACATAAGGAAGGTGG - Intronic
944915950 2:204360357-204360379 AGGCAGGACCAGAAGGTAGGAGG + Intergenic
946027759 2:216682175-216682197 AAGTGGCACCAGAAACCAGGAGG - Intronic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
947016544 2:225626967-225626989 AAGTTGGACAACAAGGAAAGAGG + Exonic
947360823 2:229343634-229343656 GAGTGGGGCAAGAATGAAGGTGG + Intergenic
947556590 2:231098868-231098890 AAGAGGTACCACAAGGAAGGGGG - Intronic
948189607 2:236047431-236047453 AGGTGGCACGAGAAGGAAGAGGG - Intronic
948248733 2:236507779-236507801 AAATGGGGCCAGCAGGAAAGCGG - Intergenic
948377413 2:237530591-237530613 AAGTGGGCCCTCAAGGAAGTTGG - Intronic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
949061272 2:241959182-241959204 AAATAGGACCAGAAGGAAGATGG + Intergenic
1168886524 20:1263234-1263256 ATCTGGGACCAGGAGGTAGGAGG + Intronic
1169934831 20:10872095-10872117 AAGTGGGAGCTCTAGGAAGGAGG - Intergenic
1169978515 20:11357573-11357595 AGCTGAGACCAGCAGGAAGGGGG - Intergenic
1170281242 20:14651382-14651404 ATAGGGGACCAGAAGAAAGGAGG + Intronic
1170669359 20:18416349-18416371 AGGTGGGACCGGAAGGAAGCTGG - Intronic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1171174704 20:23042913-23042935 AAGTGACTCCAGAAGGTAGGAGG + Intergenic
1171221384 20:23401072-23401094 AAGAGGGAGCTGAAGGAAGCAGG + Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173302720 20:41818122-41818144 AAATGGGACCCCATGGAAGGTGG - Intergenic
1173438873 20:43057389-43057411 AAGGAGGAAAAGAAGGAAGGAGG + Intronic
1174067159 20:47873821-47873843 AAGTGGAACCAGCAGGGATGAGG + Intergenic
1174157101 20:48522732-48522754 AAGTGGAACCAGCAGGAATGAGG - Intergenic
1174422322 20:50407475-50407497 TAGTGGGACCACATGGAATGGGG - Intergenic
1174547174 20:51334303-51334325 AGGAGGGAAGAGAAGGAAGGAGG + Intergenic
1175306813 20:57981854-57981876 AGGGAGGACCAGAAAGAAGGGGG + Intergenic
1175647256 20:60685133-60685155 ACCTGGGACCAGCAGGGAGGGGG - Intergenic
1175948905 20:62571951-62571973 AAGTGGGGCCTGTGGGAAGGCGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1178141600 21:29690229-29690251 AAGTGAGACCAGCAGGGAGTTGG - Intronic
1178671178 21:34592922-34592944 ATGTGGGAACTGAAGGAAAGAGG + Intronic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179150601 21:38805731-38805753 AAGCGGGAGGAGAGGGAAGGGGG - Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179782052 21:43707641-43707663 AGGTGGGACCTGATGGGAGGTGG + Intergenic
1180157677 21:45986035-45986057 AAGTGGGAGCAGCAGGAAGGAGG - Intronic
1180790273 22:18572057-18572079 AAAGGGGCTCAGAAGGAAGGGGG - Intergenic
1180859403 22:19068706-19068728 ATGGGGGACCAGCAGGCAGGGGG - Intronic
1181172153 22:21015796-21015818 AAGTGGGGCCAGAGAGGAGGTGG + Intronic
1181231465 22:21423258-21423280 AAAGGGGCTCAGAAGGAAGGGGG + Intronic
1181247186 22:21511610-21511632 AAAGGGGCTCAGAAGGAAGGGGG - Intergenic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1182016664 22:27046084-27046106 GAGTGGCCTCAGAAGGAAGGAGG - Intergenic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1183001378 22:34862411-34862433 GAGTGAGACCACAAGGAAGGTGG - Intergenic
1183807345 22:40222364-40222386 TACTAGGACCAGAAGAAAGGAGG + Intronic
1184250484 22:43257503-43257525 AATAGGGACCAGGAGGAAGGAGG + Intronic
1184449740 22:44575869-44575891 AAGAGGAACAAGAAGGGAGGAGG + Intergenic
1184661365 22:45967070-45967092 GAGTGGGAAGACAAGGAAGGGGG + Intronic
1184892102 22:47386349-47386371 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184892332 22:47387607-47387629 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184924999 22:47630510-47630532 AGGTGAGACCAGAAGGCAGAGGG - Intergenic
1185021631 22:48380015-48380037 AGGAGGTACCAGAAGGAGGGTGG + Intergenic
949930109 3:9071713-9071735 AGGTAGGAAGAGAAGGAAGGAGG + Intronic
950954348 3:17035559-17035581 AAGTGGGAACAGGAAGCAGGTGG - Intronic
950978650 3:17277793-17277815 AAGTGGGAACAGGAGCCAGGGGG + Intronic
951358713 3:21700250-21700272 TATAGGGACCAGAAGGAAGTGGG + Intronic
951651590 3:24956883-24956905 AAGCTGGACCAGAGAGAAGGAGG + Intergenic
951701731 3:25503733-25503755 AAGTTGAAACAGAAGGAAGCAGG + Intronic
951851581 3:27147147-27147169 AAATGGGACTAGAACCAAGGGGG + Intronic
953233215 3:41083062-41083084 AAGTGGTACAAGGAGGAATGAGG + Intergenic
953918394 3:46935346-46935368 AGGTGGGAGGAGAAGGGAGGAGG - Intronic
954223771 3:49170142-49170164 AAGTGGGACAAGGAGGATTGAGG + Intergenic
954280436 3:49573360-49573382 AAGATGGACCAGAAAGATGGAGG + Intronic
954367368 3:50153834-50153856 AAGTGGGAGGAGGAAGAAGGCGG + Intergenic
954413519 3:50381623-50381645 AACTGGGGCCAGAAGCAAGCAGG + Intronic
955545960 3:60030507-60030529 AAATGGGAAGAAAAGGAAGGAGG - Intronic
956327632 3:68071075-68071097 AATTGGGACCAGGAGAATGGGGG - Intronic
956805512 3:72806750-72806772 AATTGGGACTTGAAGGATGGAGG - Intronic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
957416934 3:79917461-79917483 AAGAGGGAAGAGAAGGAGGGAGG + Intergenic
957845559 3:85729612-85729634 AAATGCCACAAGAAGGAAGGAGG + Intronic
958794840 3:98695813-98695835 AAGTGGGAGTAGAAGGGAGCTGG - Intergenic
959607016 3:108252001-108252023 AAGTGGTATAGGAAGGAAGGTGG - Intergenic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962403391 3:135080317-135080339 AAGTAGGGCCAGAGAGAAGGGGG + Intronic
962452849 3:135535288-135535310 AGGTGGGACAAGAGGGAAAGAGG + Intergenic
962678493 3:137774239-137774261 AAGTGAGACCAGGAAGAAGCAGG - Intergenic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963323608 3:143836610-143836632 GAGAGGGGACAGAAGGAAGGAGG + Intronic
963411014 3:144927834-144927856 AAGTGTGACCAGCATAAAGGAGG - Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963741896 3:149089169-149089191 AAGTGGCACTAAAAGGACGGTGG + Intergenic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964570398 3:158103651-158103673 AAGCCGGGCCAGAAGGCAGGAGG + Intronic
964592484 3:158379838-158379860 AAATGGGACAAGAGGGAGGGAGG - Intronic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965286804 3:166828054-166828076 AAGTGGGACCAGGTGTGAGGAGG + Intergenic
965353596 3:167646215-167646237 GAGTTGCACCAGAAGGAAGAAGG + Intronic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
966571258 3:181446093-181446115 ATGTGGTTCCAGAAGGAAAGTGG + Intergenic
967267250 3:187701649-187701671 GAGTTGGAACTGAAGGAAGGAGG - Intronic
967899512 3:194435295-194435317 AACTGGGGCCTGAAGGAAAGCGG - Intronic
969488269 4:7484639-7484661 AACTGGGATCAGAACGGAGGAGG - Intronic
969938402 4:10706051-10706073 AAGAGGAACCAGAAACAAGGTGG + Intergenic
970244439 4:14044741-14044763 AATTAGGACCAGAAGAAAGGAGG - Intergenic
970688090 4:18590796-18590818 AAGATGGACCAGAATGAATGCGG + Intergenic
971014287 4:22471219-22471241 AAGTGGGAACATAAGGTAGTTGG - Intronic
972452250 4:39213573-39213595 AGCTGGGGTCAGAAGGAAGGAGG + Intronic
976423289 4:84870701-84870723 AAGTGAGACCAGAAGGCAAAGGG - Intronic
977177069 4:93830232-93830254 AAGGGGGAGCAGAAGGTGGGCGG - Exonic
977749054 4:100586790-100586812 AAGTTGGAGCCCAAGGAAGGGGG + Intronic
978127109 4:105147495-105147517 AAGGGGGATAAGAAGGTAGGAGG - Intronic
978313902 4:107414925-107414947 AAGAGGTACCACAAGGAGGGGGG + Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978400971 4:108330355-108330377 GAGTGGGAAGAGCAGGAAGGAGG - Intergenic
981729781 4:147885140-147885162 AAGTGGGGGCATAAGGATGGGGG + Intronic
982778513 4:159466291-159466313 AAGGGGGAAAGGAAGGAAGGTGG - Intergenic
984856438 4:184199840-184199862 GAGTGGGAGCAGACGGAAAGTGG - Intronic
986136794 5:4987503-4987525 AAGGGAGATGAGAAGGAAGGAGG + Intergenic
986518767 5:8591687-8591709 AAATGAGACCAGAAAGAAAGAGG - Intergenic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987552668 5:19404251-19404273 AAGTGACACCAGTAGGAATGTGG + Intergenic
987689080 5:21244120-21244142 AGGTGGGGCCTGATGGAAGGTGG + Intergenic
988182851 5:27819686-27819708 ATGTGGGACAGGAAGGAAAGAGG + Intergenic
989507634 5:42245902-42245924 AAGTGAGACTACAAGGCAGGGGG - Intergenic
989615651 5:43334805-43334827 AAGAGGTACCACAAGGAGGGGGG - Intergenic
990435213 5:55783606-55783628 AAGACAGACCAAAAGGAAGGAGG + Intronic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991174710 5:63673717-63673739 GAGTGAGACCAGAAAGGAGGAGG + Intergenic
993372099 5:87105520-87105542 AAGTGGAACCACAGTGAAGGTGG + Intergenic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
994052468 5:95378432-95378454 AAGTGGTGCCAAAAAGAAGGGGG + Intergenic
994213115 5:97108207-97108229 AACTGTTACTAGAAGGAAGGTGG - Intronic
994459587 5:100054922-100054944 AGATGCGAGCAGAAGGAAGGAGG + Intergenic
995114691 5:108466636-108466658 AAGTGGGTCCCTTAGGAAGGAGG + Intergenic
996387593 5:122925251-122925273 AAGGGGGAGGGGAAGGAAGGAGG - Intronic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
998997328 5:147879952-147879974 AAGTGGCAGCAGAAAGGAGGTGG + Intronic
999228225 5:150045282-150045304 AAATGTGACCAAAAGGCAGGTGG + Intronic
999248534 5:150167922-150167944 AAGCGGGAGCAGTGGGAAGGGGG + Intronic
999445429 5:151634964-151634986 AAGAAGGAAGAGAAGGAAGGAGG + Intergenic
999966563 5:156816517-156816539 AAGAGGTGACAGAAGGAAGGGGG + Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001415237 5:171540996-171541018 AAGAGGGAGAGGAAGGAAGGAGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1003540267 6:7012515-7012537 CAGTGAGTCCTGAAGGAAGGAGG + Intergenic
1003677750 6:8222427-8222449 ACGAGGGCTCAGAAGGAAGGAGG + Intergenic
1003819532 6:9880739-9880761 AAATGAGATCAGAAGGAAAGAGG + Intronic
1004026339 6:11823006-11823028 AGGTGAGACAAGATGGAAGGAGG - Intergenic
1004193675 6:13486420-13486442 AAGTGGTGCCAGGAGGCAGGAGG + Intronic
1004335129 6:14757464-14757486 AAGGGGGACAAAGAGGAAGGTGG + Intergenic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1006714797 6:36110279-36110301 AACTGGAGCAAGAAGGAAGGAGG + Exonic
1007134460 6:39507901-39507923 AAGAGGGAAAGGAAGGAAGGAGG - Intronic
1007729331 6:43936372-43936394 AAGCGGGAGCAGAAGGCATGGGG - Intergenic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1008278972 6:49573106-49573128 AGGTGGGCCCAGAAGCAATGAGG + Intergenic
1008695265 6:54028701-54028723 AAGATGGACCAGCAGGCAGGAGG - Intronic
1009009794 6:57828499-57828521 AAGTGATACCAGAAGGAAACAGG - Intergenic
1010677945 6:78766636-78766658 AAGAGGGACCTGGTGGAAGGTGG + Intergenic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1011354122 6:86456099-86456121 AATAGGGACCAGACTGAAGGTGG - Intergenic
1012039261 6:94184302-94184324 AAGTGGGACCTGATGGGAGGTGG - Intergenic
1012868754 6:104648287-104648309 AAGTGTGTCCAGATGGAATGTGG + Intergenic
1013542916 6:111129251-111129273 AAGTGGGCAAAGAAGGAAGGGGG + Intronic
1013684732 6:112566098-112566120 AACAGGGACCCCAAGGAAGGAGG - Intergenic
1014408119 6:121077383-121077405 AAGCTGGATCAAAAGGAAGGTGG - Intergenic
1014719455 6:124898344-124898366 AAGTGGGATGGGAAGGAAGGTGG - Intergenic
1016056249 6:139580498-139580520 AACTTGAACCAGAAGGAGGGTGG - Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017591644 6:155984571-155984593 AAGTGGGACAGTTAGGAAGGAGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018038063 6:159898610-159898632 AAGAGGGAGGAGGAGGAAGGAGG - Intergenic
1018469801 6:164085297-164085319 AAGAGGGACAAGAATGAAAGGGG - Intergenic
1019059098 6:169242836-169242858 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059137 6:169242952-169242974 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059177 6:169243075-169243097 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019730592 7:2627430-2627452 AAGAGGGGAAAGAAGGAAGGAGG + Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1020877251 7:13713484-13713506 AAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1020877258 7:13713500-13713522 AAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1020882590 7:13780726-13780748 AAGAAGGACAAGAAGGAAGTGGG + Intergenic
1021243476 7:18233705-18233727 AAGAGGGTCAAGAAAGAAGGAGG - Intronic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1021902152 7:25296762-25296784 AGGTGGGACAAGAAGGAGGCAGG - Intergenic
1022479561 7:30734034-30734056 AAGCATGACCACAAGGAAGGAGG - Intronic
1022628433 7:32062112-32062134 GAGTGGGAACAGAATGAATGGGG - Intronic
1022747935 7:33191460-33191482 AAGTGAAACCAAAAGCAAGGTGG - Intronic
1022769785 7:33456972-33456994 AAGTGGGACAAGGAGTAAGTGGG + Intronic
1023515407 7:40996732-40996754 AATTGGGAGCTGAAGGAAGGTGG - Intergenic
1024944935 7:54799038-54799060 AAGTGAGATGAGGAGGAAGGAGG + Intergenic
1025248498 7:57335976-57335998 TAGTGGGACCACATGGAATGGGG + Intergenic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1027233412 7:76284578-76284600 AGTTGGCATCAGAAGGAAGGGGG - Intronic
1028903613 7:96128571-96128593 ACGGGGGATCAGGAGGAAGGTGG + Intronic
1029174455 7:98654209-98654231 AACTGGTACAAGCAGGAAGGAGG + Intergenic
1029325011 7:99799338-99799360 ATGTGGGGGCAGAAGGTAGGAGG + Intergenic
1029799007 7:102926012-102926034 ATGGGGGACCAGAAAGAAGCAGG + Intronic
1030310479 7:108063994-108064016 AAGTGGGAGGAAAAGGAATGGGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031929876 7:127674149-127674171 AAGTGGGGACGGAAGGAGGGAGG - Intronic
1032191962 7:129770648-129770670 GACCGGGACCAGCAGGAAGGGGG - Intergenic
1032507831 7:132449414-132449436 AAGTGGACTCAGAAGGCAGGAGG + Intronic
1032645473 7:133818973-133818995 AAGTGGGAGGAGAAAGAGGGTGG + Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1032989961 7:137382758-137382780 AAGTAGAACAAGAAAGAAGGTGG + Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1033618761 7:143042715-143042737 AATTGTGAGCAGAAGGAGGGAGG - Intergenic
1033731819 7:144187762-144187784 AAGTGGGACTATCAGGCAGGGGG - Exonic
1033742667 7:144286345-144286367 AAGTGGGACTATCAGGCAGGGGG - Intergenic
1033751234 7:144363269-144363291 AAGTGGGACTATCAGGCAGGGGG + Exonic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035201997 7:157273619-157273641 CAGTGGGACCACCAGAAAGGCGG - Intergenic
1036744928 8:11400061-11400083 AGGTGGCACAAGGAGGAAGGAGG + Intronic
1038574791 8:28695714-28695736 GGCTGGGACCAGAGGGAAGGAGG + Intronic
1038709943 8:29934028-29934050 AAGTGAGACAAGCAGGAAGGAGG - Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039447466 8:37644073-37644095 AAGGGTGAGCAGAAGGCAGGTGG + Intergenic
1041291160 8:56310104-56310126 AAGGAGGAGGAGAAGGAAGGAGG + Intronic
1041324605 8:56651498-56651520 AAGTGGGACCTGATGGGAGGGGG - Intergenic
1041362607 8:57068662-57068684 AAGGGGCACCAGAAGGAACAAGG + Intergenic
1041732951 8:61081246-61081268 AAGAGAGAGCAGAAGGAATGAGG + Intronic
1041793448 8:61721973-61721995 GAGTGGGGACAGGAGGAAGGAGG - Intergenic
1041831537 8:62160691-62160713 AAGTAGGAGGAGGAGGAAGGAGG + Intergenic
1042215047 8:66422922-66422944 AAGGGGGACCAGGAGACAGGAGG - Intergenic
1042605337 8:70540615-70540637 AAGGAGGACTAGAATGAAGGGGG - Intergenic
1042605596 8:70542457-70542479 AAGGGGGACTAGAGTGAAGGGGG - Intergenic
1043861361 8:85320849-85320871 AATAGGGACGAGAATGAAGGGGG + Intergenic
1045551935 8:103180616-103180638 AACAGGGACCAGAAGGATGTAGG + Intronic
1046326354 8:112652315-112652337 AATTGAAACCTGAAGGAAGGGGG - Intronic
1047207155 8:122811700-122811722 AGGGGGGAAGAGAAGGAAGGTGG + Intronic
1047522809 8:125608471-125608493 AAGTGCAACAGGAAGGAAGGGGG + Intergenic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047665968 8:127091432-127091454 AAGTGGACACAGCAGGAAGGTGG + Intergenic
1047994066 8:130316700-130316722 AGGTGAGATCAAAAGGAAGGAGG + Intronic
1048541465 8:135345753-135345775 TCTTGGGACCAGAAGGCAGGAGG - Intergenic
1049501508 8:142970222-142970244 AAGTGGTAACAAAAGGAAGTGGG + Intergenic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049703150 8:144024051-144024073 AAGAGGGTCCTGAGGGAAGGTGG - Intronic
1049703237 8:144024373-144024395 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703244 8:144024389-144024411 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703251 8:144024405-144024427 AATAGGGTCCTGAAGGAAGGGGG - Intronic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1050775684 9:9257224-9257246 AACTCTGAGCAGAAGGAAGGAGG + Intronic
1050846866 9:10232060-10232082 AAGAGGGACCAGACAGGAGGAGG - Intronic
1051447811 9:17159668-17159690 AACTGGGAACAGGAGGAAGAGGG + Intronic
1052404735 9:28045111-28045133 ATGTGGGATCATAAGGATGGGGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1054454022 9:65420404-65420426 AAATGGGATGAGAAGGAAGAAGG + Intergenic
1054788380 9:69231607-69231629 AACGGGGCCAAGAAGGAAGGGGG - Intronic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056779089 9:89535914-89535936 AAGTGGGGCCAAGAGGAAGGGGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1057698850 9:97348566-97348588 TAGTGGGATCAGATGGGAGGTGG + Intronic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058181608 9:101806936-101806958 AAGTGGTACCAGAAGTAGTGTGG + Intergenic
1059072434 9:111152866-111152888 AAGTAGGAAGAGAAAGAAGGAGG + Intergenic
1060547572 9:124470172-124470194 CAGTGGGACCAGCAGGGATGGGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060993532 9:127862417-127862439 AAGTGGGAGAGGAAGGAAGTGGG - Intergenic
1061237531 9:129351479-129351501 AAGGGGGAGGAAAAGGAAGGGGG + Intergenic
1061940558 9:133881554-133881576 AGCTGGGAACACAAGGAAGGGGG + Intronic
1062726451 9:138076655-138076677 ACTTGGGAGCAGAAGGGAGGTGG + Intronic
1203787669 EBV:136814-136836 AAGTGGGATCCGTAGTAAGGAGG - Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1185895406 X:3854160-3854182 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185900523 X:3892584-3892606 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185905639 X:3931015-3931037 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186399333 X:9242240-9242262 AACTGTGACTAGAAGGAATGAGG - Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1188622028 X:32237461-32237483 AAGTGGTGCCAGAAAGATGGTGG - Intronic
1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG + Intergenic
1189712363 X:43826694-43826716 AAGTATGAGCAGAAGGAAAGGGG + Intronic
1189834292 X:45005026-45005048 AAGAGGTACCATAAGGAGGGGGG - Intronic
1189845486 X:45132523-45132545 AAGTGAGAGAAGAAGGGAGGAGG + Intergenic
1190703784 X:53008171-53008193 AAGTGGGACCTGGTGGGAGGTGG - Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1191739542 X:64422397-64422419 AACAGGGCCCAGAAGGAAAGTGG - Intergenic
1192159714 X:68775409-68775431 AAGTGGAACCAGAACCCAGGGGG - Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1192422422 X:71045569-71045591 AGGTGGCACCAGAAGGCAGTTGG - Intergenic
1196277861 X:113789701-113789723 AAATGGGAGGAGAAGAAAGGAGG + Intergenic
1196535760 X:116841598-116841620 AAGTGGGACCAGGAGACAGCGGG - Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1199637467 X:149826914-149826936 AAGAGGTACCACAAGGAGGGTGG + Intergenic
1199868348 X:151874480-151874502 AGAGGGGACCAAAAGGAAGGGGG - Intergenic