ID: 963286124

View in Genome Browser
Species Human (GRCh38)
Location 3:143436149-143436171
Sequence CTGGGGGTGTCCACTGGTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963286122_963286124 -10 Left 963286122 3:143436136-143436158 CCGGACATCAGGGCTGGGGGTGT 0: 1
1: 0
2: 1
3: 21
4: 218
Right 963286124 3:143436149-143436171 CTGGGGGTGTCCACTGGTACCGG 0: 1
1: 0
2: 1
3: 17
4: 121
963286113_963286124 6 Left 963286113 3:143436120-143436142 CCCTCACAGTACCTGTCCGGACA 0: 1
1: 0
2: 0
3: 2
4: 57
Right 963286124 3:143436149-143436171 CTGGGGGTGTCCACTGGTACCGG 0: 1
1: 0
2: 1
3: 17
4: 121
963286118_963286124 -5 Left 963286118 3:143436131-143436153 CCTGTCCGGACATCAGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 963286124 3:143436149-143436171 CTGGGGGTGTCCACTGGTACCGG 0: 1
1: 0
2: 1
3: 17
4: 121
963286110_963286124 25 Left 963286110 3:143436101-143436123 CCGAGTTCCATCAAATCAGCCCT 0: 1
1: 0
2: 0
3: 14
4: 138
Right 963286124 3:143436149-143436171 CTGGGGGTGTCCACTGGTACCGG 0: 1
1: 0
2: 1
3: 17
4: 121
963286114_963286124 5 Left 963286114 3:143436121-143436143 CCTCACAGTACCTGTCCGGACAT 0: 1
1: 0
2: 1
3: 4
4: 72
Right 963286124 3:143436149-143436171 CTGGGGGTGTCCACTGGTACCGG 0: 1
1: 0
2: 1
3: 17
4: 121
963286111_963286124 18 Left 963286111 3:143436108-143436130 CCATCAAATCAGCCCTCACAGTA 0: 1
1: 0
2: 1
3: 8
4: 176
Right 963286124 3:143436149-143436171 CTGGGGGTGTCCACTGGTACCGG 0: 1
1: 0
2: 1
3: 17
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963286124 Original CRISPR CTGGGGGTGTCCACTGGTAC CGG Intronic