ID: 963280643

View in Genome Browser
Species Human (GRCh38)
Location 3:143381738-143381760
Sequence TTGGCTAGCTAGCAAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963280643 Original CRISPR TTGGCTAGCTAGCAAGTTGC TGG Intronic
902105372 1:14031374-14031396 TTGGCTAGCTACCCAGATGAAGG + Intergenic
904829529 1:33297940-33297962 TTTCCTAGCTAGGAATTTGCAGG + Intronic
908814285 1:68015618-68015640 ATGCCTAGCTAGTAAGTGGCAGG - Intergenic
913646819 1:120864733-120864755 TTGCATATCTAACAAGTTGCCGG + Intergenic
914174732 1:145266672-145266694 TTGCATATCTAACAAGTTGCCGG - Intergenic
914529459 1:148508156-148508178 TTGCATATCTAACAAGTTGCCGG - Intergenic
914894976 1:151662090-151662112 TTGTCTAGCTAGCTTGTTACAGG + Intronic
919281562 1:195496071-195496093 TTGGTTAGCCAGGATGTTGCTGG + Intergenic
919688120 1:200503391-200503413 TTGGTTAGCTGGCAAGTGGGAGG + Intergenic
1072209983 10:93237681-93237703 CTGGCTAGATAGCAATTTCCAGG - Intergenic
1079464129 11:20712992-20713014 CTGGTTAGCTAGGATGTTGCAGG + Intronic
1079481762 11:20888772-20888794 TTGGCATGCTAGCAGGTGGCAGG + Intronic
1085828925 11:79878574-79878596 CTGGCTAGCCAGCAAGTTAGTGG + Intergenic
1097554347 12:61118408-61118430 TTGGCTAAATAGCCAGTTACTGG + Intergenic
1099103837 12:78477076-78477098 TTGGCTAACTTGAAAGGTGCAGG - Intergenic
1100815730 12:98385412-98385434 ATGGCTAGACACCAAGTTGCAGG - Intergenic
1107333187 13:39323971-39323993 TTGCCCAGCTAGTAAGTGGCAGG + Intergenic
1109681620 13:65758669-65758691 TTGGGCAGCAAGCATGTTGCAGG - Intergenic
1111448920 13:88389328-88389350 TTGGGTAGATAGCAAGTAGTGGG - Intergenic
1116297934 14:43136248-43136270 TGGGCTAGCGAGCGAGTTTCAGG - Intergenic
1116750082 14:48871932-48871954 TAGGCAAGCTAGCAAGTGTCAGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1130012357 15:80161556-80161578 TGGGCTAGCCAGCAAGCTGTAGG - Intronic
1131064335 15:89424122-89424144 TGGGCTAGCGAGCAATTTGCTGG + Intergenic
1131163667 15:90126887-90126909 GTGGCTGGCCAGCAAGTGGCTGG - Intergenic
1140118629 16:72064524-72064546 TTGGCTAACTTGCAAAGTGCAGG - Intronic
1143937622 17:10503578-10503600 TTGGGTTTCTAGCAGGTTGCTGG + Intronic
1147734837 17:42629528-42629550 TTGAGTAGCTAGTAAGTTCCAGG + Intergenic
1148185864 17:45643304-45643326 TTGGATACCCAGGAAGTTGCTGG + Intergenic
1151269686 17:72984567-72984589 TTGCCTTGCTAACAAGTTCCTGG - Intronic
1156278641 18:35610347-35610369 TTGGCTTGTTAGCAAGTGACTGG - Intronic
1158524498 18:58200357-58200379 TTGTCCAGCTAGCACATTGCTGG - Intronic
933193577 2:79364472-79364494 TTTGCTAACTAGCATGTTGTTGG + Intronic
942941621 2:181625334-181625356 TTATCTAGCTAGAAAGTTGGGGG + Intronic
943872410 2:193017335-193017357 TTGGGTAGCTATCAAGTAGTTGG - Intergenic
944853045 2:203740019-203740041 TTGGGTAGCTAGAATGTTGTGGG - Intergenic
1169832557 20:9839738-9839760 CTGGCTAGTAAGCCAGTTGCTGG + Intergenic
1183955293 22:41376546-41376568 TGGGCTAGTTAGCAGGTTTCTGG + Intronic
957392747 3:79598880-79598902 CTGGTTAGCTAGGATGTTGCAGG - Intronic
960513771 3:118580560-118580582 TTGACTTGCTAGGCAGTTGCAGG - Intergenic
963280643 3:143381738-143381760 TTGGCTAGCTAGCAAGTTGCTGG + Intronic
966268755 3:178079995-178080017 TTGGGTGGCTAGAAAGTTGTGGG - Intergenic
967854795 3:194109070-194109092 GGGGCCAGCTAGCTAGTTGCTGG + Intergenic
970171665 4:13296718-13296740 TTACCTAGCAAGCAACTTGCAGG - Intergenic
970607108 4:17691193-17691215 TTGCATAGCTAACAAGTAGCAGG - Intronic
973698636 4:53515252-53515274 TTGGCTAGCTGGTTAGCTGCGGG + Intronic
974384226 4:61184224-61184246 CTGGCTGGCGAGCAAGTTGGTGG - Intergenic
979277556 4:118830399-118830421 TTGCCTAGCTTCCAAGTAGCTGG - Intronic
983776175 4:171609966-171609988 CTGGCTAGCCAGGATGTTGCAGG - Intergenic
991591548 5:68256890-68256912 TTGGTTACCTGGCAAGTGGCGGG + Intronic
993365996 5:87035048-87035070 CTGGTTAGCTAGTATGTTGCAGG + Intergenic
993567532 5:89493261-89493283 TTGACTTGCTACCAAGTGGCTGG - Intergenic
995190892 5:109318331-109318353 TTGGCTGGCTAGGAACCTGCAGG - Intergenic
995837558 5:116413579-116413601 TGGGCTGGCTATCAAGTGGCTGG + Intergenic
1000237594 5:159376862-159376884 CTGGTTAGCCAGCATGTTGCAGG - Intergenic
1005259419 6:24042360-24042382 CTGGTTAGCTAGGATGTTGCAGG + Intergenic
1010949353 6:82016764-82016786 TTGGCTAGCTAGATAGTTTTGGG - Intergenic
1012900742 6:105003382-105003404 TTGGCTAGGTAGAAAGTTTGGGG + Intronic
1017448754 6:154533837-154533859 TTGTGTAGCTAGTAAGTGGCAGG + Intergenic
1021276320 7:18656068-18656090 TTTGGTAGCTTGCAAGTTCCTGG + Intronic
1031237407 7:119194845-119194867 TTGGCCAGCCAGAAAGTTACTGG + Intergenic
1032933896 7:136706833-136706855 TTAGCTAGCTAGCTGGTAGCAGG - Intergenic
1032933899 7:136706844-136706866 CTAGCTAGCTAACAAGGTGCTGG + Intergenic
1033462717 7:141562184-141562206 TTGGTTAGCCAGGATGTTGCAGG + Intronic
1039679915 8:39721891-39721913 TTGGGTAGCTAGCAAGTAGTAGG - Intronic
1042466674 8:69136189-69136211 CTGGTTAGCTAGGATGTTGCAGG + Intergenic
1047285917 8:123487097-123487119 TTGACTGGCTTGCATGTTGCTGG + Intergenic
1051525261 9:18035961-18035983 TTGGCTAGATAGCAAGATAGGGG - Intergenic
1051615011 9:18998830-18998852 TTGGCTGGATATGAAGTTGCAGG - Intronic
1052522539 9:29567076-29567098 TTAGCTAGCTAGAATGTTCCAGG - Intergenic
1057530980 9:95846419-95846441 TTGCACAGCTAGCAAGTGGCAGG + Intergenic
1193340521 X:80343846-80343868 ATGGGTAAATAGCAAGTTGCTGG + Intronic
1194307161 X:92261117-92261139 TTGGCAAGCAGGCAAGTAGCTGG - Intronic
1196026491 X:111046600-111046622 TTACATAGGTAGCAAGTTGCTGG - Intronic