ID: 963278262

View in Genome Browser
Species Human (GRCh38)
Location 3:143354599-143354621
Sequence GTAGGAGCCAAGATATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963278262 Original CRISPR GTAGGAGCCAAGATATTTGC AGG (reversed) Intronic
906184727 1:43853071-43853093 GTATGAGGCAAAATATTGGCAGG - Intronic
906594087 1:47058193-47058215 GTAGAAGCCAAAATATTTAGAGG - Intergenic
909010893 1:70333833-70333855 GTGGGAACCAAGATGTTTGGAGG - Intronic
909762527 1:79309643-79309665 GCAGGAGCCAACACATTTGCTGG - Intergenic
913438894 1:118876440-118876462 GTAGGAGACAAGGAATTTGGCGG + Intergenic
914990612 1:152496730-152496752 ATAGGAGTCAAGATGTTTGGGGG - Intergenic
918899232 1:190391022-190391044 GCAGGAGGCATGAGATTTGCAGG + Intronic
920114474 1:203610264-203610286 CCAGGAGCCAAGATAGATGCAGG + Intergenic
1063845400 10:10122148-10122170 GTAGGATCCCAAATATTTGTAGG - Intergenic
1070519145 10:77236559-77236581 GTAGAAGCCAGCATACTTGCTGG - Intronic
1072306102 10:94108655-94108677 CTAGGAACCAAGATATCAGCAGG - Intronic
1072524636 10:96260616-96260638 GTAAAAGCAAAGATATTTTCAGG + Intronic
1075661929 10:124203384-124203406 GTTGGAACCAAGATGTTGGCTGG - Intergenic
1079357913 11:19745389-19745411 TTAGGAGCCAAGATAGTTTTAGG - Intronic
1079400318 11:20101742-20101764 GCAGGAGCCAATCTATTTGCTGG - Intronic
1079883903 11:25961955-25961977 TTAGGACCCAAGATTTTTGCAGG - Intergenic
1080192548 11:29569499-29569521 GTAGGAGCAGTGACATTTGCTGG + Intergenic
1081193630 11:40134832-40134854 GTGGGAGCCACTAGATTTGCAGG - Intronic
1085387937 11:76167819-76167841 GTGGGAGCCCAGTTATTTACTGG + Intergenic
1086453473 11:86939507-86939529 GTAAGACTCATGATATTTGCAGG - Intronic
1092010228 12:5103962-5103984 TTAGGAGCAAAAATATTTTCTGG + Intergenic
1092086619 12:5768163-5768185 GTAGGAACAAAGATATTTTGGGG - Intronic
1101790921 12:107927059-107927081 GTTGGTGCAAAAATATTTGCAGG - Intergenic
1105877768 13:24574241-24574263 GTAGGAGCTAAGAAAGTTGATGG - Intergenic
1106137917 13:26988316-26988338 ATAGGAGCCAAGATTTTTACTGG - Intergenic
1107750352 13:43558476-43558498 GAAGGAGCCAGGATATTTCTAGG + Intronic
1114652105 14:24291757-24291779 GTAGGACCCAAAGTATTGGCAGG + Intronic
1118467121 14:66041114-66041136 GTAGCAGGCAAAATAATTGCAGG - Intergenic
1119814967 14:77557839-77557861 GTAGCAGCCAAGTTGTTTCCAGG - Intronic
1121400864 14:93675914-93675936 TTAGGAGCACAGATATTTTCTGG - Intronic
1126689596 15:51278995-51279017 GTAGGATGCAAGATCTTTGGAGG + Intronic
1128633887 15:69290713-69290735 CTAGGTGCCAAGAGCTTTGCAGG - Intergenic
1129016201 15:72471371-72471393 AGAAGAGCCAAAATATTTGCTGG - Intergenic
1132492047 16:237385-237407 GTTGCAGCCAAGATGTTGGCTGG + Intronic
1133582527 16:7159765-7159787 GGAGGAGCCCAGTTATTTGATGG - Intronic
1133839037 16:9392257-9392279 GTTGGGCCCAAGATATTTCCTGG - Intergenic
1148691639 17:49530749-49530771 GAAGTAACCAAGATATTTTCAGG - Intergenic
1149273035 17:55003430-55003452 GTAGTAGGCAAGATATTTCTGGG + Intronic
1151237238 17:72729673-72729695 GTAGGTGCCAAGGTTTTTTCAGG - Intronic
1151245992 17:72795126-72795148 GTATGAGCCACCAAATTTGCAGG - Intronic
1153383144 18:4460410-4460432 GTAGGAGCTAAGATAGTGGTAGG - Intergenic
1153504412 18:5780871-5780893 GTAACTGCCAAGATATTAGCAGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161133521 19:2605955-2605977 TTAGGAGCCAATATCTTTGGGGG + Intronic
1164645225 19:29854482-29854504 GCAGGAGGGAAGATATTTTCAGG - Intergenic
1167233409 19:48298918-48298940 GTAGGAGCTCAGATATGGGCAGG - Intronic
1168540454 19:57205493-57205515 GTAGGAGCCAAGATCTGGGCAGG + Intronic
1168545784 19:57248701-57248723 GTAGGAGCCAAGATCTGGGCAGG + Intronic
926820768 2:16849200-16849222 GATGGAGGCAAGATATTTTCTGG - Intergenic
932857619 2:75253711-75253733 CTAGTAGCCAAGGAATTTGCTGG + Intergenic
939112713 2:138027704-138027726 TTAGAAGCCAGGATATTAGCAGG - Intergenic
939591744 2:144072880-144072902 TTAGGAGTCAAGATCTTTGCAGG - Intronic
943495613 2:188617093-188617115 GTATGAGCCAAGATCTTGCCTGG + Intergenic
946518653 2:220441990-220442012 GTAGGAGACAAGAGAATTGGGGG - Intergenic
1177118772 21:17116617-17116639 ATAGGAGCCAAAATATATGAAGG - Intergenic
1177645697 21:23897842-23897864 GTTGAAGCCAAGGTATGTGCCGG - Intergenic
1178479955 21:32971180-32971202 GTCGGGGCCCAGATATATGCGGG - Intergenic
952471905 3:33663714-33663736 GTAGGACTCTACATATTTGCAGG + Intronic
954771433 3:52973323-52973345 ATAGGTGCCTAGATATTTGGAGG + Intronic
954888014 3:53893660-53893682 GTAGGTGCTCAGATATTTGTTGG + Intergenic
962754288 3:138456445-138456467 CTAGGAGCCAAGAAGCTTGCAGG + Intronic
963278262 3:143354599-143354621 GTAGGAGCCAAGATATTTGCAGG - Intronic
972407035 4:38756740-38756762 GCAGGAGCCAGGATATTTCTCGG + Intergenic
973262106 4:48175515-48175537 GTGGGAACCAAGATACTGGCAGG + Intronic
979764952 4:124453435-124453457 GTAAGTTTCAAGATATTTGCAGG + Intergenic
982782150 4:159502344-159502366 GTAGGAGGCAAGATTGGTGCAGG - Intergenic
984875376 4:184363188-184363210 ATAGGAGCCAAGATGTTGCCAGG - Intergenic
997999634 5:138614665-138614687 CCAGGAGCCAAGATTTTTGTGGG - Intronic
998108426 5:139482923-139482945 GTAGGAGCAAAAGTAATTGCAGG + Intronic
998984300 5:147738977-147738999 GTAGGATACAAAATTTTTGCGGG + Intronic
1004181059 6:13380950-13380972 GTAGGAGGGAAGAAATCTGCTGG - Intronic
1004987969 6:21104337-21104359 GAAGGAGCCAGGAATTTTGCAGG + Intronic
1005469405 6:26147243-26147265 ATTGGAGGCAAGCTATTTGCTGG - Intergenic
1005849409 6:29809776-29809798 GAATGAGAGAAGATATTTGCAGG + Intergenic
1010029104 6:71254576-71254598 GCAGGAGGCAAGATATTGTCAGG - Intergenic
1011948995 6:92940828-92940850 GTTGCAGGCAAGATGTTTGCTGG + Intergenic
1012143670 6:95654696-95654718 GTACTAGCCAATATATTTACAGG - Intergenic
1012215811 6:96582100-96582122 GGAAGAGCCAATATAGTTGCTGG - Intronic
1015441266 6:133249701-133249723 GCAGTAGAAAAGATATTTGCAGG - Intronic
1015472601 6:133622644-133622666 TTAGGAGCCAAGCTCTGTGCTGG - Intergenic
1016526157 6:145003862-145003884 GAAGGAGACAAGATATTAGCTGG - Intergenic
1021653482 7:22853681-22853703 TTTGGGGGCAAGATATTTGCGGG + Intergenic
1021725707 7:23546347-23546369 GTATGAGCCAAGGTGTTGGCTGG + Intergenic
1022581564 7:31560322-31560344 GTAAGAGCCAAAATACTTACAGG - Intronic
1025722386 7:64028332-64028354 CTGGGAGTCAAGATATGTGCAGG - Intergenic
1030385180 7:108859462-108859484 GAAGGAAATAAGATATTTGCAGG - Intergenic
1031515575 7:122694136-122694158 GTAGGAGGCAAGGAATTTGGTGG + Intronic
1034036049 7:147823523-147823545 GTAGGAGCCAAGTTTTTTCAGGG - Intronic
1034067828 7:148153744-148153766 GGAGAAGGCAAGATATCTGCTGG + Intronic
1039726155 8:40218833-40218855 GAAGGAGCCGAAATATTTGAGGG - Intergenic
1042178832 8:66064456-66064478 GTAGGAGACAAGATATCAGGCGG + Intronic
1043216137 8:77591455-77591477 GAAGGAGCAAAGATGATTGCAGG + Intergenic
1044149686 8:88759956-88759978 GTAGGGCCCCAGATATTTTCAGG - Intergenic
1046058160 8:109103278-109103300 GAAACAGCCAAGATATTTGAGGG - Intronic
1046502625 8:115097859-115097881 GTACATGCCAAGATATTTGGGGG - Intergenic
1048631358 8:136246542-136246564 GTAGGAGCCAAGATATGAGGAGG + Intergenic
1049809174 8:144555744-144555766 GCAGGAGCCAGGTTATTTCCAGG - Intronic
1053168936 9:35864692-35864714 TTAAAAGCCAAAATATTTGCTGG - Intergenic
1054851768 9:69853849-69853871 GTAGGACCCAAGATGGCTGCTGG + Intronic
1055053465 9:72002149-72002171 CTAGGACCCAGGATATTTTCAGG + Intergenic
1056642924 9:88386709-88386731 GTAGGTGCCAAGAAGTCTGCTGG - Intergenic
1058067699 9:100567370-100567392 GTATGAGCCAGGAAAGTTGCAGG - Intronic
1060131703 9:121106478-121106500 AAAGGAGCAAAGATATGTGCAGG + Intronic
1060262770 9:122091040-122091062 GGAGGTGCCAAGTTCTTTGCTGG - Intronic
1061218981 9:129237960-129237982 CTAGGAGCCAAGCTCTCTGCTGG + Intergenic
1061277999 9:129580603-129580625 GTAAGAGCCAAGATGTCAGCGGG + Intergenic
1185908335 X:3958767-3958789 GTTGGAGCCCAGATATTAGCAGG - Intergenic
1192805876 X:74508824-74508846 GTAGCAGAAAAGATATTTACTGG - Intronic
1196358431 X:114823163-114823185 ATAGGTACCAAGATATTTTCTGG - Intronic
1197931623 X:131702236-131702258 GTAGGAGCTAAAATACTTGTTGG + Intergenic
1198598020 X:138258258-138258280 GCAGCAGCCAAAATATTGGCAGG + Intergenic
1200873050 Y:8124028-8124050 GTAGGACCCTAGTTATCTGCTGG + Intergenic