ID: 963292196

View in Genome Browser
Species Human (GRCh38)
Location 3:143503461-143503483
Sequence GCTTTGGAGGGTCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963292196_963292204 12 Left 963292196 3:143503461-143503483 CCCTTGAGGGGACCCTCCAAAGC 0: 1
1: 0
2: 2
3: 11
4: 69
Right 963292204 3:143503496-143503518 CTTCATGATGTCATCATATTTGG 0: 1
1: 10
2: 19
3: 39
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963292196 Original CRISPR GCTTTGGAGGGTCCCCTCAA GGG (reversed) Intronic
903220057 1:21864469-21864491 TCTCTGGTGGGCCCCCTCAAGGG + Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
914882498 1:151558348-151558370 CCTTTGAGGGATCCCCTCAAAGG + Intronic
915979582 1:160411424-160411446 GGTTTGGAGGGTCCCCTGGGTGG - Intronic
918498778 1:185170513-185170535 GCTCTGGAGGCTCTCCTGAATGG - Intronic
920988702 1:210915143-210915165 GCTTTTGAGGAATCCCTCAAAGG - Intronic
922969695 1:229725781-229725803 GCTTTGGAGAGTCTCCATAAAGG + Intergenic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1069676677 10:70253771-70253793 GCCTTGGAGGGTCCTTTCACAGG - Exonic
1081070236 11:38602361-38602383 GCTTTGGAGAATCCCCTTACAGG - Intergenic
1084424248 11:69076146-69076168 GCTTCGGAGGGTCCCCTTCCAGG - Intronic
1084429895 11:69105360-69105382 GGTTTGAAGGGGCCCCTCCATGG + Intergenic
1088727852 11:112655401-112655423 GATGTGGATGGTCTCCTCAAGGG + Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1097991032 12:65834254-65834276 CCTTTGGAGTGGCCCTTCAAAGG - Intronic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1110760889 13:79229068-79229090 CCTTTGGAGCTTCCCCTCAGAGG - Intergenic
1111094187 13:83489512-83489534 GATTTGAAGAGTGCCCTCAAGGG - Intergenic
1114413091 14:22518729-22518751 CCTTTGGAGGGTCCCTTCTCAGG + Intergenic
1119547426 14:75482471-75482493 GCTGTGGAGAGTCCCCACCAGGG - Intergenic
1126398599 15:48245880-48245902 GCTTTCCAGGGCCACCTCAAAGG - Intronic
1128947622 15:71840176-71840198 TGTTTCCAGGGTCCCCTCAAGGG - Intronic
1130248816 15:82281620-82281642 GCTTTGGAGAGACTCATCAAAGG - Intronic
1130451242 15:84054532-84054554 GCTTTGGAGAGACTCTTCAAAGG + Intergenic
1132191739 15:99867992-99868014 GCTTTGGTGGGTACCATCAGGGG + Intergenic
1135190379 16:20349318-20349340 GTTTTGGAGGGAGCCCTCTAGGG - Intronic
1138525203 16:57601219-57601241 GTTTTTGAGGGGCCACTCAAGGG - Intergenic
1141926566 16:87173952-87173974 GCTGTGGTGGGTCCCATCCATGG + Intronic
1142059315 16:88019442-88019464 GCTCTGGAGAGTCACCTCAGGGG + Intronic
1144548102 17:16215870-16215892 GGTTTGCAGGGTCCCTTCCACGG - Intronic
1147769112 17:42855704-42855726 GCTCAGGAAGGTTCCCTCAAAGG - Intronic
1151774422 17:76189743-76189765 GCTTCGGAGGGTCCCTTCTCCGG - Intronic
1153784798 18:8525079-8525101 GTTTTGCAGGGACCCTTCAAAGG - Intergenic
1157546069 18:48547324-48547346 TCTTTCCAGGGTCCCCTTAAGGG + Intronic
1157592285 18:48843070-48843092 GGGTGGGAGGCTCCCCTCAAAGG - Intronic
1160576265 18:79855680-79855702 GCCGTGCAGGGTCCCCTCCACGG - Intergenic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
937482623 2:122278030-122278052 GCATTGGAGTTTCCCCTCCACGG - Intergenic
938036277 2:128037651-128037673 CCTTTCGAGGGTCCCATCAGGGG + Intergenic
944212455 2:197220566-197220588 GCTGTGGAGCCTCCCCACAAAGG - Intronic
946321333 2:218956108-218956130 GCTTTAGAGGGGCCCCTGAAAGG - Intergenic
1173337334 20:42123507-42123529 GCCAAGGAGGGTCCCCTCAGAGG + Intronic
1173639767 20:44592710-44592732 GCTTCAGAGGCTCCTCTCAAAGG - Intronic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1179580952 21:42343673-42343695 CCTTTGGGGGGTCCCCCCAGGGG - Intergenic
1181404721 22:22674655-22674677 TCTTTGGAGTGTTCCCTCAAGGG - Intergenic
1181413294 22:22740169-22740191 TCTTTGGAGTGTTCCCTCAAGGG - Intronic
952228524 3:31404365-31404387 GCTTTGGAGTGTTCCCTCTATGG - Intergenic
953930482 3:47003429-47003451 GCTTTGGACAGTCCCTTCAGGGG - Intronic
956836346 3:73099342-73099364 GCTTTGGAGGGTGACCTCCTTGG + Intergenic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
964479348 3:157126633-157126655 GCTTTGGGGTGTCATCTCAAAGG + Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976223670 4:82778486-82778508 CCTTTGGAAGGTCCCTACAAGGG + Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977178085 4:93839543-93839565 GCTTTGGAGGGTCTCCCAAATGG - Intergenic
979540769 4:121878821-121878843 GTTTTGGAGGGTCTGCTCATGGG - Intergenic
989260251 5:39411542-39411564 GCCTTGGAGGATCCACTCCATGG + Intronic
990740614 5:58908832-58908854 GCCATGGAGGGACCCCTCAGTGG + Intergenic
1000300312 5:159950686-159950708 GCATTGGAGTGTCCCCCCAAGGG - Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1006238800 6:32659801-32659823 GGTTTGCTGGGTCACCTCAAGGG + Exonic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1022944132 7:35265173-35265195 GCTAAGGAGAGTCACCTCAACGG - Intergenic
1023863760 7:44229312-44229334 GCTCTGGAGTGGCCCCTCTAGGG + Intronic
1023888125 7:44375171-44375193 CCCTGGGAGGGTCCCCTCAGAGG - Intergenic
1025712947 7:63928246-63928268 GCTCTGGAAGGACCCCTGAAGGG - Intergenic
1034434161 7:151055198-151055220 GGTCTGGAGGGTCCCCTCTGGGG - Intronic
1034971005 7:155419064-155419086 GCTGTGGAGGGTCTTCTCCAAGG + Intergenic
1035388815 7:158491401-158491423 GGATTGGAGGCTCCCGTCAATGG - Intronic
1035773973 8:2173315-2173337 ACTTTTGAGGGTCTCCTAAAAGG - Intergenic
1035975759 8:4309378-4309400 GCTTTTGAGGGTCTTCTCTAAGG - Intronic
1039744411 8:40410955-40410977 GCCTTTCAGAGTCCCCTCAAAGG + Intergenic
1040079634 8:43274344-43274366 GCTGAGGAGGGTCCCCTCTGGGG - Intergenic
1040893576 8:52341872-52341894 GGTGTGGAGGATCCCCTCATGGG + Intronic
1056088948 9:83185706-83185728 GCCTTAGAGAGTCCCCTCAGAGG - Intergenic
1062395238 9:136350143-136350165 GGTCTGGAGGGTCCCAACAAAGG - Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189973394 X:46439899-46439921 GCGTTGAAGGCCCCCCTCAAGGG - Intergenic
1192221834 X:69202718-69202740 GGTCTGGAGGGTCTGCTCAAGGG + Intergenic