ID: 963285628

View in Genome Browser
Species Human (GRCh38)
Location 3:143431865-143431887
Sequence AGATGTACCTGGCAAATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963285628 Original CRISPR AGATGTACCTGGCAAATTGG AGG (reversed) Intronic
904869638 1:33608372-33608394 AGCTGTCCCTGGCACAATGGTGG + Intronic
904882478 1:33711514-33711536 AGATTCACCTGGGACATTGGTGG - Intronic
905953288 1:41971393-41971415 AGATGAATCTGGAAAATAGGCGG - Intronic
906687268 1:47770741-47770763 ATATGTTCCTGTCAAACTGGGGG + Intronic
915626893 1:157119347-157119369 AGATGTAACTGGTGAAGTGGGGG + Intergenic
921675592 1:217972626-217972648 AGCAGTACCTGGCACATGGGAGG - Intergenic
923399249 1:233600324-233600346 AGAAGTGCCTGGCCAATTGAGGG - Intergenic
1064495488 10:15905640-15905662 AAATGTACCTGGAAAAGGGGTGG - Intergenic
1065875284 10:29992615-29992637 ACATGTGCCTGGCAACATGGCGG - Intergenic
1066644767 10:37595261-37595283 AGCTGTAGTTGGCAAATTGCTGG - Intergenic
1067019897 10:42786186-42786208 ATATGCACCTGGCACATAGGAGG - Intronic
1071329665 10:84546994-84547016 AAATGTACCTGGCACTTAGGAGG + Intergenic
1072112401 10:92335611-92335633 AGATGTACCAGATAAAATGGAGG - Intronic
1072192325 10:93086168-93086190 AGAGGGACGTGGCTAATTGGGGG + Intergenic
1074954480 10:118374955-118374977 AGATTAACCTGGAAATTTGGAGG - Intergenic
1075336076 10:121609630-121609652 AGAGGTACCTGCCAGATTTGGGG + Intergenic
1077665968 11:4109812-4109834 AGATGGACCTGGGGAATTAGTGG + Intronic
1080082804 11:28241080-28241102 AAAAGTACCTGGCACATTGTAGG - Intronic
1081930954 11:46871022-46871044 CCAGGTACCTGGCAAATTGATGG + Intronic
1085309581 11:75508332-75508354 AGATCTGCCTTGCAAATCGGTGG + Intronic
1085837473 11:79972320-79972342 AGTTATCCCTGGCAAAGTGGAGG - Intergenic
1088028430 11:105215869-105215891 AGAAGTACCTGGCACATAGCAGG - Intergenic
1088538477 11:110887106-110887128 AGATTGGCCTAGCAAATTGGTGG - Intergenic
1096955706 12:55523790-55523812 TGATGTCCCTGGAAAATTTGGGG - Intergenic
1098044690 12:66388461-66388483 AGAGGAGACTGGCAAATTGGTGG - Intronic
1098958637 12:76714710-76714732 AGTTATACGTGTCAAATTGGAGG - Intergenic
1099339220 12:81407125-81407147 AGATGTACCTGGCTGCTTTGTGG - Intronic
1106852197 13:33805764-33805786 AGATGAACCAGGCTAATTGTAGG + Intergenic
1108991996 13:56671050-56671072 AAAAGTACCTGGCCAATTGCTGG - Intergenic
1112303581 13:98252624-98252646 AGAGATACCTGGCATTTTGGAGG - Intronic
1114131400 14:19797357-19797379 AGTGGTACCTGGCAAATGGGAGG - Intronic
1114484359 14:23054278-23054300 AGCTGGACCTGGCACACTGGTGG - Exonic
1116928842 14:50669725-50669747 CCATGTTCCTGGCAGATTGGAGG + Intergenic
1117176978 14:53154846-53154868 AGAGGTGCCTGGCATATAGGTGG - Intergenic
1118690594 14:68335722-68335744 AGATGCACCTGGCTAATTAAAGG + Intronic
1120677556 14:87439076-87439098 AGATGTGCTTGGCACATTGTTGG - Intergenic
1122146068 14:99689525-99689547 AGACGGCCCTGGCAAATTGCAGG + Intronic
1122155373 14:99747379-99747401 AGATGTACAGGGCACATTTGGGG + Intronic
1123183184 14:106489088-106489110 AGATGTACCTTTCATTTTGGAGG - Intergenic
1123574463 15:21652948-21652970 AATGGTACCTGGCAAATGGGAGG - Intergenic
1123611077 15:22095536-22095558 AATGGTACCTGGCAAATGGGAGG - Exonic
1123969683 15:25495408-25495430 AATTGTAACTGGCAAATTGCCGG + Intergenic
1124649080 15:31461795-31461817 AAATGTACGTGACAAAATGGTGG - Intergenic
1125783418 15:42292128-42292150 CAATGTACCTGTGAAATTGGAGG + Intronic
1126946996 15:53832500-53832522 AGAAGTCCCTGGCAAATGAGGGG + Intergenic
1127608419 15:60613572-60613594 AGACGTGCCTGGCAATCTGGTGG - Intronic
1127653378 15:61031555-61031577 AGTTCTTCTTGGCAAATTGGTGG + Intronic
1127819710 15:62644185-62644207 AACTGAATCTGGCAAATTGGAGG - Intronic
1129881899 15:79012331-79012353 AGATCTACCTGGCACAGTTGAGG - Intronic
1131200476 15:90391277-90391299 AGATGTAACTGGGAAGCTGGTGG + Intronic
1202983325 15_KI270727v1_random:387292-387314 AATGGTACCTGGCAAATGGGAGG - Intergenic
1133849912 16:9493194-9493216 AGATGTATCTGGCACATGGCTGG + Intergenic
1134423255 16:14113849-14113871 AAATGTACCTGGAAAATTTAAGG - Intronic
1139798279 16:69500320-69500342 AGATGTTCTTGGAAACTTGGGGG + Intergenic
1147761806 17:42803056-42803078 AGATTTACCCAGCAAACTGGTGG + Intronic
1150980960 17:70141077-70141099 ACATGTTCCTGTTAAATTGGAGG + Intergenic
1152058006 17:78046865-78046887 GTATGAACCTGTCAAATTGGGGG + Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154129018 18:11719916-11719938 AGATGTCCCTGGGAGGTTGGTGG + Intronic
1154273255 18:12937920-12937942 AGATATACCAGGCACATAGGTGG - Intergenic
1157139398 18:45090533-45090555 AGTTACACCTGGGAAATTGGTGG + Intergenic
1157300841 18:46477945-46477967 AGAAGTACCTGGCAGAGAGGTGG + Exonic
1159332498 18:67016084-67016106 GAATGTACCTGGAAAATTTGGGG - Intergenic
1168429113 19:56263311-56263333 ACATGTTCCTGGCACATTGGAGG - Intronic
1168472316 19:56649690-56649712 AGATGTGCCTGGTACATTTGGGG + Intronic
926261555 2:11268213-11268235 AGCTGTAACTGACAAATTGCTGG + Intronic
926261837 2:11271384-11271406 AGCTGTAACTGACAAATTGCTGG - Intronic
928819718 2:35345110-35345132 ATATATACCTGGCAATTTGAAGG + Intergenic
930191562 2:48465299-48465321 AGGTGTATTTGCCAAATTGGTGG + Intronic
932534967 2:72582849-72582871 AGATCAGCCTGGCCAATTGGGGG - Intronic
935827438 2:106965372-106965394 AGGAGTACCTGGAAACTTGGGGG - Intergenic
936373942 2:111925086-111925108 AGATGGACATGGCTAACTGGGGG - Intronic
941257389 2:163249792-163249814 AGATGTAGCTGGCACATTTGTGG - Intergenic
943036747 2:182756240-182756262 ATATATTCCTGGCAAATTGTTGG - Intronic
944201673 2:197114289-197114311 AAATGTAGCTAGAAAATTGGAGG - Intronic
944331756 2:198476587-198476609 TGATGTAACTGGCATATTGGTGG - Intronic
945549433 2:211201308-211201330 AAATGTACCTGGCATATGGTGGG + Intergenic
1175321520 20:58091577-58091599 AAATGTAACTGGCATATTGTAGG - Intergenic
1175417152 20:58809256-58809278 CCAGGTACCTGGCAAATAGGGGG + Intergenic
1178384126 21:32135529-32135551 AGGAGTACCTGGCACATAGGGGG + Intergenic
1179420761 21:41234725-41234747 AGATGTGCCTGCCACATGGGAGG - Intronic
1182006002 22:26960235-26960257 AGATGTACCTGGAAAAAGGGAGG + Intergenic
950773991 3:15333991-15334013 GGATGTACCTGCAAAGTTGGAGG - Intronic
952801895 3:37301298-37301320 AGAAGTAACTAGCAAGTTGGAGG + Intronic
952838894 3:37627913-37627935 AGATGTGCCTGCCAGTTTGGGGG - Intronic
953674454 3:44989780-44989802 CTATGTACCTGGCACATAGGAGG - Intronic
954796350 3:53163126-53163148 AGCTGTACCTGGCTGATGGGTGG + Intronic
955904712 3:63794668-63794690 ACAAGTACCTGGCACATAGGAGG - Intergenic
956504340 3:69921609-69921631 AGATGTTTCTAGCTAATTGGAGG - Intronic
960462139 3:117949202-117949224 AGATCTACCATGCAAATGGGGGG - Intergenic
962728114 3:138254297-138254319 AGCAGTACCTGGCATATTGTAGG + Intronic
963285628 3:143431865-143431887 AGATGTACCTGGCAAATTGGAGG - Intronic
966479084 3:180385024-180385046 AGAAGTTCCTGCAAAATTGGGGG - Intergenic
967680780 3:192361072-192361094 AGATGTCACTGGCAAATATGTGG + Intronic
967974602 3:195026077-195026099 GGAAGCAGCTGGCAAATTGGAGG + Intergenic
968432496 4:566990-567012 AGATGTACCTGGCAAGATGCAGG - Intergenic
971854302 4:32024207-32024229 AGATGAACCTGGGACATGGGAGG - Intergenic
972487330 4:39554806-39554828 AGAGGTAACTGGCAAATTCATGG + Intronic
973879375 4:55253846-55253868 AGAGGTCCCTAGGAAATTGGTGG - Intergenic
975082773 4:70300457-70300479 AGAAGTACCTGGTAAGGTGGTGG - Intergenic
975108935 4:70601559-70601581 AGATGTCCCAGGTGAATTGGAGG - Exonic
976267194 4:83195475-83195497 ACATGTGCCTGGCAACATGGCGG + Intergenic
976883513 4:89959912-89959934 AGATGTATCTGTTCAATTGGTGG - Intergenic
977800706 4:101227437-101227459 AAATGTACCTGGCACATAGAAGG + Intronic
979773168 4:124555147-124555169 AGGAGTACCTGGAAAATTGGAGG - Intergenic
980547830 4:134292441-134292463 AGATGTTCCTAGCACATAGGAGG - Intergenic
981351284 4:143732754-143732776 AATTGTACCTGGCAAATAGTAGG - Intergenic
981835842 4:149052326-149052348 TAATGTACCTGGCAGAGTGGAGG - Intergenic
988181856 5:27805965-27805987 AGCTGTACTTGACAAATTGATGG + Intergenic
989782486 5:45285154-45285176 AGATGGAGATGGCAAATTGAAGG - Intronic
990255857 5:53968078-53968100 AGATGTGAGTGGCAACTTGGGGG + Intronic
991516264 5:67438979-67439001 AGATGTACCTGGGGAATTGGAGG + Intergenic
991898073 5:71426759-71426781 AGATGTATCAGGCAAATTCTTGG + Intergenic
996712677 5:126559109-126559131 AGATGTGGCTGGCAAATATGTGG - Intronic
998908832 5:146936001-146936023 ATTTGTACCTGGCAGATTGGAGG + Intronic
1001240323 5:170063965-170063987 AGATGTAGCTGGAAAGGTGGGGG - Intronic
1001960247 5:175875912-175875934 AGAGGTACTTTGCAAACTGGTGG + Intronic
1004729968 6:18348020-18348042 AGAAGTACCTTTCAATTTGGTGG - Intergenic
1004861639 6:19809390-19809412 AAAAGTACCTGGCACATAGGAGG - Intergenic
1008884674 6:56419241-56419263 AGATGTTCCAGGCAAAGTGTAGG - Intergenic
1009321997 6:62303017-62303039 ATATTTACCTGGAAGATTGGGGG - Intergenic
1009721953 6:67482925-67482947 AATTGTTCCTGGCAGATTGGTGG - Intergenic
1010208477 6:73344302-73344324 AGTTGAACCTGGGAAATGGGAGG - Intergenic
1012485942 6:99722665-99722687 AGATGTACAGTGCAAATTGTTGG - Intergenic
1013313603 6:108920553-108920575 TGCTGTCCCTGGAAAATTGGAGG - Intronic
1013581811 6:111542524-111542546 AAGTGTACCTGGCATATTTGAGG + Intergenic
1013674455 6:112442227-112442249 TGAGGTACCTGGCTAATAGGTGG - Intergenic
1014685160 6:124488495-124488517 AGATGTACCTGGAAAATGGGTGG - Intronic
1017945170 6:159090709-159090731 AGACCAACCTGCCAAATTGGAGG - Intergenic
1021401140 7:20210660-20210682 AGATGTACTTGGGGAAATGGGGG - Intronic
1021554485 7:21905342-21905364 AGCTGTACCTGGGAAAGGGGAGG - Intronic
1022322777 7:29303018-29303040 AGATGGACCTGGAAGATGGGCGG - Intronic
1022429910 7:30307442-30307464 AGATCTACCTGGCAAAATTTGGG - Intronic
1028074294 7:86492648-86492670 AGATGTACCTGGTATATAGTAGG + Intergenic
1029504905 7:100957355-100957377 CAATGTACCTGTCATATTGGTGG - Exonic
1029898443 7:104011874-104011896 ACATGTCCCTGGCACATTGTAGG - Intergenic
1031381292 7:121088922-121088944 AGATGTACCTGGCTAATGATGGG + Intronic
1032419846 7:131769641-131769663 AGATGTACATGGCAAATGGCTGG - Intergenic
1032510536 7:132468681-132468703 AGGTGTTCCTGGAAAAGTGGAGG - Intronic
1032943529 7:136823568-136823590 ATATGTCCCTTGCAATTTGGGGG - Intergenic
1033027915 7:137794432-137794454 AGATGAAGCTAGCAAATTGCAGG + Intronic
1037375627 8:18224654-18224676 ATATGTAGCTGGAAAAGTGGGGG + Intergenic
1038207297 8:25478659-25478681 AGATGTACCTGGCATAGCAGAGG - Intronic
1038690509 8:29758165-29758187 AGGTGGACCTGGCTAAATGGTGG + Intergenic
1039217270 8:35286420-35286442 AGAAGCACCTGGCAAATGTGGGG - Intronic
1039817277 8:41105615-41105637 AGATGAAATTGACAAATTGGTGG + Intergenic
1041310397 8:56510512-56510534 TCATGTACCTGGCATGTTGGAGG + Intergenic
1041362192 8:57065987-57066009 AGAGGTACTTGGCAAATGGTGGG + Intergenic
1043024260 8:75046426-75046448 AAATAAACCTGGCAAATTGTTGG - Intergenic
1043412696 8:80015037-80015059 AGCTGTAACTGGTGAATTGGTGG + Intronic
1044539775 8:93395457-93395479 AGATGTTCCTGGTAAAATGCCGG - Intergenic
1045370831 8:101521088-101521110 AGAGGGAGCTGGCAAAGTGGGGG + Intronic
1047523331 8:125612467-125612489 AGAGGGACCTGGCAGATGGGTGG + Intergenic
1047983866 8:130212656-130212678 TGATGAACCTGGCAGTTTGGTGG - Intronic
1048873608 8:138818605-138818627 AGATGCTCCTGGAGAATTGGAGG - Intronic
1057060129 9:91996567-91996589 ATAAGTACCTGACAAATTGCTGG + Intergenic
1057714938 9:97485490-97485512 AATTGTACAGGGCAAATTGGTGG - Intronic
1057871701 9:98722913-98722935 ACATGTATCCGGCACATTGGAGG - Intergenic
1058270592 9:102967591-102967613 TGAGGTACATGGAAAATTGGAGG + Intergenic
1186313787 X:8347259-8347281 AGGTTTACCTGGCAGATGGGAGG + Intergenic
1186776863 X:12873449-12873471 AGAAGTACCTGGCATGTTGCAGG + Intronic
1188010646 X:25052195-25052217 AAAGGTAGCTGGCAAATGGGAGG - Intergenic
1188557351 X:31427723-31427745 AGATAAATGTGGCAAATTGGTGG + Intronic
1188679943 X:32991499-32991521 AAATGTAGCTAGCAAAATGGAGG + Intronic
1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG + Intergenic
1190003325 X:46710453-46710475 GGATGTAACTGGCAAATTGAGGG + Intronic
1190061388 X:47214080-47214102 GGGTGTGCCTGGCAAGTTGGAGG + Intronic
1190888777 X:54551521-54551543 AGATGTACCTGGCATCGTAGAGG - Intronic
1191580553 X:62756393-62756415 ACATATGCCTGGCAAATTGTTGG + Intergenic
1191898982 X:66022092-66022114 AGATGCATCTGGCAAATTCCAGG + Exonic
1192276889 X:69641190-69641212 TGTTTTAACTGGCAAATTGGAGG + Intronic
1194532057 X:95061957-95061979 AGAAGTGCCTGGCAAATAGTAGG - Intergenic
1195038649 X:100993331-100993353 ATATTTATCAGGCAAATTGGAGG - Intergenic
1195626794 X:107012179-107012201 AGAAGTAGCTTGCACATTGGTGG + Intergenic
1195746088 X:108120028-108120050 AGTTGTTACTGGGAAATTGGAGG - Intronic
1201271171 Y:12255458-12255480 AAATGTATCTATCAAATTGGTGG - Intergenic