ID: 963284630

View in Genome Browser
Species Human (GRCh38)
Location 3:143421850-143421872
Sequence GTCTAATACCAGAATCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 4, 2: 16, 3: 38, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963284627_963284630 22 Left 963284627 3:143421805-143421827 CCACAGAATAGGAGAAAATATTT 0: 103
1: 1398
2: 2838
3: 3778
4: 4927
Right 963284630 3:143421850-143421872 GTCTAATACCAGAATCTACAGGG 0: 1
1: 4
2: 16
3: 38
4: 180
963284626_963284630 23 Left 963284626 3:143421804-143421826 CCCACAGAATAGGAGAAAATATT 0: 232
1: 3157
2: 14774
3: 17972
4: 9612
Right 963284630 3:143421850-143421872 GTCTAATACCAGAATCTACAGGG 0: 1
1: 4
2: 16
3: 38
4: 180
963284625_963284630 26 Left 963284625 3:143421801-143421823 CCACCCACAGAATAGGAGAAAAT 0: 2
1: 23
2: 160
3: 249
4: 437
Right 963284630 3:143421850-143421872 GTCTAATACCAGAATCTACAGGG 0: 1
1: 4
2: 16
3: 38
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963284630 Original CRISPR GTCTAATACCAGAATCTACA GGG Intronic
902967518 1:20019030-20019052 GATTAATACTAGAATATACAAGG - Intergenic
906891097 1:49715830-49715852 GCCAAAATCCAGAATCTACAAGG - Intronic
909267658 1:73581426-73581448 GTCTAAATCCAGAATCTATAAGG + Intergenic
911260681 1:95681615-95681637 GTCTATCTCCAGAATCTACCAGG - Intergenic
911468857 1:98290767-98290789 GTCTAAGTCCAGAATGTCCAAGG + Intergenic
911537060 1:99113046-99113068 GGCTATAACTAGAATCTACAAGG - Intergenic
911932285 1:103920226-103920248 GTCTAGTTCCAGAATTTATATGG - Intergenic
912205543 1:107504485-107504507 GCCTAATTCCAGCGTCTACAAGG + Intergenic
912642195 1:111357923-111357945 GAATAATAACAGAATCTATATGG - Intergenic
912771561 1:112468684-112468706 GACTAATTCCAGAATATACAAGG - Intronic
913339322 1:117742217-117742239 GACTAATATCCAAATCTACAAGG - Intergenic
913487577 1:119347411-119347433 GTCAAATAGCAAAATTTACATGG + Intergenic
917381052 1:174408942-174408964 GTCTAACATTAGAATCTATAAGG - Intronic
918797840 1:188927190-188927212 GTTTAATATCATAATCTTCAAGG + Intergenic
918921186 1:190712384-190712406 GTATAAATCCAGAATCTACCAGG - Intergenic
918982486 1:191581267-191581289 GTCTAATATCAGCATCTATAAGG - Intergenic
919316418 1:195976317-195976339 GATTAATACCAGAACATACAAGG - Intergenic
924416855 1:243864868-243864890 GACTAGGACTAGAATCTACAGGG + Intergenic
924837138 1:247661676-247661698 GGCTAATTCCACAATCTACAAGG - Intergenic
1062964586 10:1597383-1597405 GTCAATACCCAGAATCTACAAGG + Intronic
1064776461 10:18783430-18783452 GTCTAATATCCGAATCTATAAGG - Intergenic
1066326868 10:34369072-34369094 GTCTGACACCAGAATCTGCAGGG - Intronic
1067847359 10:49735046-49735068 GTGTCATGCCAGAATCTACCAGG - Exonic
1068983110 10:63082234-63082256 GACTAATATCCAAATCTACAAGG + Intergenic
1071696898 10:87886016-87886038 GTCAAAGACCAGGATCAACATGG - Intronic
1072015117 10:91339033-91339055 GTCTTATATCAGACTATACAAGG + Intergenic
1077022892 11:427091-427113 GTCAAGAACCAGCATCTACAGGG + Intronic
1077450638 11:2641516-2641538 TACTAATACCAGAATATACTAGG - Intronic
1079461936 11:20689155-20689177 GTCTAAGACCAGAATCTATAAGG - Intronic
1079993279 11:27268766-27268788 GCCAATAACCAGAATCTACAAGG - Intergenic
1082327390 11:51163328-51163350 CTCTTATACTAGAATCTGCAAGG + Intergenic
1085335855 11:75694437-75694459 GTCTAATTCCAGAATCTATAAGG - Intergenic
1085975897 11:81654394-81654416 GACTAATACCAGAATCTATAAGG - Intergenic
1088225084 11:107611342-107611364 ATCTAAAACCAGCATCTATAAGG + Intronic
1091167148 11:133489341-133489363 GGCTAAATCCAGAATCTACAAGG + Intronic
1095173028 12:39057312-39057334 GTCAAATACCAAAATTCACAGGG - Intergenic
1097257298 12:57688573-57688595 GTCTAATATCAGAATATAAAAGG + Intergenic
1098503118 12:71217331-71217353 ATCTTCTACCAGAATCTCCATGG - Intronic
1104446692 12:128839778-128839800 GCATAATACCAAAATGTACAGGG + Intergenic
1106462409 13:29982928-29982950 GATTAATATCAGAATATACAAGG - Intergenic
1106701231 13:32231030-32231052 ATCTAATCCCAGCATCTATAAGG - Intronic
1108828600 13:54448892-54448914 GTCTAATAAAATAATCTATAGGG - Intergenic
1109000583 13:56797799-56797821 AGCTAATACCAAAATCTACCCGG + Intergenic
1109018681 13:57055530-57055552 GTCTAATATCAGTGTCTTCAGGG - Intergenic
1109146457 13:58785767-58785789 GTCTAATATCCGAGTCTCCAAGG - Intergenic
1109417517 13:62062451-62062473 TTTTAATACCAGAATTTACAAGG - Intergenic
1109593074 13:64512820-64512842 GTCTAATATTAGCATCTAAAAGG - Intergenic
1110182311 13:72632399-72632421 ATCTAATTCCAGAACCTATAAGG + Intergenic
1113293332 13:108929657-108929679 GTCAAATTCCAGAATCTAGTGGG + Intronic
1115286786 14:31722815-31722837 ATCTAATTCCAGCATCTATAAGG - Intronic
1118068531 14:62219161-62219183 GTCTAACACCAAAATCTATAAGG - Intergenic
1120027255 14:79600504-79600526 GTCAAATACTAGAATCTGCAGGG + Intronic
1120260508 14:82178622-82178644 GTCTATTCCCAGAATTTTCAGGG - Intergenic
1121397970 14:93643795-93643817 CACAAATACCAGTATCTACAAGG - Intronic
1122016305 14:98799723-98799745 TTCTGATTCCAGAATCCACAGGG + Intergenic
1126191221 15:45880930-45880952 GTATAACACAAGGATCTACAAGG + Intergenic
1126212622 15:46117054-46117076 GTCTAATATCCAACTCTACAAGG + Intergenic
1126306931 15:47270604-47270626 GACTAATTACAGAGTCTACATGG - Intronic
1127535644 15:59887468-59887490 GCCTAATATCTGAATCTACAAGG + Intergenic
1130363946 15:83216023-83216045 GTCTAATATCAGAATCTATAAGG - Intergenic
1130400670 15:83550282-83550304 GTCTAATAGGAAAATCTCCAAGG - Intronic
1131800603 15:96065480-96065502 CTCTAATACCAGAATTTAATTGG - Intergenic
1134418394 16:14064348-14064370 ATCTAATTCCAAAATCTATAAGG - Intergenic
1138068465 16:53966434-53966456 CTCAAATACCAAAATCAACAAGG + Intronic
1138530512 16:57631858-57631880 ACCTAAGACCAGAATCTACAGGG - Intronic
1143310738 17:5986684-5986706 GACTAATACCAGAATCTATAAGG + Intronic
1150428425 17:65096007-65096029 GTCTAAATCCAGAATTTACAAGG + Intergenic
1151012016 17:70510511-70510533 GCCTAACACCAGAAGCCACATGG - Intergenic
1155683407 18:28517682-28517704 GTCTAATATCCAGATCTACAAGG + Intergenic
1156230269 18:35147045-35147067 GTCTAATATCTGAATCTACAAGG - Intergenic
1156499266 18:37546755-37546777 GTCTACAACATGAATCTACATGG + Intronic
1158345442 18:56511715-56511737 GTCTTATCTCAGAATCTACAGGG + Intergenic
1158713063 18:59854321-59854343 CTCAAACACCAGAATCAACAGGG + Intergenic
1168367711 19:55803570-55803592 GTCTAATACCCGCATCTATAAGG + Intronic
925073799 2:993326-993348 GTCTAATACTATAATGTGCATGG - Intronic
927185432 2:20478923-20478945 TTCTGATTCCAGAATCCACATGG + Intergenic
930436400 2:51349177-51349199 GTATAATACCAGAAAACACAAGG + Intergenic
930715974 2:54594542-54594564 ATCTAATCCCAGTATCTACGGGG - Intronic
931581699 2:63782425-63782447 TACTAATATCAGAATCTAGAAGG + Intronic
933508804 2:83213843-83213865 GCCTAATCCCATGATCTACAGGG - Intergenic
933690569 2:85176402-85176424 GTCTAATAACAGAATTGCCAAGG - Intronic
935764156 2:106348128-106348150 GTCTAATATCCAAATCTATAAGG - Intergenic
936120969 2:109744463-109744485 GTCTACATCCAGAATCTATAAGG - Intergenic
936223726 2:110627012-110627034 GTCTACATCCAGAATCTATAAGG + Intergenic
938275117 2:130013493-130013515 GTTAAATAGCAGAATCTAGAGGG + Intergenic
938326076 2:130404217-130404239 GTTAAATAGCAGAATCTAGAGGG + Intergenic
938363866 2:130717242-130717264 GTTAAATAGCAGAATCTAGAGGG - Intergenic
938440248 2:131323787-131323809 GTTAAATAGCAGAATCTAGAGGG - Intronic
939300465 2:140330830-140330852 GTCTAAATTCAGAATCTACAAGG + Intronic
940383965 2:153048725-153048747 GTCTAATATTATAATCTATAAGG + Intergenic
940791444 2:158033718-158033740 GGCTAATAACAGAAACTACTTGG - Intronic
940923986 2:159343508-159343530 GATTAATACCAGGATATACAAGG + Intronic
940934881 2:159481129-159481151 GTCTTATGCCTGAATTTACAAGG + Intronic
941036149 2:160571059-160571081 GTCTGAGACCAGCATCAACATGG - Intergenic
941423451 2:165313434-165313456 ATATAATAACAGAATCTATAAGG - Intronic
942079962 2:172390873-172390895 GTCTAATATCACTAACTACATGG - Intergenic
943245641 2:185447153-185447175 GACTAATATCAGAAGTTACAAGG + Intergenic
944485991 2:200206159-200206181 GACTAAATCCAGAATCTACAAGG + Intergenic
945900323 2:215530222-215530244 GTCTGTAACCAGAATCTCCAAGG - Intergenic
946810749 2:223522516-223522538 GTCTCATACCAAAATGTATATGG + Intergenic
946967346 2:225051245-225051267 GGCTAAATCCAGAATATACAAGG - Intergenic
947029819 2:225781555-225781577 GTCTGGTAGCAGAATCTACCTGG + Intergenic
948183586 2:236001719-236001741 GTAAAATTCCAGAATATACATGG - Intronic
1169787918 20:9380404-9380426 ATCTAATACAAGAAAGTACATGG - Intronic
1172951675 20:38726582-38726604 GTCTAGAACCAGAAGCTTCAGGG - Intronic
1173203693 20:40973840-40973862 GACTAATAACAGAATATATAAGG - Intergenic
1173544027 20:43878612-43878634 ATCTAAAAGCAGAATCTATATGG - Intergenic
1177133623 21:17286990-17287012 GTCTAATTCCAGAATCTACAAGG + Intergenic
1178980691 21:37261837-37261859 GTCTTCTCCCAGAATCTAGATGG + Intronic
1182076899 22:27501162-27501184 GTCAAATTTCAGGATCTACATGG - Intergenic
1182629083 22:31670724-31670746 TTCTATTACCAGGACCTACAAGG - Intergenic
1183709231 22:39492645-39492667 GTCCAGGTCCAGAATCTACAAGG - Intergenic
1184917763 22:47583988-47584010 TTCTAATGCCACAATCTCCAAGG - Intergenic
949865702 3:8545098-8545120 TTCTAATAGTAGAATCGACAAGG - Intronic
950599645 3:14021541-14021563 GTCTAATACCAGCATATATAAGG - Intronic
951329748 3:21352760-21352782 GGCTACATCCAGAATCTACAAGG + Intergenic
953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG + Exonic
953080469 3:39611956-39611978 GTCTAACTCCAAAATCTAAAGGG + Intergenic
953251452 3:41248665-41248687 TTCTAAAAACAGAATCTACCAGG + Intronic
953513082 3:43563085-43563107 CTAGAATACCAGAATATACAAGG + Intronic
954018052 3:47712878-47712900 TTCTGATACTATAATCTACAGGG + Intronic
957135959 3:76289371-76289393 GTCTAATATCAGCATCTATAAGG - Intronic
957912375 3:86637265-86637287 GTCTAATATCCAAATCTACAAGG - Intergenic
958718060 3:97811185-97811207 GTGTAATACAAGAACATACAAGG - Intergenic
958758698 3:98280934-98280956 GTCTAATATCAGAATCTATAAGG + Intergenic
959309596 3:104717205-104717227 CTCTAATTCCAAAATATACATGG + Intergenic
959479871 3:106858328-106858350 GTCTAAATCCAGAATCTACAAGG + Intergenic
959654654 3:108788794-108788816 GACTAATTCCAGAATTCACAAGG + Intergenic
960711532 3:120535260-120535282 GACTAATATCAGAATCTATAAGG + Intergenic
962633185 3:137300565-137300587 AATTAATACCAGAATCTACTGGG - Intergenic
963284630 3:143421850-143421872 GTCTAATACCAGAATCTACAGGG + Intronic
965770536 3:172177140-172177162 TGCTAAAACCAGATTCTACAAGG + Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
968212887 3:196864050-196864072 GTTCAATATCAGAATCTATAAGG + Intergenic
970285019 4:14502544-14502566 GTCTAATATCAAAGTCTATAGGG - Intergenic
970746838 4:19308498-19308520 CTCTAATACCATTACCTACAAGG + Intergenic
971156872 4:24092535-24092557 ATCTGATACCTGAATCCACATGG + Intergenic
971523608 4:27587067-27587089 GACTAAAACCAGAATATATAAGG + Intergenic
971905745 4:32722942-32722964 ATCTAATACAAGCATCTAAAAGG + Intergenic
974328320 4:60444198-60444220 GTCTGATACTTGTATCTACAGGG + Intergenic
975465866 4:74708844-74708866 GGCTAATACCAGAATCTATGAGG - Intergenic
977722724 4:100259376-100259398 GTATAATACCAATTTCTACAAGG - Intergenic
977933034 4:102769033-102769055 GACTAATATCAGAGTCTATAAGG + Intergenic
978137805 4:105283532-105283554 GACTAATATCAGAATGTAGAAGG - Intergenic
980271702 4:130592486-130592508 GACAAAGGCCAGAATCTACAGGG - Intergenic
980497254 4:133602477-133602499 CTCTAATATCAGTATTTACAAGG - Intergenic
981689711 4:147494257-147494279 CTCTTCTACCAGAATCCACAAGG - Intronic
983138932 4:164124012-164124034 GATTAATAACAGAATATACAAGG + Intronic
983535915 4:168856756-168856778 GTCTAACTCCAGAGCCTACATGG + Intronic
984843277 4:184088221-184088243 GTCTAATATCAGAATCTACAAGG + Intergenic
984897729 4:184556743-184556765 GTCTAATATCCAAATCTATAGGG + Intergenic
987693877 5:21302817-21302839 GACTAATACAGGAATCTTCAAGG + Intergenic
987982547 5:25105395-25105417 GTCTAATTCCACAATATATAAGG + Intergenic
988011041 5:25486174-25486196 GGCTAATACCAGAGTCTGCAAGG - Intergenic
988128895 5:27078348-27078370 TTCTAATATCAGCATCTATAAGG + Intronic
988129083 5:27079904-27079926 GTCTAATATCAGCAACTATAAGG + Intronic
988795444 5:34649152-34649174 GTCTAAGACAAAAAACTACATGG + Intergenic
989460760 5:41696246-41696268 GTCTAATGTCTGAATCTACAGGG - Intergenic
989975431 5:50580437-50580459 GACTATATCCAGAATCTACAAGG - Intergenic
991507144 5:67337159-67337181 GCCTACTTCCAGAATCTCCATGG + Intergenic
991746379 5:69746724-69746746 GACTAATACAGGAATCTTCAAGG - Intergenic
991751326 5:69808517-69808539 GACTAATACAGGAATCTTCAAGG + Intergenic
991797981 5:70326669-70326691 GACTAATACAGGAATCTTCAAGG - Intergenic
991825757 5:70622038-70622060 GACTAATACAGGAATCTTCAAGG - Intergenic
991830614 5:70683411-70683433 GACTAATACAGGAATCTTCAAGG + Intergenic
991890322 5:71325989-71326011 GACTAATACAGGAATCTTCAAGG - Intergenic
992033903 5:72752354-72752376 GTCTAAAACCACAATCCAAAAGG - Intergenic
994381909 5:99081039-99081061 GTCTAATACCAGAACCTATAAGG - Intergenic
994707065 5:103219852-103219874 GGCTATAACCAGAATCTACAAGG - Intergenic
995252093 5:110005542-110005564 GGCTAACATCAGAATCTACAAGG - Intergenic
995685703 5:114769783-114769805 GATTAATACCAGAATATATAAGG - Intergenic
996335014 5:122373998-122374020 GTCTACTAACAGGATGTACATGG + Intronic
997188519 5:131906134-131906156 GTCTAATATCAGAATCTATAAGG + Intronic
997968371 5:138379120-138379142 GTCAGATACCAGAATGTAAATGG + Intronic
998648126 5:144086915-144086937 GTTTAATACCTGAATCCATAAGG - Intergenic
998724176 5:144990302-144990324 GACTAAATCCAGAATCCACAAGG + Intergenic
998808107 5:145938279-145938301 GCCTAATGTCAGAATCCACATGG + Exonic
998927860 5:147146704-147146726 GTCTAATATACGAATCTATAAGG + Intergenic
999597383 5:153220138-153220160 GTCTATATCCAGAATTTACAAGG + Intergenic
1000474044 5:161683211-161683233 GTCTAATATCGAAATCTACCTGG + Intronic
1000870386 5:166569916-166569938 AGCAAATACCAGAAGCTACAGGG - Intergenic
1001145953 5:169184934-169184956 CTGTAATGCAAGAATCTACAAGG + Intronic
1001939239 5:175729097-175729119 GTCTAATTCCAGGGTCTGCAGGG - Intergenic
1002638489 5:180619536-180619558 GTCTCATCCGAGATTCTACAGGG - Intronic
1003833542 6:10041715-10041737 TTATAAATCCAGAATCTACAAGG - Intronic
1005557033 6:26997122-26997144 GACTAATACAGGAATCTTCAAGG - Intergenic
1006049327 6:31329255-31329277 GTATAATACAACATTCTACAAGG + Intronic
1008896548 6:56563463-56563485 GGCTGATACCAGAATCTACAAGG - Intronic
1009735320 6:67669629-67669651 GTCTAAGGTCAGACTCTACATGG + Intergenic
1010976320 6:82318368-82318390 GACTAATATCAGAATCTACAAGG + Intergenic
1013827013 6:114225303-114225325 GTCTACTACTAGAAGGTACATGG - Intronic
1013921294 6:115407642-115407664 GTCTAATATCAGCATCTATAAGG - Intergenic
1015662654 6:135592632-135592654 GCCTATTAACAGAATCTATAGGG - Intergenic
1017392337 6:153954890-153954912 GGCTAATACCAGAATCTACAAGG - Intergenic
1020331696 7:7024045-7024067 ATCTGATATCAGAATCTACAAGG - Intergenic
1022658852 7:32347366-32347388 TTCTAATAACAGAAACTGCAAGG - Intergenic
1024405431 7:48974025-48974047 GTCTAATACCAGAATCTAAGGGG + Intergenic
1024496324 7:50051049-50051071 GTAATATTCCAGAATCTACAAGG + Intronic
1024999688 7:55305115-55305137 GACTATCTCCAGAATCTACAAGG + Intergenic
1030454464 7:109755696-109755718 GCCTAGTATCAGAATCTACAAGG - Intergenic
1030663073 7:112243441-112243463 GACTAATACCAGAATCCACAAGG + Intronic
1031171781 7:118300898-118300920 ATCTAATACCAGAATTGAAAGGG - Intergenic
1031397450 7:121290682-121290704 GGCTAAATCCAGAATCTACAAGG - Intronic
1034370321 7:150589609-150589631 GGCTAATATCCAAATCTACAAGG - Intergenic
1035247303 7:157571942-157571964 GTCTAAAAACAGCATCTTCAAGG + Intronic
1036084010 8:5592808-5592830 CTCTAACACCCGATTCTACAAGG + Intergenic
1036886843 8:12563537-12563559 AACTAATGTCAGAATCTACAGGG - Intergenic
1038830665 8:31055644-31055666 GTCTATATCCAGAATCTACAAGG - Intronic
1039402713 8:37284490-37284512 GTCTAATACCAGAATTTACAAGG + Intergenic
1039661161 8:39468420-39468442 GACTAATATCCGAATCTGCAAGG - Intergenic
1039713308 8:40081460-40081482 GTTTAATACCAGATTGTAAATGG - Intergenic
1040574084 8:48635651-48635673 GACTAATACATGAAGCTACATGG - Intergenic
1041180724 8:55245259-55245281 GTCTAATACCAGAATCTATGAGG - Intronic
1042375131 8:68041402-68041424 TTCTAATACTACAATCCACATGG - Intronic
1042448085 8:68912540-68912562 ATCCAATTACAGAATCTACAGGG + Intergenic
1043189111 8:77194684-77194706 GTCTAATATCAAAATTTATATGG + Intergenic
1046123992 8:109881593-109881615 GTCTAGTCCCAAACTCTACAGGG - Intergenic
1046209232 8:111045392-111045414 CACTAACACCAGAATCTAAATGG + Intergenic
1047813206 8:128433086-128433108 GTTTAATATCAGAATCTATAAGG + Intergenic
1049458182 8:142705540-142705562 GTCTAATACCAGAGGCTGCTGGG + Intergenic
1050133221 9:2434545-2434567 GACTAAATCCAGAATCTACAAGG - Intergenic
1050864205 9:10477244-10477266 GCTAAATTCCAGAATCTACAAGG + Intronic
1051592609 9:18791678-18791700 GTCTTAAGACAGAATCTACATGG - Intronic
1052526284 9:29623728-29623750 GGCTGACACCAGCATCTACATGG - Intergenic
1054844380 9:69777384-69777406 GACTAATTCTAGAATCTACAAGG - Intergenic
1055235946 9:74123532-74123554 GGCTACTACTAGCATCTACAGGG - Intergenic
1060782486 9:126423007-126423029 GTCTAAGAACAGCATCTCCAGGG + Intronic
1188933027 X:36138166-36138188 GTCAAACACCTGAATCTGCATGG + Intronic
1191138441 X:57091472-57091494 GTCTACTTCCAGCATCTATAAGG + Intergenic
1191640566 X:63426986-63427008 GTCTAATACCAGAGCCTACGAGG - Intergenic
1191880801 X:65842261-65842283 CTCTAAAACCAGAAGCTATAAGG + Intergenic
1193091610 X:77499822-77499844 GTCTAATATCAGAATTTCCAAGG + Intergenic
1193371343 X:80700919-80700941 TGCAAATAACAGAATCTACAAGG - Intronic
1193718537 X:84960223-84960245 GTCTAATATCAGCATTTATAAGG + Intergenic
1194371247 X:93075118-93075140 GGCTACTACGAGAATCTATATGG + Intergenic
1194604005 X:95958706-95958728 GACTAATACCAGTATGTAGATGG + Intergenic
1197396809 X:125937571-125937593 GTCTAATTCCAGAACTTACAAGG - Intergenic
1198241431 X:134791163-134791185 GTGTAGTACCAGAAACAACAGGG + Intronic
1199567780 X:149233895-149233917 GCCTAATACCAGAATTTACAAGG + Intergenic