ID: 963275971

View in Genome Browser
Species Human (GRCh38)
Location 3:143330056-143330078
Sequence GTCTAAGCCAGGCATGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 762}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963275971_963275982 4 Left 963275971 3:143330056-143330078 CCTCCCCCATGCCTGGCTTAGAC 0: 1
1: 0
2: 2
3: 28
4: 762
Right 963275982 3:143330083-143330105 GGTGGAGGAGACAGATGGTGAGG 0: 1
1: 0
2: 9
3: 83
4: 692
963275971_963275980 -1 Left 963275971 3:143330056-143330078 CCTCCCCCATGCCTGGCTTAGAC 0: 1
1: 0
2: 2
3: 28
4: 762
Right 963275980 3:143330078-143330100 CTCCTGGTGGAGGAGACAGATGG 0: 1
1: 1
2: 4
3: 51
4: 468
963275971_963275983 9 Left 963275971 3:143330056-143330078 CCTCCCCCATGCCTGGCTTAGAC 0: 1
1: 0
2: 2
3: 28
4: 762
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963275971 Original CRISPR GTCTAAGCCAGGCATGGGGG AGG (reversed) Intronic