ID: 963275972

View in Genome Browser
Species Human (GRCh38)
Location 3:143330059-143330081
Sequence GGAGTCTAAGCCAGGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2672
Summary {0: 1, 1: 4, 2: 34, 3: 315, 4: 2318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963275972_963275983 6 Left 963275972 3:143330059-143330081 CCCCCATGCCTGGCTTAGACTCC 0: 1
1: 4
2: 34
3: 315
4: 2318
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275972_963275982 1 Left 963275972 3:143330059-143330081 CCCCCATGCCTGGCTTAGACTCC 0: 1
1: 4
2: 34
3: 315
4: 2318
Right 963275982 3:143330083-143330105 GGTGGAGGAGACAGATGGTGAGG 0: 1
1: 0
2: 9
3: 83
4: 692
963275972_963275980 -4 Left 963275972 3:143330059-143330081 CCCCCATGCCTGGCTTAGACTCC 0: 1
1: 4
2: 34
3: 315
4: 2318
Right 963275980 3:143330078-143330100 CTCCTGGTGGAGGAGACAGATGG 0: 1
1: 1
2: 4
3: 51
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963275972 Original CRISPR GGAGTCTAAGCCAGGCATGG GGG (reversed) Intronic