ID: 963281632

View in Genome Browser
Species Human (GRCh38)
Location 3:143390139-143390161
Sequence AAATGGCATATGGGCAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963281632_963281638 5 Left 963281632 3:143390139-143390161 CCAAGGTTGCCCATATGCCATTT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 963281638 3:143390167-143390189 TCTCCTAGACATTATGGAGGTGG 0: 1
1: 0
2: 1
3: 4
4: 120
963281632_963281636 -1 Left 963281632 3:143390139-143390161 CCAAGGTTGCCCATATGCCATTT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 963281636 3:143390161-143390183 TACTTTTCTCCTAGACATTATGG 0: 1
1: 0
2: 3
3: 16
4: 224
963281632_963281637 2 Left 963281632 3:143390139-143390161 CCAAGGTTGCCCATATGCCATTT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 963281637 3:143390164-143390186 TTTTCTCCTAGACATTATGGAGG 0: 1
1: 0
2: 3
3: 17
4: 201
963281632_963281639 6 Left 963281632 3:143390139-143390161 CCAAGGTTGCCCATATGCCATTT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 963281639 3:143390168-143390190 CTCCTAGACATTATGGAGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 93
963281632_963281642 30 Left 963281632 3:143390139-143390161 CCAAGGTTGCCCATATGCCATTT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 963281642 3:143390192-143390214 TGGATTTCATGAAACTCTATTGG 0: 1
1: 0
2: 2
3: 14
4: 172
963281632_963281641 10 Left 963281632 3:143390139-143390161 CCAAGGTTGCCCATATGCCATTT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 963281641 3:143390172-143390194 TAGACATTATGGAGGTGGGATGG 0: 1
1: 0
2: 1
3: 39
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963281632 Original CRISPR AAATGGCATATGGGCAACCT TGG (reversed) Intronic
900856007 1:5184753-5184775 AAAAGGCTTAAGGGAAACCTCGG + Intergenic
904004936 1:27358658-27358680 AAGTGGCATAGGGCCAGCCTGGG - Intronic
907427063 1:54386514-54386536 ATACGGGATATGAGCAACCTTGG - Intronic
911404799 1:97423212-97423234 AATGGGCATATGGGCAGCATAGG - Intronic
912902770 1:113670211-113670233 AAATGGTATATGGCCAAGCCAGG - Intronic
923906870 1:238394744-238394766 AAATAGTTTATTGGCAACCTTGG + Intergenic
1063287184 10:4703150-4703172 AATTGGCATTTGGGCAACAAAGG - Intergenic
1065991963 10:31019387-31019409 AAATAACATATTTGCAACCTTGG + Intronic
1067858507 10:49819582-49819604 AAATGGCATATGCTCAGACTTGG + Intronic
1068636766 10:59356665-59356687 ACATGGCACATGGGCGACCTTGG - Intronic
1068840105 10:61602900-61602922 GAATGGCATTTGGGGAACCCAGG + Intergenic
1070340411 10:75493413-75493435 AAATGGCATATGGGAAGCCGAGG + Intronic
1073899172 10:108199387-108199409 AAATGTCATCTGGGCACTCTGGG - Intergenic
1075253733 10:120907389-120907411 AAATGGCACTTGAGCAACATTGG + Intronic
1079640489 11:22798894-22798916 AAATGGCATATGCTCAAAATTGG - Intronic
1080754603 11:35184552-35184574 TAAGGGCATATAGCCAACCTGGG - Intronic
1087011571 11:93519129-93519151 CAAGGGCATATGTGCACCCTGGG - Intronic
1088198844 11:107307516-107307538 AAAAGGCATATGGCAAAACTTGG - Intergenic
1090126381 11:124089323-124089345 AAATGGCATATGGGAAGCCTGGG - Intergenic
1094695279 12:32812002-32812024 AAATGGCATATGTGCAGGCCAGG - Intronic
1095389166 12:41685440-41685462 TAATGGCATTTGCACAACCTGGG + Intergenic
1095520066 12:43052832-43052854 AAATGCCTTTTGGGCAGCCTCGG - Intergenic
1095946469 12:47756601-47756623 AAATGGCAGTTGGGCAAGGTAGG + Intronic
1096453058 12:51761268-51761290 AAATGGGAGATGGGTAACATAGG + Intronic
1096827546 12:54291460-54291482 GAAAGGCCTATGGGCATCCTGGG + Intergenic
1098213612 12:68192467-68192489 AAATGGCCTATGGGGCACTTTGG - Intergenic
1100244121 12:92739349-92739371 ACATGGCACATGTGCAGCCTGGG + Intronic
1104401637 12:128481340-128481362 TCCTGGCATATGAGCAACCTTGG - Intronic
1110981707 13:81908622-81908644 AGATTGCATAGGGGCTACCTGGG - Intergenic
1118807745 14:69252492-69252514 AACTGGGAGATGGGAAACCTGGG - Intergenic
1119631086 14:76232796-76232818 ACATGGAATATTGGCAACCAGGG + Intronic
1120235074 14:81881442-81881464 AGAAGGCATAAGAGCAACCTAGG - Intergenic
1121462046 14:94088097-94088119 AACTGGCATATGGGGAAGCCAGG - Intronic
1127021809 15:54756566-54756588 AAAGGGCACATGGCGAACCTTGG - Intergenic
1127624655 15:60768310-60768332 AAATGGCATATGTGCACTGTGGG + Intronic
1127748967 15:62013206-62013228 AAATGGCATTTGGGTAATTTTGG - Intronic
1130834542 15:87636391-87636413 ATATTGCATGTAGGCAACCTTGG + Intergenic
1135497554 16:22965666-22965688 CAATGACATATGGGGATCCTTGG + Intergenic
1138778313 16:59752374-59752396 AAGTGTCATGTGGGCACCCTCGG - Intronic
1138986701 16:62337634-62337656 AAATGGTATATGGGCATCCAGGG + Intergenic
1143513992 17:7410374-7410396 AAATGGCTTATGGGGAACTAGGG - Intronic
1144406610 17:14958034-14958056 AGATGGCATCTAGGCATCCTTGG - Intergenic
1146506486 17:33410059-33410081 AATTGGCAGATGGTCAGCCTAGG + Intronic
1148828248 17:50410452-50410474 AAATGGCAAATGGGAGATCTGGG - Intergenic
1149709264 17:58724862-58724884 AAATGGCATGTGGGCAAAGATGG + Intronic
1155705231 18:28802183-28802205 AAATCGCAGATGGTCACCCTAGG + Intergenic
1157488317 18:48105198-48105220 ATTTAGAATATGGGCAACCTTGG + Intronic
1158066098 18:53410365-53410387 AAATTACATTTGGGAAACCTGGG + Intronic
1158815081 18:61085781-61085803 ACATGGGATATGGCCAACCAGGG + Intergenic
1160088978 18:75808168-75808190 AAATGGCAGATGGGCTCCCCAGG - Intergenic
931087269 2:58846596-58846618 AGATGGCATATAGGGAACATGGG - Intergenic
932499674 2:72172965-72172987 AAATGGCACATGGGCACTCATGG - Intergenic
936249533 2:110857267-110857289 AAATGACATATGGGAAAACACGG - Intronic
937676111 2:124592884-124592906 AAAGGGCAAATGGACAAACTGGG - Intronic
939359892 2:141156753-141156775 CAATGGCATATGTGCAATGTAGG + Intronic
939742531 2:145927121-145927143 AAATGGAACTTGGGCAACCTGGG - Intergenic
943798046 2:192023057-192023079 AACTTGCATATTGGCAAACTAGG - Intronic
944936704 2:204577186-204577208 ACATGGCAGATGAGGAACCTTGG + Intronic
946735985 2:222755082-222755104 AAATGGCATAAAGGGACCCTAGG + Intergenic
1169037011 20:2462046-2462068 ACATGGCATATGTGCTAACTAGG + Intronic
1169987534 20:11461806-11461828 ATATGGAATATGGGCACTCTAGG - Intergenic
1172577023 20:36017355-36017377 GAATGGCATAAGGACAACCTTGG - Intronic
1176588699 21:8618512-8618534 TAATGACATTTGAGCAACCTTGG + Intergenic
1180134015 21:45849179-45849201 AAAAGGCATATTTGGAACCTTGG - Intronic
1180271527 22:10595508-10595530 TAATGACATTTGAGCAACCTTGG + Intergenic
949138623 3:603257-603279 TAATGACATTTGAGCAACCTTGG - Intergenic
949405602 3:3711130-3711152 TAATGGGATATGGGCCACTTGGG - Intronic
950330703 3:12153869-12153891 ATATTGAATATGGGGAACCTTGG - Intronic
953974067 3:47369578-47369600 AAAGCTAATATGGGCAACCTGGG + Intergenic
954048710 3:47954615-47954637 AAATGGCCTTTGGGGAAGCTTGG - Intronic
956646154 3:71458817-71458839 AAATGGGATTTGGGCACCGTAGG + Intronic
960028967 3:113038900-113038922 AAAAGTCATAAGGGCAACCTAGG + Intergenic
961152058 3:124647403-124647425 AAATGACATGGGGGCAGCCTGGG - Intronic
963281632 3:143390139-143390161 AAATGGCATATGGGCAACCTTGG - Intronic
968669132 4:1839237-1839259 AGATGGCAGATGTGGAACCTTGG + Intronic
975328961 4:73091890-73091912 AAGTGGGTCATGGGCAACCTTGG + Exonic
986049667 5:4077001-4077023 AAATGGCAGATGGATCACCTGGG - Intergenic
988635265 5:32976989-32977011 AAATGACATTTGGGAAAACTGGG - Intergenic
991263000 5:64686827-64686849 AACTAACATATGGGTAACCTTGG + Intergenic
998163487 5:139826994-139827016 AAATGGCATATGACCCATCTGGG - Intronic
998603867 5:143614028-143614050 AAGGGGCATATGGTCAACCTTGG - Intergenic
999553346 5:152714656-152714678 ATATGCCCTATGGACAACCTAGG - Intergenic
1000829880 5:166089563-166089585 AAATTGCATATAAGTAACCTGGG - Intergenic
1000868874 5:166550031-166550053 AAATTGGATCTTGGCAACCTTGG + Intergenic
1007951285 6:45874815-45874837 AAATGTCATTTGGGAAGCCTGGG - Intergenic
1008687810 6:53944606-53944628 AAATTAAATATGGGCAAGCTTGG + Intronic
1010739028 6:79477983-79478005 AAATGTTATTTGGGCAATCTGGG + Intergenic
1020653879 7:10907675-10907697 GAATTGCATATGGTCATCCTAGG + Intergenic
1021941403 7:25682428-25682450 AAATGGGGTATAGGCCACCTAGG + Intergenic
1023574767 7:41615377-41615399 AAATGGTGTTTGGGGAACCTTGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1034734353 7:153414290-153414312 AAAGGGTATATGGGAAATCTTGG - Intergenic
1036207207 8:6814152-6814174 AAATGGCCTATGGGAAACTGAGG - Intronic
1042203544 8:66305087-66305109 AAATGGCACATGGGCAGAATGGG + Intergenic
1042446124 8:68887115-68887137 AATTGGCATAAGGGAACCCTTGG + Intergenic
1043277715 8:78420666-78420688 TTATGGCATATGTGCTACCTTGG - Intergenic
1043369907 8:79578632-79578654 AAATCACATATAGACAACCTAGG + Intergenic
1047729596 8:127715917-127715939 AAATGGCACATAGGCCGCCTTGG + Intergenic
1052572241 9:30241669-30241691 AAAAGCCATTTGGGCAGCCTAGG - Intergenic
1052787923 9:32847029-32847051 CCAAGGCATATGGGCAACCTGGG - Intergenic
1054783133 9:69184624-69184646 AAATGGCATAGATGCCACCTGGG + Intronic
1056269294 9:84930778-84930800 AAATGGAAAATGGGCAAGTTGGG + Intronic
1061930657 9:133831459-133831481 AAAAAGAAAATGGGCAACCTGGG + Intronic
1203618706 Un_KI270749v1:97091-97113 TAATGACATTTGAGCAACCTTGG + Intergenic
1190220732 X:48510996-48511018 AAAGGGCATTTGGGGGACCTTGG - Intronic
1192171410 X:68857546-68857568 ATATGGCAGATGGGGAACCCTGG + Intergenic
1192632866 X:72790609-72790631 AAATGGTTGATGGGCCACCTTGG + Intronic
1192648843 X:72930192-72930214 AAATGGTTGATGGGCCACCTTGG - Intronic
1196645600 X:118114840-118114862 AAATGGCAGATTGAAAACCTTGG + Intronic
1196989421 X:121311706-121311728 AAACGGCATATGAGCCACATGGG - Intergenic
1199302067 X:146224354-146224376 AAATGGCATATAGTCTCCCTTGG - Intergenic
1199509679 X:148607899-148607921 ACATGGCAAATAGGCAACATTGG - Intronic
1201296132 Y:12464712-12464734 CAATCGCTTATGGGCAACATTGG - Intergenic
1202275890 Y:23119133-23119155 AAATGGTCTCTGGGCCACCTGGG + Intergenic
1202290138 Y:23301558-23301580 AAATGGTCTCTGGGCCACCTGGG - Intergenic
1202428884 Y:24752852-24752874 AAATGGTCTCTGGGCCACCTGGG + Intergenic
1202441907 Y:24917237-24917259 AAATGGTCTCTGGGCCACCTGGG - Intergenic