ID: 963291745

View in Genome Browser
Species Human (GRCh38)
Location 3:143497316-143497338
Sequence CTGAGAGTAGGGAATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963291745_963291755 26 Left 963291745 3:143497316-143497338 CCCACTTCATTCCCTACTCTCAG 0: 1
1: 0
2: 4
3: 35
4: 310
Right 963291755 3:143497365-143497387 AAATATGGAGCATATAATTTAGG 0: 1
1: 0
2: 1
3: 44
4: 374
963291745_963291751 11 Left 963291745 3:143497316-143497338 CCCACTTCATTCCCTACTCTCAG 0: 1
1: 0
2: 4
3: 35
4: 310
Right 963291751 3:143497350-143497372 ATGCCTCCCTAGCTCAAATATGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963291745 Original CRISPR CTGAGAGTAGGGAATGAAGT GGG (reversed) Intronic
902346320 1:15820754-15820776 CTGGGAGTAGGGAATGGATGTGG - Intergenic
902998792 1:20249325-20249347 CTGAGAGGTGGAAATGAAGGAGG - Intergenic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
906784770 1:48605307-48605329 CAGAGAGTAGGAAATGAGGTTGG - Intronic
906995794 1:50792758-50792780 CTGTGAGTTGGGAATGACATGGG + Intronic
907873482 1:58464385-58464407 GGGAGAGGATGGAATGAAGTGGG + Intronic
907917282 1:58882626-58882648 CTGCGGGTGGGGGATGAAGTGGG + Intergenic
908918782 1:69165108-69165130 CTGATGGCAGTGAATGAAGTTGG - Intergenic
909503270 1:76359050-76359072 CTGAGAGTAGGGTAGGAAGAAGG + Intronic
910266297 1:85341441-85341463 CTAAGAAAATGGAATGAAGTTGG + Intronic
910827668 1:91427042-91427064 CAGGGAGAATGGAATGAAGTTGG - Intergenic
911170755 1:94768887-94768909 CAGGGTGTAGGGAATGAGGTAGG - Intergenic
911898054 1:103464906-103464928 CTGACAGTAGGGTATAGAGTAGG - Intergenic
912806110 1:112758364-112758386 CTCAGAGCAGGGAGTGGAGTGGG - Intergenic
913118257 1:115716402-115716424 CTGTGCTTAGGAAATGAAGTAGG - Intronic
913174545 1:116262176-116262198 TTGAGACTAGAGAATGAAGTTGG + Intergenic
913696337 1:121329503-121329525 CTGGAAGTTGGGAATGAAATAGG + Intronic
914141224 1:144950550-144950572 CTGGAAGTTGGGAATGAAATAGG - Intronic
914369285 1:147008062-147008084 CAGAGAGAATGGAATCAAGTTGG + Intergenic
916085344 1:161265032-161265054 CTGATAGGAGTGAAGGAAGTAGG + Intronic
916228602 1:162516415-162516437 CTAAAACAAGGGAATGAAGTAGG + Intronic
917009624 1:170456639-170456661 CTGAGAGAATGGAACCAAGTTGG - Intergenic
917080745 1:171254703-171254725 CTGAGAGTAGGGGCTGGAGGTGG - Intronic
917162984 1:172079216-172079238 CGGGGAGAATGGAATGAAGTTGG - Intronic
917599235 1:176558390-176558412 TTCAGACTAGGGAAAGAAGTCGG + Intronic
918021169 1:180693024-180693046 TTGAGAGAAGGTAATGAAATAGG + Intronic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
919220814 1:194625972-194625994 CAGAGAGAATGGAATAAAGTTGG + Intergenic
919443770 1:197674587-197674609 CAGAGAAAAGGGAATGAAGTTGG + Intronic
920006223 1:202835644-202835666 GTGGGAGGAGGAAATGAAGTGGG + Intergenic
920483661 1:206347869-206347891 CTGGAAGTTGGGAATGAAATAGG + Intronic
920562095 1:206946241-206946263 CTGGGAGTTGGGAATGGAGGGGG + Intronic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
921632422 1:217451757-217451779 CTGAAAACAGGGAATAAAGTGGG + Intronic
922716172 1:227873697-227873719 CGGGGAGAATGGAATGAAGTTGG + Intergenic
923236831 1:232042287-232042309 CTGAGAGTAGGCCCTCAAGTAGG + Intergenic
924273447 1:242359228-242359250 CTGTGAGGTGGGAGTGAAGTAGG + Intronic
924501221 1:244639693-244639715 ATGGGAGGAGGAAATGAAGTTGG - Intronic
1063554923 10:7069290-7069312 CTGAGAGTGGGAAATAAAGTGGG + Intergenic
1065251816 10:23823265-23823287 CTGAGAGCAGGCAAGGAAGCAGG - Intronic
1065422494 10:25561512-25561534 CTGGGAGTAGGGGAAGCAGTGGG + Intronic
1066432122 10:35362400-35362422 CTGGCAGTAGGGAAGGCAGTAGG + Intronic
1067093791 10:43285433-43285455 CTGTGAGCAGGGACAGAAGTTGG - Intergenic
1067942435 10:50668120-50668142 CTGGGGGTCGGGAATGGAGTGGG - Intergenic
1068963934 10:62893080-62893102 CTGAGAATAGGGAATGGTGAAGG - Intronic
1069120667 10:64566056-64566078 CAGAGAGAATGGAATCAAGTTGG - Intergenic
1069228382 10:65973689-65973711 CTCACAGTAGGAGATGAAGTGGG + Intronic
1069557050 10:69405285-69405307 CTGGGTCTAGTGAATGAAGTGGG + Intronic
1069642099 10:69962732-69962754 CTGAGAGGAGGGAGGGAGGTGGG - Intronic
1070516078 10:77208204-77208226 CTAAGAGAAGGGAATCAAGCTGG - Intronic
1070863679 10:79693078-79693100 CTGGGGGTCGGGAATGGAGTGGG - Intergenic
1071470693 10:85982102-85982124 GTGAGTCTGGGGAATGAAGTTGG + Intronic
1071621898 10:87128151-87128173 ATGAGAGGAGGAAATGAAGGTGG - Intronic
1071707440 10:88014344-88014366 CTGAGACTGGGCAATGAAGTAGG + Intergenic
1073891822 10:108111352-108111374 CTCTGAGAGGGGAATGAAGTAGG - Intergenic
1074735064 10:116422555-116422577 CTGACAGGAGGGAATGAATGAGG + Intergenic
1074743587 10:116508533-116508555 ATGAGGGTAGGGAGTGTAGTGGG + Intergenic
1075333748 10:121594368-121594390 CTAAGAGAAGGGAACGAGGTTGG - Intronic
1075444055 10:122501529-122501551 CTGCCAGCAGGGAAGGAAGTTGG - Intronic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1078763902 11:14275167-14275189 CTGATGGAAGGGAAAGAAGTTGG + Intergenic
1078844418 11:15108469-15108491 CTGAGGGCAGGGCATGATGTAGG + Intergenic
1080444171 11:32322463-32322485 TGGAGAGGAGGGAATGAACTTGG - Intergenic
1080755070 11:35189434-35189456 GGGAGAGTAGGGAAACAAGTGGG + Intronic
1081025857 11:38014342-38014364 TTGAGACTAGGTTATGAAGTGGG - Intergenic
1081425923 11:42926434-42926456 CTGATAGCTGTGAATGAAGTGGG - Intergenic
1083987007 11:66222157-66222179 CTGAGAGTGTGGCATGGAGTGGG + Intronic
1085763305 11:79260868-79260890 GTAAGAGAGGGGAATGAAGTGGG - Intronic
1085850236 11:80110887-80110909 CAGAGAGAATGGAATCAAGTTGG + Intergenic
1087296717 11:96386077-96386099 CCGAGACAAGTGAATGAAGTGGG - Intronic
1087603856 11:100350329-100350351 ATGAGAGCAGGGAATGGAGAGGG - Intronic
1088135312 11:106550056-106550078 CTGAGGGTAGGCAAAGAAGAGGG - Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1089032903 11:115351836-115351858 AAGAAAGTAGTGAATGAAGTAGG + Intronic
1089155242 11:116396981-116397003 ATGAGATTAAGGAATGAATTTGG + Intergenic
1089805843 11:121088086-121088108 GTGTGTGTGGGGAATGAAGTTGG + Exonic
1091276863 11:134358649-134358671 GTGAGAGAAGGGAAGGATGTAGG + Intronic
1093061905 12:14616283-14616305 GTAAGAGTAGGGAAGTAAGTGGG + Intronic
1093277539 12:17148508-17148530 CTCAGGGAAGGGGATGAAGTGGG + Intergenic
1093288378 12:17294672-17294694 ATGAGGGTAGGGAAGGAGGTAGG - Intergenic
1093898156 12:24599492-24599514 CTGACAGCAGGGAAATAAGTTGG + Intergenic
1095271771 12:40226883-40226905 CAGAGTCTAGGGAATGAAGGTGG - Intronic
1095435046 12:42177875-42177897 GATAGAGTAGGGAGTGAAGTTGG - Intronic
1095599916 12:44002538-44002560 CTGGGAGTTAGGGATGAAGTAGG - Intronic
1095646252 12:44551589-44551611 CTGAGGGTAGGCACTGAAGAAGG - Intronic
1095838332 12:46663438-46663460 CTGAGAGCAGGGAGTGGAGGAGG + Intergenic
1096259634 12:50082502-50082524 TTGAGAGAAGCAAATGAAGTTGG - Exonic
1096787832 12:54027826-54027848 CTGAGAGTCTTGAATGTAGTAGG - Intronic
1097207977 12:57339780-57339802 CAGAGAGAAGAGAATTAAGTAGG + Intronic
1097635042 12:62112580-62112602 CTGGGAGAAGGGAACCAAGTTGG - Intronic
1099682359 12:85844535-85844557 CTGAGAGGAGGCATTGGAGTAGG - Intergenic
1099859350 12:88208349-88208371 CTGAGACTAGGGCATGATCTGGG + Intergenic
1101629473 12:106478996-106479018 CAGAGAGAAAGGAATAAAGTAGG - Intronic
1101969446 12:109302668-109302690 CGCAGAGGAGAGAATGAAGTGGG - Intronic
1102654714 12:114472210-114472232 CTGTGAGTAGGAAAAGAAATTGG - Intergenic
1102881018 12:116485048-116485070 CAGAGAGTAAGGGATGAAGCTGG - Intergenic
1103620954 12:122186951-122186973 CTCATAGAAAGGAATGAAGTAGG + Intronic
1103845154 12:123896672-123896694 CTAACAGTAGGGAAGGAATTAGG + Intronic
1104071066 12:125345760-125345782 CTGAGAGCAGGAAATGAGGAAGG - Intronic
1104159978 12:126168664-126168686 CTGAGAGAAGGGAAGGAATGAGG + Intergenic
1105069517 12:133226234-133226256 TGGAGACTAGGGCATGAAGTAGG - Intronic
1107880662 13:44829479-44829501 CTGGGAGTAGGGTGTGAGGTTGG - Intergenic
1109061571 13:57628804-57628826 CTGAGATTAGTAAATGAAGTTGG + Intergenic
1110161604 13:72385159-72385181 CTGTGAGATGGGAATGAACTTGG - Intergenic
1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG + Intronic
1112582525 13:100688727-100688749 CTCTGAGTAGGGAATGCAGTAGG - Intergenic
1112790922 13:103001452-103001474 CTGCCAGTAGGGAATTAGGTAGG + Intergenic
1115401269 14:32963483-32963505 GTGAGGGGAGGGAATGGAGTGGG + Intronic
1117030688 14:51666533-51666555 CTAGGAGTGGGGACTGAAGTGGG + Intronic
1118012970 14:61628800-61628822 CTGAGTGTAGGGAGTGCACTGGG - Intronic
1118250830 14:64159328-64159350 CTGAGAGCAGTGAAGGGAGTTGG + Exonic
1118489747 14:66247568-66247590 CAGAGAGAAGGGAATTAGGTGGG - Intergenic
1118730930 14:68665818-68665840 CTGAGAGCAGGGCATGGTGTGGG - Intronic
1119680005 14:76585103-76585125 CTGGGAGAAGGGAAAGAAGGAGG + Intergenic
1119866225 14:77977415-77977437 CTGAGAGAGGGGAGAGAAGTGGG + Intergenic
1120486468 14:85120257-85120279 TGGTGAGTGGGGAATGAAGTGGG - Intergenic
1121125717 14:91405410-91405432 CTGAGGGCTTGGAATGAAGTGGG - Intronic
1121235139 14:92386614-92386636 GTGAGAGGAGAGAATGAGGTTGG - Intronic
1122690596 14:103530438-103530460 CTGACAGCAGGGAGTGAAGGTGG + Intronic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1124217752 15:27823024-27823046 CTGTGTGTACGGAATGAGGTAGG + Intronic
1124378910 15:29148133-29148155 CTGAGAGGTGGGAAGGAAATAGG + Intronic
1125971513 15:43915754-43915776 CTGAGAGAAGGGGGTGAAGTAGG - Intronic
1127232693 15:57014352-57014374 CTGATGGTAGGGAATGAGGAAGG - Intronic
1128338345 15:66802797-66802819 CTGTGAGTAGGGGAAGAGGTGGG + Intergenic
1129043832 15:72715045-72715067 CTGGGAGTAGAGAGAGAAGTAGG + Intronic
1130170754 15:81510514-81510536 CTGGGAGTACTGAATGAATTTGG + Intergenic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1131761604 15:95628795-95628817 CTGAATGTTGGAAATGAAGTTGG + Intergenic
1132298610 15:100762959-100762981 CTGACAGAGGAGAATGAAGTAGG + Intergenic
1137379504 16:47984217-47984239 CAGAGAATAGGGAGTGAAGGAGG + Intergenic
1138207694 16:55136866-55136888 GTGGGAGGAGGGAGTGAAGTAGG + Intergenic
1141162520 16:81638797-81638819 CTGAGAGCAGGGAATCCAGGAGG + Intronic
1141238375 16:82241893-82241915 CTGGGAGTAGAGAGTGAGGTTGG + Intergenic
1144275960 17:13668187-13668209 CTGGGAGCAGGGAGTGAAGCTGG - Intergenic
1145847763 17:28057249-28057271 CTCAAAGTAGGTAATGCAGTTGG - Intronic
1147241407 17:39093177-39093199 CTGGGGGCAGGGACTGAAGTGGG - Intronic
1148201723 17:45753826-45753848 CTGTGGGTAGGGACTGAGGTGGG + Intergenic
1151700204 17:75738722-75738744 CTCAGAGTAGGGATTGTAGGCGG + Intronic
1154186397 18:12187807-12187829 ATGGGAGTAGGGATTGAAATGGG - Intergenic
1155680850 18:28483691-28483713 CTCTGAGCAGGGAAAGAAGTGGG + Intergenic
1156032393 18:32727381-32727403 CTGAGATTAGCAAATGAACTGGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159514497 18:69440119-69440141 CTGAGAAGAGGGAGAGAAGTGGG + Intronic
1159841148 18:73400310-73400332 CTGAAAGTAGAAAATGTAGTTGG - Intergenic
1160816143 19:1036643-1036665 CTGAGAGTGGGGAGAGAAGCTGG - Intronic
1165334344 19:35158487-35158509 CTGGGAGTAGGGACTGAAATGGG - Intronic
1165429778 19:35766066-35766088 CTGAGAGTAGGGAACAGATTTGG + Intronic
1166310572 19:41960028-41960050 TGGAGAGAAGGGAGTGAAGTTGG + Intergenic
1166395066 19:42433609-42433631 CTGAGAGTCAGGAAGAAAGTGGG + Intronic
1167717153 19:51150847-51150869 CTGAGAGCAGGAAATGACTTTGG + Intronic
1168078590 19:53993350-53993372 CTGAGAGCAGAGGACGAAGTGGG - Intronic
1168149248 19:54436044-54436066 GGGAGAGGAGGGAATGGAGTGGG - Intronic
925426362 2:3751725-3751747 CTGAGAGGAAGGAATGAATTAGG - Intronic
926475213 2:13313556-13313578 CAGAGAGAATGGAATCAAGTTGG - Intergenic
926859215 2:17291426-17291448 CTGAGAGGAGGCCGTGAAGTGGG + Intergenic
926958401 2:18327733-18327755 CAGAGAGTAGAGAATGAAATAGG - Intronic
928622768 2:33107914-33107936 CTGAGAGGAGGGAAGGGAGGAGG + Intronic
929106818 2:38373602-38373624 CTCAGAGTAGGTAGTGAAGGTGG + Intronic
931571206 2:63670989-63671011 CTCAGAGAAGGGAATGAAAGAGG + Intronic
932500603 2:72179732-72179754 CTGAGAGAAGAGAATGAATTAGG - Intronic
933270126 2:80224334-80224356 CTTAGAGTCGGGAATGACATTGG + Intronic
933272516 2:80248417-80248439 CAAAGAGTAGGGAATGAATTAGG - Intronic
934509935 2:94929589-94929611 CTGAGAGCAGGGACTGAAACAGG + Intergenic
935517781 2:104064395-104064417 CTGGGGGTAGGGAGTAAAGTGGG + Intergenic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
937058978 2:118967465-118967487 CTGAGAGCAGGGAATGACTTGGG + Intronic
937373286 2:121317482-121317504 CTGAGAGTGAGAGATGAAGTCGG + Intergenic
937420963 2:121755194-121755216 CTGTGAGTAGGGAATGGATTGGG - Intronic
938114882 2:128596200-128596222 CGGAGAGGAGGAAATGAAGGTGG + Intergenic
940915824 2:159254784-159254806 CTGAGAGTAGGTAATAGAGTAGG - Intronic
941674717 2:168331473-168331495 CTGAGAGTGGGGTATGAATCTGG - Intergenic
942493667 2:176516299-176516321 CTGTGATTAGGGAATGAGGTTGG + Intergenic
942677206 2:178440341-178440363 CTGAGAGTAGTGTATTAGGTGGG - Intronic
942685524 2:178527055-178527077 CTGAGTTTAGGGAATGAATTTGG - Exonic
942989339 2:182180683-182180705 CTGGGAGAATGGAATCAAGTTGG - Intronic
944440841 2:199742011-199742033 CGGAGGGTAGGAAATGAAGCTGG - Intergenic
944629972 2:201614102-201614124 CAGAGAGAATGGAATCAAGTTGG + Intronic
944883260 2:204037140-204037162 CAGAGAGAAGGGATTGAAGAGGG + Intergenic
945067524 2:205959770-205959792 GTGAAAGTAGGGAATGAATAGGG + Intergenic
946978121 2:225175751-225175773 CTGTAAGTAGGGAAGGTAGTAGG + Intergenic
947992938 2:234501075-234501097 CTGGGAGTCGAGAATGAAGGAGG + Intergenic
948908600 2:240991785-240991807 CTGAGGGCACGGAATGAAGCCGG - Intronic
949073063 2:242038448-242038470 CTGAGAGAAGAGGATGGAGTGGG + Intergenic
1169362385 20:4961986-4962008 GTGAGAGAAGGGCAGGAAGTTGG + Intronic
1170205936 20:13798599-13798621 CTGACAGTTGGGAAAGAAATCGG + Intronic
1170522056 20:17196925-17196947 GTGAGAGAAGGGAATGTAATTGG + Intergenic
1171428173 20:25061490-25061512 TTGAGACTAGGGAATGAGGGCGG - Intergenic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173262911 20:41452285-41452307 CTGGGAGCAGGGAATAAATTTGG + Intronic
1173654860 20:44692992-44693014 CTGTGAGTAGGCAGTGAAGGTGG - Intergenic
1174329531 20:49807116-49807138 ATGAGAGGAGAGAGTGAAGTGGG - Intergenic
1177330111 21:19648371-19648393 CTGAAAGTATGGAATCAAGAAGG - Intergenic
1178096643 21:29222642-29222664 CTGAGAGTAGGGAGTCAAAATGG + Intronic
1178321381 21:31608543-31608565 CTCAAAGCAGGGGATGAAGTGGG - Intergenic
1179025407 21:37675302-37675324 CAGAGAGGAAGGAATCAAGTTGG + Intronic
1179170882 21:38971898-38971920 CGGAGAGTAGGGAAGGGAGAGGG - Intergenic
1181002318 22:19993636-19993658 CTCAGAGTTGGGCATGAAGCTGG - Intronic
1182356609 22:29725015-29725037 CTCACAGTAGGGGATGCAGTGGG - Intronic
1182489413 22:30660949-30660971 CTGAGATTAGAGAATGAAACAGG - Intronic
1182694636 22:32188855-32188877 ATGAGAGAAGAGAATGATGTGGG - Intergenic
1182845943 22:33430988-33431010 CTGAGACCAGCAAATGAAGTGGG - Intronic
1183983664 22:41557538-41557560 CAGAGAGCAGTGAATGAAGGAGG - Intergenic
1184103368 22:42353396-42353418 TGGAGAGTAGGGAAGGAAGGAGG + Intergenic
1185058335 22:48592658-48592680 CTGAGAGGAGGGAGTGAGGGAGG - Intronic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
953794686 3:45975513-45975535 CAGAGAGTAAGGCTTGAAGTGGG + Intronic
953906343 3:46870205-46870227 GTGAGAGGTGGGAATGAATTTGG - Intronic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
956049765 3:65235386-65235408 TTCAGAGTAGGGCATGGAGTAGG - Intergenic
956075077 3:65496388-65496410 CGGAGAGTAGGGCAGGAGGTGGG + Intronic
956280859 3:67555205-67555227 CTGAGATTTAGGAATGAAATTGG + Intronic
956857245 3:73287257-73287279 CTGGGAGCATGAAATGAAGTGGG + Intergenic
956954895 3:74325965-74325987 CTTAGAGTAAGAAATCAAGTAGG - Intronic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
957708263 3:83818462-83818484 CTGTCAGTAGGGAAAGACGTAGG + Intergenic
958457214 3:94347180-94347202 CTGAGAGTCAGGAATGAGATTGG - Intergenic
958595374 3:96215961-96215983 CTCTGAGTGGGGAATGAGGTAGG - Intergenic
960278328 3:115752419-115752441 CTGGGAGAATGGAATCAAGTTGG + Intergenic
960404893 3:117247689-117247711 CTGGGAGCAGGGCATGAAGCTGG + Intergenic
961943557 3:130661859-130661881 CTGAGTGTTGGGTAGGAAGTCGG - Exonic
962503262 3:136017869-136017891 CTTAGAGTAGGAAAGGCAGTTGG - Intronic
962598961 3:136976207-136976229 CTCAGAGAAGGGAGTGAAGCTGG + Intronic
963291745 3:143497316-143497338 CTGAGAGTAGGGAATGAAGTGGG - Intronic
966291341 3:178362657-178362679 CAGAGAGAATGGAATCAAGTTGG + Intergenic
967531729 3:190555317-190555339 CTGAGAGTAGGGAGTAGAGAAGG - Intronic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
970217855 4:13778475-13778497 CAGAGAGTTGGGAATGGGGTAGG - Intergenic
970539973 4:17067866-17067888 CTAAGGGTAGGGAATGAGGGAGG - Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
970775574 4:19670092-19670114 CTGGGAGAATGGAATCAAGTTGG + Intergenic
971392790 4:26201749-26201771 TTGAGTGGAGGGCATGAAGTAGG - Intronic
973802425 4:54492389-54492411 CTGAGATTAGAGAAAGAAGTGGG - Intergenic
975479491 4:74861359-74861381 CAGAGAGAATGGAATCAAGTCGG + Intergenic
976103015 4:81585787-81585809 TGGAGATTAGGGAAAGAAGTGGG + Intronic
976148466 4:82067636-82067658 CTTAGATGAGGGAATGAAGCAGG - Intergenic
977942646 4:102875817-102875839 CTGGGAGAAACGAATGAAGTAGG - Intronic
978414011 4:108456790-108456812 ATGATAGGAGGGAAGGAAGTAGG - Intergenic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
980491806 4:133537599-133537621 CAGAGAGTAGGAAATGACCTGGG - Intergenic
981561472 4:146053021-146053043 CTGAGAGCAAGGAATGAACATGG - Intergenic
982321069 4:154078022-154078044 CTGACAGGAGGAAAGGAAGTGGG - Intergenic
984959166 4:185077810-185077832 CTGAGAGAATGAAATGAAGCGGG - Intergenic
985301248 4:188492288-188492310 ATGAGAGTGGGGAATGCAGGGGG - Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
986207015 5:5634451-5634473 CTGAGAGCTGGGAAGGAGGTTGG - Intergenic
986283978 5:6346517-6346539 GTGAGAGGAGGGAAGGAAGGAGG + Intergenic
986626079 5:9725089-9725111 CTGAGAGAAGGGGGTGAACTAGG + Intergenic
986943172 5:12981626-12981648 CTGAAAGGAGATAATGAAGTGGG + Intergenic
987682709 5:21158743-21158765 CTTAGAGGAGGAAATGGAGTTGG + Intergenic
988958512 5:36345142-36345164 CTGAGAGTTGGGAATGGGGAGGG + Intergenic
992088360 5:73297898-73297920 GAGAGAGTAGGGAAAGAGGTTGG + Intergenic
992187680 5:74259888-74259910 CTGAGGGTAGGGAATGGAGGTGG - Intergenic
992850122 5:80798374-80798396 CTGAGATAAGGGAAGGAATTGGG - Intronic
994292533 5:98045685-98045707 CTGAGATAAGGGAATAAATTAGG + Intergenic
995867801 5:116710220-116710242 CTGAGAGAAGGGAATGAATGAGG + Intergenic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997508441 5:134436742-134436764 CTGAGAGCACAAAATGAAGTTGG + Intergenic
998025631 5:138813537-138813559 GTGGGAGTAGGGAATGGATTTGG + Intronic
998164253 5:139833656-139833678 CTAAGAGTAGGGAAGGAGGCTGG - Intronic
998779986 5:145646130-145646152 CTGGGAGTATGGAACCAAGTTGG - Intronic
999222107 5:149988902-149988924 CTGTGAGGTGGGAATGAGGTTGG - Intronic
1001606085 5:172960710-172960732 ATGAGAGGAGGGAAGGGAGTTGG + Intronic
1003822717 6:9917920-9917942 CTGAGAGTAGGGAAGGAAAATGG - Intronic
1006123434 6:31821791-31821813 GGGAGAGTAGGGGATGGAGTCGG - Intergenic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006603006 6:35238234-35238256 ATGAGAGTAGGGAAACAAGGTGG - Intronic
1006701229 6:35975290-35975312 TTCAGAGTAGGGAATTAAATGGG - Intronic
1007614901 6:43174133-43174155 GTGAGAGGAGGGAAGGGAGTGGG + Intronic
1008584771 6:52938570-52938592 CTCAGGGTGGGGAATGAGGTGGG + Intergenic
1008645508 6:53510127-53510149 CTGAGAGTAGGGGATGGCTTAGG + Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1010390657 6:75332841-75332863 CTGAGACTAGTCAAAGAAGTTGG + Intronic
1010614960 6:78001593-78001615 CTAAGAGTGCGGAATGAGGTGGG + Intergenic
1010923903 6:81720104-81720126 ATGAGATTAAGGAAGGAAGTAGG + Intronic
1011485020 6:87832277-87832299 GTGGGTGTAGGGGATGAAGTGGG + Intergenic
1012345464 6:98179999-98180021 CTGAGAGTGGGTACTCAAGTGGG - Intergenic
1012573762 6:100764730-100764752 CTTAGATTAGGTCATGAAGTAGG - Intronic
1013626165 6:111939207-111939229 CAGAGAGTAGGTTATGAACTAGG + Intergenic
1013768879 6:113604987-113605009 ATAAGAGTTGGAAATGAAGTGGG - Intergenic
1015155593 6:130091864-130091886 CAGGGAGTAGGGCATAAAGTGGG + Intronic
1017359882 6:153555372-153555394 ATGAGAGTAGGGGATGATGTTGG - Intergenic
1021226162 7:18028846-18028868 GTGAGAGTTGAGAATGAAGGAGG + Intergenic
1021228407 7:18056038-18056060 AACAGAGTAGGGAATGAAGTAGG + Intergenic
1021805790 7:24353681-24353703 CAGGGAGAAAGGAATGAAGTTGG + Intergenic
1021902137 7:25296653-25296675 CAGAGAGTAAGGAAAGAAGTTGG - Intergenic
1022495154 7:30848458-30848480 ATGAGAGCAGGGCATGAAGCAGG + Intronic
1023129095 7:36984870-36984892 CAGAGAGTGGGGGCTGAAGTTGG - Intronic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1026500050 7:70936399-70936421 CTGAGAGATGAGAATGAAGTGGG + Intergenic
1026846269 7:73700630-73700652 CTGAGAGAAGGGAGAGAGGTGGG + Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027585311 7:80049705-80049727 CTGTGAGTAGGGGATGTATTTGG - Intergenic
1028064489 7:86365510-86365532 CTTAGAGTAGGGAAGAATGTGGG + Intergenic
1028916091 7:96260830-96260852 TTGAGAGAATGGGATGAAGTGGG - Intronic
1029048931 7:97662893-97662915 ATGAGAGTAGGAAATGAAAGTGG - Intergenic
1029145015 7:98439649-98439671 CTCAGTGGAGGGAAGGAAGTGGG - Intergenic
1029968346 7:104764037-104764059 CTGAGAAGAAAGAATGAAGTAGG - Intronic
1030334592 7:108311016-108311038 CTGAGAGTGGGCTAGGAAGTGGG + Intronic
1030419505 7:109290134-109290156 CTGAGGGTAGGGCATAATGTGGG + Intergenic
1030470556 7:109957838-109957860 CTGAGAGTACTGAATCAAGGAGG + Intergenic
1030857205 7:114574578-114574600 TAGAGAGTAGTGAATGAACTTGG - Intronic
1031140585 7:117938440-117938462 CTGAGAGATGTGAATGAAGATGG + Intergenic
1032550826 7:132782341-132782363 GTTAGAGGAGGGAATGAAGATGG + Intergenic
1033017291 7:137684788-137684810 CTGGGAGTGGGGAAAGATGTGGG + Intronic
1033550391 7:142441693-142441715 GAGTGAGAAGGGAATGAAGTGGG - Intergenic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1035906964 8:3522555-3522577 CTGAGAATAGAGAAAGAAATGGG + Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG + Intergenic
1038119268 8:24593924-24593946 CTTAGAGTCAGGAATGAAGTGGG + Intergenic
1039197107 8:35044928-35044950 TTGCAAGTAGGGAAAGAAGTAGG - Intergenic
1041378465 8:57226114-57226136 AAGAGATTAGAGAATGAAGTAGG + Intergenic
1042012739 8:64266530-64266552 CTGAAAGAAGGTAATGATGTAGG - Intergenic
1043263962 8:78238790-78238812 CTTAGAGTACACAATGAAGTAGG - Intergenic
1043389874 8:79782209-79782231 CTGAGATTTGGGAGTGGAGTTGG + Intergenic
1044361014 8:91283728-91283750 CTGAGAGTTGGGAGTGGAGATGG - Intronic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1048336244 8:133504490-133504512 CTGAAAGTGGGTAGTGAAGTGGG + Intronic
1048851527 8:138649779-138649801 CTGAGAGTGGGGAGAGAGGTGGG + Intronic
1052608172 9:30732552-30732574 CTGGGAGTGGGGAATGGAGTGGG + Intergenic
1053070661 9:35099861-35099883 CTTTGATTGGGGAATGAAGTTGG - Intronic
1054992289 9:71343088-71343110 CTTAGAGTAGGGAAGGGAGGGGG + Intronic
1057172823 9:92974014-92974036 CTGAGAGACGGGAATGAATGAGG - Intronic
1058194562 9:101956689-101956711 CTCTGAGGAGGCAATGAAGTGGG + Intergenic
1058211291 9:102173288-102173310 CGGGGAGAAGGGAACGAAGTTGG - Intergenic
1059935400 9:119305448-119305470 CTGATAGTAGGGCATAAGGTTGG - Intronic
1060498469 9:124134892-124134914 GTCAGAGTAGGGGAGGAAGTGGG - Intergenic
1061211118 9:129194044-129194066 GGGAGAGCAGGGAATGAGGTGGG - Intergenic
1061473264 9:130844208-130844230 CTGATAGTAGGGAGTGGAGGTGG + Intronic
1186187279 X:7033589-7033611 CTGAGTGTAGGGTGTGGAGTGGG + Intergenic
1188114059 X:26222732-26222754 CTGAGAATAGGGGATGAATTTGG - Intergenic
1188715446 X:33454873-33454895 CTTGTAGTAGGGTATGAAGTTGG - Intergenic
1189721704 X:43926392-43926414 CAGAGAGAATGGAATCAAGTTGG - Intergenic
1190553973 X:51615208-51615230 CAGAGAATAGGGTATGAGGTGGG + Intergenic
1191147948 X:57188983-57189005 CTGGGAGAATGGAATCAAGTTGG - Intergenic
1191969042 X:66793634-66793656 CGGGGAGAATGGAATGAAGTTGG - Intergenic
1194696527 X:97058806-97058828 ATGAGAGGAGGGATTGATGTGGG + Intronic
1195504564 X:105642506-105642528 CTGAGGGAAGGAAATGCAGTTGG - Intronic
1196887977 X:120265372-120265394 TTGAGCCTAGGGAAAGAAGTGGG + Intronic
1196946435 X:120831655-120831677 CTGAGAGAATGGAACCAAGTTGG - Intergenic
1197565231 X:128075763-128075785 CTGACATTAGAGAATGAATTAGG - Intergenic
1198337362 X:135679651-135679673 CCAAGGGTAGGGAATGGAGTGGG + Intergenic
1198361832 X:135903163-135903185 CCAAGGGTAGGGAATGGAGTGGG - Intronic
1198928695 X:141828050-141828072 CTAAGGGTAGAGAATGAAGAAGG - Intergenic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1199456811 X:148038264-148038286 CTGAGAGTGTTGAATGAGGTAGG + Intergenic