ID: 963275969

View in Genome Browser
Species Human (GRCh38)
Location 3:143330045-143330067
Sequence GCATGGGGGAGGTCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963275969_963275976 -6 Left 963275969 3:143330045-143330067 CCTGGCTGTGACCTCCCCCATGC 0: 1
1: 0
2: 4
3: 28
4: 290
Right 963275976 3:143330062-143330084 CCATGCCTGGCTTAGACTCCTGG 0: 1
1: 0
2: 4
3: 32
4: 550
963275969_963275980 10 Left 963275969 3:143330045-143330067 CCTGGCTGTGACCTCCCCCATGC 0: 1
1: 0
2: 4
3: 28
4: 290
Right 963275980 3:143330078-143330100 CTCCTGGTGGAGGAGACAGATGG 0: 1
1: 1
2: 4
3: 51
4: 468
963275969_963275982 15 Left 963275969 3:143330045-143330067 CCTGGCTGTGACCTCCCCCATGC 0: 1
1: 0
2: 4
3: 28
4: 290
Right 963275982 3:143330083-143330105 GGTGGAGGAGACAGATGGTGAGG 0: 1
1: 0
2: 9
3: 83
4: 692
963275969_963275979 0 Left 963275969 3:143330045-143330067 CCTGGCTGTGACCTCCCCCATGC 0: 1
1: 0
2: 4
3: 28
4: 290
Right 963275979 3:143330068-143330090 CTGGCTTAGACTCCTGGTGGAGG 0: 1
1: 0
2: 1
3: 8
4: 149
963275969_963275983 20 Left 963275969 3:143330045-143330067 CCTGGCTGTGACCTCCCCCATGC 0: 1
1: 0
2: 4
3: 28
4: 290
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275969_963275977 -3 Left 963275969 3:143330045-143330067 CCTGGCTGTGACCTCCCCCATGC 0: 1
1: 0
2: 4
3: 28
4: 290
Right 963275977 3:143330065-143330087 TGCCTGGCTTAGACTCCTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963275969 Original CRISPR GCATGGGGGAGGTCACAGCC AGG (reversed) Intronic