ID: 963291655

View in Genome Browser
Species Human (GRCh38)
Location 3:143496383-143496405
Sequence TGTTAGGTAAATATCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963291651_963291655 -7 Left 963291651 3:143496367-143496389 CCTACATAAATCACCATGTTAGG 0: 1
1: 0
2: 2
3: 8
4: 129
Right 963291655 3:143496383-143496405 TGTTAGGTAAATATCTCTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 164
963291650_963291655 -1 Left 963291650 3:143496361-143496383 CCTGGACCTACATAAATCACCAT 0: 1
1: 0
2: 1
3: 9
4: 85
Right 963291655 3:143496383-143496405 TGTTAGGTAAATATCTCTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 164
963291649_963291655 4 Left 963291649 3:143496356-143496378 CCATTCCTGGACCTACATAAATC 0: 1
1: 0
2: 1
3: 8
4: 156
Right 963291655 3:143496383-143496405 TGTTAGGTAAATATCTCTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963291655 Original CRISPR TGTTAGGTAAATATCTCTGG AGG Intronic
900171047 1:1269023-1269045 TGTTAGGAAAGTCACTCTGGTGG + Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904145368 1:28386606-28386628 TGTTGGGTATATATATGTGGCGG + Intronic
906449290 1:45931009-45931031 TGTTATGAAAATGTCTCTGTAGG - Intronic
909167468 1:72247214-72247236 GGTTATGTGAATATCTCTGAAGG + Intronic
909417455 1:75423381-75423403 TGTTAGATCAATATTTCTGTTGG - Intronic
912127531 1:106557659-106557681 TTAAAGGTAAATTTCTCTGGTGG - Intergenic
922392523 1:225160018-225160040 TTTTAGGAAAACAACTCTGGTGG - Intronic
923504283 1:234592057-234592079 TGTTGGATACATATCTCAGGTGG + Intergenic
1062775024 10:136983-137005 TGTTTTGTATATATATCTGGTGG + Intronic
1063531389 10:6834931-6834953 TGTTAGGTAAATATACCTATAGG + Intergenic
1065891428 10:30124540-30124562 TGAAAGGTAAATAAATCTGGGGG + Intergenic
1066526045 10:36280863-36280885 TTTTAAGTAAATATCTCAGCAGG + Intergenic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1071397013 10:85234141-85234163 TGGTTGGGAAATATCTTTGGGGG - Intergenic
1074231646 10:111542582-111542604 TGTTCTGTAAATCTCTCAGGTGG - Intergenic
1074458588 10:113616361-113616383 TGTTTGGAAACTTTCTCTGGTGG - Intronic
1075399626 10:122151641-122151663 GTTTGGGGAAATATCTCTGGTGG + Intronic
1081762506 11:45586240-45586262 TGGTAGGAGAATGTCTCTGGTGG - Intergenic
1085380983 11:76117956-76117978 TGTTAGGGAAATATCTGTTAGGG + Intronic
1086605814 11:88695223-88695245 TGTTATGTAACTATTTCTAGAGG - Intronic
1086827987 11:91523496-91523518 TGTTGGATAAATATTTCTTGGGG + Intergenic
1088231408 11:107677067-107677089 TGCTACGCAAATATCTCTGAGGG - Intergenic
1089344933 11:117785091-117785113 TGCTTGGTAAATATCTCCTGAGG - Intronic
1089403838 11:118181273-118181295 TGTAAGGTAAATAACTAGGGAGG - Intergenic
1091125086 11:133087619-133087641 TGTTGGCTAAATATCTCTCTCGG - Intronic
1092631730 12:10386564-10386586 GTTTAGGAACATATCTCTGGAGG + Intronic
1093780242 12:23127256-23127278 AGATAAGTAAACATCTCTGGAGG - Intergenic
1093816595 12:23556581-23556603 TGTTAGGTAAATCCTTCTGGAGG - Intronic
1094776430 12:33733808-33733830 TGTTAGATATAAATCTCTGAAGG - Intergenic
1095263959 12:40131910-40131932 TGTGAGGTAAATAACTGTGGAGG - Intergenic
1097470767 12:59988085-59988107 TGTTAGGTAAATATTCCTGTAGG - Intergenic
1098982535 12:76973148-76973170 AGTTTGGAAAATATATCTGGGGG - Intergenic
1099075900 12:78107853-78107875 GGTTAGTTAGATTTCTCTGGTGG - Intronic
1102083333 12:110115932-110115954 TGTTAGGCAACTGTCTCTGTAGG + Intergenic
1103022685 12:117548772-117548794 AGTTAGGTGTTTATCTCTGGAGG + Intronic
1104278484 12:127352350-127352372 TTCTAGGTAAATATTTCTGTTGG + Intergenic
1106336897 13:28791616-28791638 TTTTAGGTAATTCTCTCTGCAGG + Intergenic
1106370405 13:29127162-29127184 TATCAGGTAAGGATCTCTGGAGG - Intronic
1112571633 13:100598542-100598564 AGCTAAGTAAATATCTCAGGAGG + Intergenic
1115056093 14:29128931-29128953 TTTTAGGTCAATATCTGTGATGG - Intergenic
1116289786 14:43018564-43018586 TGATAGGAAAATAAATCTGGGGG - Intergenic
1116824152 14:49655877-49655899 TATTAGAAAAATATCTCTAGTGG - Intronic
1119280710 14:73405180-73405202 TGTAAAGTAAATATCACAGGTGG + Intronic
1120452806 14:84691415-84691437 TCTTAGGTACATATCCCTGGTGG + Intergenic
1126204325 15:46026430-46026452 TGGTGCCTAAATATCTCTGGAGG - Intergenic
1126667710 15:51090168-51090190 TGTTGGGTAACGTTCTCTGGAGG - Intronic
1127210773 15:56772391-56772413 TATTGGGGAAATATCTGTGGAGG - Intronic
1127541538 15:59943870-59943892 TGTGAGCTGAATACCTCTGGAGG + Intergenic
1127712049 15:61608951-61608973 TGTAAGGTAATTATTTCTGAAGG + Intergenic
1127712602 15:61614838-61614860 TCCTAGGTCAATATCTCTTGGGG - Intergenic
1128437581 15:67669933-67669955 TCTTAGGTAAATATCTAGGAAGG - Intronic
1130077709 15:80704113-80704135 TTTCAGATAAAGATCTCTGGTGG + Intronic
1131706654 15:95003463-95003485 TGTTTGGTAAATGTTACTGGTGG + Intergenic
1134204963 16:12229676-12229698 TGTTAGGTAAATCCCTTTGACGG - Intronic
1135722868 16:24832049-24832071 TGTTAGGTAAATAACAGTTGAGG + Intergenic
1139216929 16:65135182-65135204 TGCTAGGAAAATATGTCTGGAGG - Intergenic
1140189751 16:72805280-72805302 TGCTAAGAAAATATCTCTGCTGG - Intronic
1140767899 16:78177028-78177050 TACTAGGTAAGAATCTCTGGAGG + Intronic
1141233903 16:82197651-82197673 GGTTAGGGGAATATTTCTGGAGG + Intergenic
1141468309 16:84221666-84221688 CATTAGGGAAATATCACTGGTGG + Exonic
1141567055 16:84909817-84909839 TGTGAGGAAGATATCTCTGTGGG - Intronic
1143433898 17:6908509-6908531 TGTTGGGTAAATATCTATAAGGG + Intronic
1144750500 17:17644952-17644974 TGTCAGGGAAATCTCCCTGGAGG + Intergenic
1149640921 17:58201928-58201950 TGTCAGGATAATATTTCTGGAGG - Intronic
1149854871 17:60073398-60073420 TGTTAGATAAATGTCTCCGATGG + Intronic
1152977419 18:236177-236199 TTTTAGGTATATATCCCTTGTGG + Intronic
1153938833 18:9958545-9958567 AATTAGGTCAGTATCTCTGGGGG - Intronic
1156323228 18:36047873-36047895 CATTTGGTAAAAATCTCTGGTGG - Intronic
1158879228 18:61760619-61760641 TGCTCAGTAAATATCACTGGAGG + Intergenic
926697348 2:15780134-15780156 TGTGAGGCAAATATATCTGCAGG + Intergenic
928398233 2:30959403-30959425 TGTTCAGTAAATATCCCTCGAGG - Intronic
930937499 2:56971838-56971860 TGTTAGATAATCATCTCTAGTGG - Intergenic
932994415 2:76832522-76832544 TCCTAGGTAAATATTTCTTGAGG + Intronic
933452946 2:82479956-82479978 TGTAAGGTAAATCTACCTGGAGG + Intergenic
937663159 2:124453442-124453464 TGTTTGGAAAATATATTTGGGGG + Intronic
940060146 2:149556818-149556840 TTTTAGGAAAATATATTTGGGGG + Intergenic
940384523 2:153055203-153055225 TCCTAGGTCAATATCTCTGGAGG - Intergenic
942120751 2:172774296-172774318 TGATTTTTAAATATCTCTGGTGG + Intronic
942161497 2:173193197-173193219 TGTTAGGTATATATGTATGTTGG + Intronic
942463223 2:176183913-176183935 TATTAGGTAAAAATCTCTGGGGG + Intergenic
943836324 2:192518146-192518168 GGTTAGATACATGTCTCTGGTGG - Intergenic
944150213 2:196549768-196549790 TTCTAGGAAAATATCTGTGGAGG - Intronic
946223556 2:218249568-218249590 TCTTAGGTAAATAATTCTAGAGG + Intronic
946708582 2:222484021-222484043 TATTAAGTAAATGTCTCTAGGGG + Intronic
946842852 2:223835893-223835915 TGTTAGGCAAATTACACTGGTGG + Intronic
1169898854 20:10533203-10533225 TTTAAGGTAAATCACTCTGGTGG + Intronic
1170196071 20:13690928-13690950 TGTTCACTGAATATCTCTGGAGG - Intergenic
1170761056 20:19251898-19251920 TGTTGGGTAACTTTCTCTGATGG + Intronic
1171052586 20:21873846-21873868 TGTTAGGTAAACATCCATGCAGG + Intergenic
1171104032 20:22415121-22415143 TGATAGGTAGATTTTTCTGGTGG - Intergenic
1172306460 20:33884334-33884356 AGTTAGGTTAGTGTCTCTGGCGG - Intergenic
1173141551 20:40489356-40489378 TCTCAGGTAAATTTCTCTTGTGG + Intergenic
1174561749 20:51435590-51435612 TGTTAGGTCCAGAGCTCTGGGGG + Intronic
1174677464 20:52372346-52372368 TGTTAAGCAAATATTTCTGCTGG + Intergenic
1178568479 21:33711814-33711836 TGTAACATAAATGTCTCTGGGGG - Intronic
1180501669 22:15935351-15935373 TGTTAAGTAAATATTCCTGCAGG + Intergenic
1180647818 22:17354179-17354201 TGTTTAGTAAATATTTATGGGGG + Intergenic
1182011434 22:27003931-27003953 ATTTAGTTACATATCTCTGGTGG - Intergenic
1183144656 22:35978902-35978924 GGTTAGGTATATATCTGTTGAGG + Intronic
950721795 3:14888201-14888223 AATTAAGTAAATATCTCTGAGGG - Intronic
950774576 3:15338495-15338517 TGCCACGTAAATATCACTGGTGG - Intronic
955868622 3:63412876-63412898 TTTTAGGTAGATAACTCTGCTGG + Intronic
959027943 3:101263200-101263222 TGTTCTGTAAATATCTGTGAGGG - Intronic
959134361 3:102398534-102398556 TTTTAGGAAGATGTCTCTGGAGG - Intronic
959674373 3:109018356-109018378 AGGGAGGTAAATGTCTCTGGAGG - Intronic
959822384 3:110751979-110752001 TGCTGGTTAAATTTCTCTGGTGG + Intergenic
960611364 3:119557849-119557871 TGTTTTGTAAACATCACTGGAGG - Exonic
963035957 3:141029299-141029321 TGCTAGACAAACATCTCTGGGGG - Intergenic
963291655 3:143496383-143496405 TGTTAGGTAAATATCTCTGGAGG + Intronic
963857945 3:150275456-150275478 AGTTAGCTAAATATCTTTGAGGG + Intergenic
964014622 3:151929802-151929824 TGTTAGGCTGATATCACTGGTGG - Intergenic
964940136 3:162149282-162149304 TGATATGTGTATATCTCTGGAGG + Intergenic
965279858 3:166736450-166736472 TGTTAAGTAATTTTCTCTGTTGG - Intergenic
966998491 3:185308962-185308984 TGTTAAGTCAGTATCTCTGTGGG + Intronic
970878192 4:20897055-20897077 TATTAGGTAAATATCAGTTGAGG + Intronic
971066345 4:23036861-23036883 TGCTCAGTAAATATCTGTGGAGG + Intergenic
972703236 4:41514673-41514695 TTTTAGGCAATTACCTCTGGTGG + Intronic
976091651 4:81464606-81464628 TGGTGTGTAAATTTCTCTGGGGG - Intronic
977169230 4:93739719-93739741 TATTAGGCAAATTTCTCTGGAGG - Intronic
978037529 4:104014075-104014097 TTTTAGGAAGATAACTCTGGTGG + Intergenic
978272470 4:106907401-106907423 TGTGAGTTCAATATGTCTGGTGG - Intergenic
978829559 4:113067732-113067754 TGTGAGGAAATCATCTCTGGGGG - Intronic
981068986 4:140515054-140515076 TGTTTGTGGAATATCTCTGGTGG + Intergenic
987655771 5:20803973-20803995 TGTTAGATTAATCTCTCTGTAGG + Intergenic
988449649 5:31328329-31328351 ATTTATGTAAATATGTCTGGAGG + Exonic
989680290 5:44020816-44020838 TGCTAGGTAATTATATCTGGGGG + Intergenic
990153978 5:52853410-52853432 TGTTATTTAATTATCTCTAGAGG + Intronic
991626668 5:68609935-68609957 TATTAGGTAAATATGTCTTTAGG - Intergenic
996828102 5:127708505-127708527 TGTTCCAGAAATATCTCTGGTGG - Intergenic
997679661 5:135741022-135741044 TGTTCAGTAAATATCTGTGATGG - Intergenic
999542247 5:152586475-152586497 TTTTATGTAAGTAGCTCTGGTGG + Intergenic
1006986182 6:38177154-38177176 TGCTCGGTCAATATCTCCGGAGG + Intronic
1007959366 6:45945011-45945033 TGTAAGCAAAAGATCTCTGGAGG + Intronic
1007977519 6:46116492-46116514 TGTTAAGTACATATCTCTTGGGG + Intergenic
1008556865 6:52681034-52681056 TGTTAGGTTAAAATCCCTGGGGG - Intronic
1009240504 6:61180289-61180311 TGTCAGGTAAGTATATCAGGGGG + Intergenic
1009574271 6:65431927-65431949 TGTTGAGCAACTATCTCTGGTGG + Intronic
1009611747 6:65952530-65952552 TGTTAGGTAATCTTTTCTGGTGG + Intergenic
1011975933 6:93298744-93298766 TGGTAGTTAAATATTTCTGGAGG + Intronic
1012564417 6:100629166-100629188 TGTTAGTTCAATAACTCTGGAGG + Exonic
1012949804 6:105505707-105505729 TGTTTGGTAAACATCTATGAGGG - Intergenic
1014762688 6:125375066-125375088 TATTCAGAAAATATCTCTGGAGG - Intergenic
1014812010 6:125897610-125897632 TGTTAGTTCAATCTCTCTGTTGG + Intronic
1015795442 6:137006635-137006657 TGTTGGAAAGATATCTCTGGTGG + Intronic
1016259866 6:142155970-142155992 TATTATGTAAATATCTCTAGTGG - Intronic
1017041685 6:150313342-150313364 TGTTGGGGAGATGTCTCTGGTGG - Intergenic
1017061266 6:150487278-150487300 TATTACATAAATTTCTCTGGGGG + Intergenic
1017305953 6:152918500-152918522 TGTTCAGTAAATATTTGTGGAGG - Intergenic
1021360072 7:19701739-19701761 TTTAAAGTAAATATCACTGGGGG - Intronic
1027568321 7:79827894-79827916 TCTCAGGTAAATACCTGTGGTGG - Intergenic
1028873699 7:95796712-95796734 TGTCAAGTAAATGTCTCTGTAGG + Intronic
1030456494 7:109781185-109781207 TGTTAAGTAAAATGCTCTGGTGG - Intergenic
1031199789 7:118666839-118666861 AGTTAGGGAAATAGCTTTGGAGG - Intergenic
1032207689 7:129882538-129882560 TCTTATTTAAATATCTCTTGTGG - Intronic
1035731581 8:1857191-1857213 TTTTAATTAAATATCTCTGATGG - Intronic
1036988148 8:13560426-13560448 TTTTAGGTGAACATCTGTGGGGG - Intergenic
1040681311 8:49813087-49813109 TGATAGATGAATATCTCTGCTGG + Intergenic
1040811255 8:51456140-51456162 TTTTAGAAAAATGTCTCTGGTGG - Intronic
1041765462 8:61413847-61413869 TGTAGGGTAAATGCCTCTGGTGG - Intronic
1044094752 8:88049423-88049445 TCTCAGGTAAATATCTCAGTGGG + Intronic
1048121081 8:131582621-131582643 TCTAAAGTAAATATCACTGGGGG + Intergenic
1050476449 9:6045942-6045964 TGTTAGGTGATTAGCTCTGGTGG + Intergenic
1056505244 9:87252161-87252183 TGGGAGGGAAATACCTCTGGTGG - Intergenic
1057967890 9:99522053-99522075 AATTAGATAAATATTTCTGGGGG - Intergenic
1059112462 9:111570182-111570204 TGATAGATAACAATCTCTGGGGG + Exonic
1060377125 9:123126359-123126381 TGTAAGGTAAATATGTCTTTTGG - Intronic
1062171085 9:135135095-135135117 TGTTAAGTAAATAGCACGGGTGG - Intergenic
1188225050 X:27587126-27587148 TGTTATTTAAATATCTATGAAGG + Intergenic
1189092973 X:38107097-38107119 AGTTTGGTAATTTTCTCTGGAGG - Intronic
1189458681 X:41218685-41218707 TGTTAGGTAAACATATCAAGTGG - Intronic
1191181009 X:57563771-57563793 TGTTAGGTGCATATCTCTTTAGG - Intergenic
1191780248 X:64856772-64856794 TGTTAGGTAATTTTCTGGGGGGG - Intergenic
1191972304 X:66830129-66830151 TGTTTTGTAAATATCTCTTAAGG - Intergenic
1193312593 X:80025323-80025345 TGTTAGATCAATTTCTGTGGTGG + Intronic
1193524964 X:82577748-82577770 TGTTAGGCCAATATCCCTGATGG - Intergenic
1193892941 X:87073555-87073577 TGTTAGGTAAATTCCTCTTGTGG - Intergenic
1194917517 X:99723339-99723361 TATTAGCTTCATATCTCTGGTGG - Intergenic
1195778125 X:108430512-108430534 TGTTAGTAAAATAACTCTAGTGG + Intronic
1197204785 X:123780421-123780443 TGCTTGGTAAATGCCTCTGGAGG - Intergenic
1197574094 X:128187042-128187064 GGTTAAGTAATCATCTCTGGTGG + Intergenic
1198318151 X:135490331-135490353 TTTTACTTAAATATCTCTGTTGG - Intergenic