ID: 963275975

View in Genome Browser
Species Human (GRCh38)
Location 3:143330062-143330084
Sequence CCAGGAGTCTAAGCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 716}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963275975_963275982 -2 Left 963275975 3:143330062-143330084 CCATGCCTGGCTTAGACTCCTGG 0: 1
1: 0
2: 5
3: 45
4: 716
Right 963275982 3:143330083-143330105 GGTGGAGGAGACAGATGGTGAGG 0: 1
1: 0
2: 9
3: 83
4: 692
963275975_963275984 30 Left 963275975 3:143330062-143330084 CCATGCCTGGCTTAGACTCCTGG 0: 1
1: 0
2: 5
3: 45
4: 716
Right 963275984 3:143330115-143330137 CTGTGTGACCCGATCACTGCCGG 0: 1
1: 0
2: 0
3: 3
4: 112
963275975_963275980 -7 Left 963275975 3:143330062-143330084 CCATGCCTGGCTTAGACTCCTGG 0: 1
1: 0
2: 5
3: 45
4: 716
Right 963275980 3:143330078-143330100 CTCCTGGTGGAGGAGACAGATGG 0: 1
1: 1
2: 4
3: 51
4: 468
963275975_963275983 3 Left 963275975 3:143330062-143330084 CCATGCCTGGCTTAGACTCCTGG 0: 1
1: 0
2: 5
3: 45
4: 716
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963275975 Original CRISPR CCAGGAGTCTAAGCCAGGCA TGG (reversed) Intronic