ID: 963295488

View in Genome Browser
Species Human (GRCh38)
Location 3:143541626-143541648
Sequence TGGACATGGGTCATTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 2, 2: 0, 3: 12, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963295488_963295492 -10 Left 963295488 3:143541626-143541648 CCTTGAGCAATGACCCATGTCCA 0: 1
1: 2
2: 0
3: 12
4: 115
Right 963295492 3:143541639-143541661 CCCATGTCCAGGTTGACCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 123
963295488_963295496 2 Left 963295488 3:143541626-143541648 CCTTGAGCAATGACCCATGTCCA 0: 1
1: 2
2: 0
3: 12
4: 115
Right 963295496 3:143541651-143541673 TTGACCCTGGGTTGGAAAACTGG 0: 1
1: 0
2: 0
3: 17
4: 164
963295488_963295494 -6 Left 963295488 3:143541626-143541648 CCTTGAGCAATGACCCATGTCCA 0: 1
1: 2
2: 0
3: 12
4: 115
Right 963295494 3:143541643-143541665 TGTCCAGGTTGACCCTGGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963295488 Original CRISPR TGGACATGGGTCATTGCTCA AGG (reversed) Intronic