ID: 963275983

View in Genome Browser
Species Human (GRCh38)
Location 3:143330088-143330110
Sequence AGGAGACAGATGGTGAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 0, 2: 3, 3: 75, 4: 712}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963275969_963275983 20 Left 963275969 3:143330045-143330067 CCTGGCTGTGACCTCCCCCATGC 0: 1
1: 0
2: 4
3: 28
4: 290
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275975_963275983 3 Left 963275975 3:143330062-143330084 CCATGCCTGGCTTAGACTCCTGG 0: 1
1: 0
2: 5
3: 45
4: 716
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275973_963275983 5 Left 963275973 3:143330060-143330082 CCCCATGCCTGGCTTAGACTCCT 0: 1
1: 0
2: 0
3: 23
4: 232
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275972_963275983 6 Left 963275972 3:143330059-143330081 CCCCCATGCCTGGCTTAGACTCC 0: 1
1: 4
2: 34
3: 315
4: 2318
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275978_963275983 -2 Left 963275978 3:143330067-143330089 CCTGGCTTAGACTCCTGGTGGAG 0: 1
1: 0
2: 0
3: 4
4: 125
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275971_963275983 9 Left 963275971 3:143330056-143330078 CCTCCCCCATGCCTGGCTTAGAC 0: 1
1: 0
2: 2
3: 28
4: 762
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712
963275974_963275983 4 Left 963275974 3:143330061-143330083 CCCATGCCTGGCTTAGACTCCTG 0: 1
1: 0
2: 0
3: 32
4: 521
Right 963275983 3:143330088-143330110 AGGAGACAGATGGTGAGGTGAGG 0: 1
1: 0
2: 3
3: 75
4: 712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963275983 Original CRISPR AGGAGACAGATGGTGAGGTG AGG Intronic