ID: 963275973

View in Genome Browser
Species Human (GRCh38)
Location 3:143330060-143330082
Sequence AGGAGTCTAAGCCAGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963275973_963275983 5 Left 963275973 3:143330060-143330082 CCCCATGCCTGGCTTAGACTCCT 0: 1
1: 0
2: 0
3: 23
4: 232
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275973_963275980 -5 Left 963275973 3:143330060-143330082 CCCCATGCCTGGCTTAGACTCCT 0: 1
1: 0
2: 0
3: 23
4: 232
Right 963275980 3:143330078-143330100 CTCCTGGTGGAGGAGACAGATGG 0: 1
1: 1
2: 4
3: 51
4: 468
963275973_963275982 0 Left 963275973 3:143330060-143330082 CCCCATGCCTGGCTTAGACTCCT 0: 1
1: 0
2: 0
3: 23
4: 232
Right 963275982 3:143330083-143330105 GGTGGAGGAGACAGATGGTGAGG 0: 1
1: 0
2: 9
3: 83
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963275973 Original CRISPR AGGAGTCTAAGCCAGGCATG GGG (reversed) Intronic