ID: 963288925

View in Genome Browser
Species Human (GRCh38)
Location 3:143466683-143466705
Sequence TCCTACTGGATTGTATCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963288923_963288925 6 Left 963288923 3:143466654-143466676 CCTTTGTATTATAGATTTCTCTG 0: 1
1: 0
2: 1
3: 26
4: 407
Right 963288925 3:143466683-143466705 TCCTACTGGATTGTATCTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963288925 Original CRISPR TCCTACTGGATTGTATCTTG AGG Intronic
909410160 1:75340906-75340928 TCCTAATGGCATTTATCTTGTGG + Intronic
921663291 1:217834428-217834450 TCCCACTAGAAGGTATCTTGGGG - Intronic
1064211834 10:13366406-13366428 TGCTTCGGGATGGTATCTTGGGG - Intergenic
1064273755 10:13888185-13888207 GCGTGCTGGATTTTATCTTGAGG - Intronic
1065349389 10:24782099-24782121 TCCTACTGAATTGTATTCTTAGG - Intergenic
1066801219 10:39193467-39193489 TCCTTCTGGTTTTTATCATGGGG + Intergenic
1067011433 10:42717552-42717574 TCCTACTGGACCTTATCTTTAGG - Intergenic
1067312148 10:45124276-45124298 TCCTACTGGACCTTATCTTTAGG + Intergenic
1067382545 10:45788213-45788235 TTCTACTTGATTGTATATTTTGG + Intronic
1067537499 10:47124571-47124593 TCAGAATGAATTGTATCTTGAGG + Intergenic
1067890249 10:50128761-50128783 TTCTACTTGATTGTATATTTTGG + Intronic
1073687336 10:105769755-105769777 TCCTACTGGATTTTCTGTCGGGG - Intergenic
1074906639 10:117869913-117869935 TCATACTGGAAAGTATTTTGGGG + Intergenic
1078601801 11:12738850-12738872 TCTTACTGGAGTGTGTCTTTAGG - Intronic
1082575247 11:54795458-54795480 TCCTTCTGGTTTTTATCATGGGG + Intergenic
1084731347 11:71075630-71075652 GCCTTCTGGTTTGCATCTTGTGG - Intronic
1085919505 11:80935313-80935335 TCCTAATGAATTGAATATTGAGG - Intergenic
1088865993 11:113848672-113848694 TTCTACTTGATTGTATTATGGGG + Intronic
1095426937 12:42085339-42085361 TCCAACTGGACTGTATGCTGTGG - Exonic
1095777999 12:46030964-46030986 TCCTGCTGTATTGTCTCCTGAGG + Intergenic
1097052864 12:56234064-56234086 TCCTACTGGCAGGTACCTTGGGG - Intronic
1097972114 12:65644690-65644712 TCCTACAGTATTGTATTTGGAGG - Intergenic
1099293073 12:80796186-80796208 TCAAATTGTATTGTATCTTGGGG + Exonic
1099564217 12:84219976-84219998 TCCTTGTGGATTGTAACGTGTGG + Intergenic
1099694819 12:86004994-86005016 TCCGACTGGATTGTGCCATGGGG - Intronic
1108108972 13:47047059-47047081 TCCTTCTGAATTTTATCTTTTGG + Intergenic
1109220120 13:59633208-59633230 TCTTACTGGATTGTGTGTTTAGG - Intergenic
1109955023 13:69554332-69554354 TCTTAGTGGATTGTCTCTGGTGG + Intergenic
1114239669 14:20854940-20854962 TCCTACTGGATGCTCTGTTGAGG - Intergenic
1115478288 14:33836904-33836926 TTCAACTGGTTTGTATCTTTTGG - Intergenic
1117348167 14:54854459-54854481 TCCATCTGGAGTGTATTTTGGGG - Intronic
1121614628 14:95304903-95304925 CCCTACTGGACTGTTTCATGGGG - Intronic
1123814943 15:23968182-23968204 TGGTACTGGATTATATCATGTGG - Intergenic
1133491515 16:6274347-6274369 TGTTACTGGGTTGTATTTTGTGG - Intronic
1139033822 16:62918737-62918759 TCCTACTGGCTGGTTTCTTTTGG + Intergenic
1203013466 16_KI270728v1_random:324712-324734 TCCTTCTAGTTTTTATCTTGGGG - Intergenic
1203031801 16_KI270728v1_random:597871-597893 TCCTTCTAGTTTTTATCTTGGGG - Intergenic
1203039920 16_KI270728v1_random:736560-736582 TCCTTCTAGTTTTTATCTTGGGG + Intergenic
1151108247 17:71644357-71644379 TTCTCCTGGATGATATCTTGAGG - Intergenic
1155903315 18:31418385-31418407 TCCCACTGGATTCAATCTTGGGG + Intergenic
1158752062 18:60273606-60273628 TTCTACTAGAATGTATCTTCTGG - Intergenic
1158893158 18:61892142-61892164 TCATTCTGGATTTTATCTTTAGG - Intronic
1164332640 19:24274527-24274549 TCTTTCTGGTTTGTATCTGGGGG + Intergenic
925705107 2:6677286-6677308 TGCTTCTGGATTGAATCTTAGGG - Intergenic
926330106 2:11817487-11817509 TCCTCCTGGATTTTATCTGAAGG + Intronic
926408402 2:12577084-12577106 TCCTGCTGGACTGCAGCTTGAGG - Intergenic
930274959 2:49300047-49300069 TTCTCCTGGATAATATCTTGAGG - Intergenic
935010784 2:99134151-99134173 TCCTCCTGGATAATATCCTGAGG + Intronic
937782193 2:125851510-125851532 TCTAACTGAATTGTATCTTAGGG + Intergenic
939501116 2:142986100-142986122 TCCTATTGGATAGCATCTTAAGG - Intronic
942353824 2:175084765-175084787 TCACACTGGATTGTAACTTTTGG + Intronic
944548981 2:200828300-200828322 TCCTATGGGCTTGAATCTTGGGG - Intergenic
945516435 2:210768374-210768396 TGCTACCGGATGGTATCTTGTGG + Intergenic
946735763 2:222753071-222753093 TCTTTTTGGATTGTATCTTAAGG + Intergenic
948243643 2:236460010-236460032 TCCTATTGGAATTTATCCTGAGG + Intronic
1168782622 20:506601-506623 TCCTACTGGATAGAATCCTCTGG + Intronic
1170936952 20:20818643-20818665 ACCTACTCAATTGTATCATGAGG + Intergenic
1171516261 20:25740220-25740242 TCCTCCTGGTTTGGATCCTGAGG - Intergenic
1174758561 20:53183739-53183761 TGCCACTGCCTTGTATCTTGAGG + Intronic
1181535339 22:23539475-23539497 TTCTACTTGATTTTCTCTTGGGG - Intergenic
1182057904 22:27374610-27374632 TTCTTCTGGATAGTATCCTGAGG - Intergenic
951142306 3:19178448-19178470 TCTTACTGTAGTGTATCTTGAGG - Intronic
952046639 3:29329502-29329524 TCCTAATGGATTATTTCTTTTGG - Intronic
953045420 3:39290259-39290281 TCTTAGTGGATTTTATCTGGGGG + Intergenic
955190783 3:56759484-56759506 TTCTACTTGACAGTATCTTGAGG + Intronic
955455135 3:59111914-59111936 TCCTAGTGGATTATATCTAAAGG + Intergenic
958020676 3:87991385-87991407 TCCTACTTGCTTGTCTCTTGTGG - Exonic
959128966 3:102327995-102328017 TCATACAGGATTGTGTCTTTTGG - Intronic
960461062 3:117936502-117936524 TCCCACTGTATTGTATCTTTTGG - Intergenic
963288925 3:143466683-143466705 TCCTACTGGATTGTATCTTGAGG + Intronic
970095434 4:12458753-12458775 TCATGCTGGATTTTCTCTTGAGG - Intergenic
970512540 4:16795466-16795488 TCCTGCTGGGCTTTATCTTGAGG + Intronic
972048485 4:34698605-34698627 TCCTTATGGATTCTTTCTTGTGG + Intergenic
973908107 4:55550861-55550883 CCCTTCTGGAGTTTATCTTGTGG - Intergenic
974791059 4:66690526-66690548 TCCTACTGGAGTTTATAATGAGG - Intergenic
979278952 4:118843033-118843055 TGTTATTGGATTGTTTCTTGTGG - Intergenic
979514846 4:121595957-121595979 TCCTGCTGGCTTTTACCTTGGGG - Intergenic
983461364 4:168028852-168028874 TCCTACTGGAAGGCATGTTGTGG - Intergenic
988526146 5:31988864-31988886 TCCTACAGGAGGGTGTCTTGAGG - Intronic
989667061 5:43866896-43866918 TCCTGCTAGATAGCATCTTGAGG + Intergenic
989795776 5:45470458-45470480 TCTTACTCAATTGTTTCTTGGGG - Intronic
989857269 5:46313783-46313805 TTCTCCTGGATAGTATCCTGCGG - Intergenic
991376776 5:65976134-65976156 TGCTACAGGATCGTATCTTATGG + Intronic
991933666 5:71781203-71781225 TCCTAATGGATTTTATAGTGTGG - Intergenic
993090449 5:83419872-83419894 TAATACTGGATTGAACCTTGTGG - Intergenic
993327187 5:86555741-86555763 TCCTACCGGATTGTATATAAGGG - Intergenic
994298958 5:98122961-98122983 TTCTCCTGGATTATATCCTGAGG - Intergenic
995120296 5:108529327-108529349 TCCCATAGGATTGTTTCTTGTGG + Intergenic
995896615 5:117019567-117019589 TCCTGCTGGATAGTTTCCTGTGG + Intergenic
999886715 5:155932297-155932319 TCTTCCTGAATTGTTTCTTGAGG + Intronic
1000520293 5:162286492-162286514 TCCTTCTAGATGGTATCTTCTGG - Intergenic
1002925378 6:1602656-1602678 TCCTCCTGGATGCTATCTGGTGG - Intergenic
1003544196 6:7044577-7044599 TCCTACTGGATTTAAAGTTGGGG + Intergenic
1006758227 6:36436566-36436588 TGGTACTGGGTTGTATCTGGGGG + Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1009439595 6:63661574-63661596 TCATACTGGAATATATATTGAGG - Intronic
1013576222 6:111485225-111485247 TCTTACTGAATTATATTTTGGGG + Intergenic
1018440549 6:163808367-163808389 TCTTATTGGCTTGGATCTTGTGG - Intergenic
1020115368 7:5473229-5473251 TCCTTCTGGCTTGGTTCTTGAGG - Intronic
1025590649 7:62855826-62855848 TCCTTCTAGTTTTTATCTTGAGG - Intergenic
1025592970 7:62886522-62886544 TCCTTCTGGTTTTTATCCTGGGG - Intergenic
1030311344 7:108072298-108072320 TCCTACTTCATTGTGTCTTCTGG + Intronic
1031240779 7:119236678-119236700 TTATCCTGGATTGTATTTTGAGG - Intergenic
1037028680 8:14073564-14073586 TCATACTGAACTGTATGTTGTGG - Intergenic
1040119107 8:43661174-43661196 TCCTGCTAGTTTTTATCTTGGGG - Intergenic
1041595645 8:59647798-59647820 TCATTCTGTATTGTAGCTTGAGG + Intergenic
1042897747 8:73689833-73689855 TCTCACTGGATTGTATCAGGGGG - Intronic
1046767351 8:118084053-118084075 TCCCACTGGAGTGGATCCTGAGG + Intronic
1047664403 8:127074906-127074928 TCCTACTGTATTATATTTTAAGG - Intergenic
1048475248 8:134736899-134736921 TCTTATTGGATTGTATATAGAGG + Intergenic
1048779674 8:137987444-137987466 TCCTACTGTATTGGACGTTGTGG - Intergenic
1056698442 9:88880431-88880453 TCCTCCTGGAGTGTCTCCTGAGG - Intergenic
1057407383 9:94785448-94785470 TCCTATTGGACTGTATTTAGGGG - Intronic
1058137836 9:101327042-101327064 TCCTACTCTCTTGCATCTTGAGG - Intergenic
1062033769 9:134373661-134373683 GCCTACTGGGTTGTAGCTGGAGG + Intronic
1186074747 X:5865955-5865977 TTCTACTGGCTTTTATCTGGTGG + Intronic
1191844511 X:65536576-65536598 TCTGACTGGCCTGTATCTTGAGG - Intergenic
1193067799 X:77277767-77277789 TCATGTTGTATTGTATCTTGTGG - Intergenic
1198929617 X:141839468-141839490 TCATATTTGATTATATCTTGAGG + Intronic
1199379010 X:147146578-147146600 TTCTCCTGGATAGTATCCTGCGG + Intergenic