ID: 963295488 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:143541626-143541648 |
| Sequence | TGGACATGGGTCATTGCTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 130 | |||
| Summary | {0: 1, 1: 2, 2: 0, 3: 12, 4: 115} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963295488_963295492 | -10 | Left | 963295488 | 3:143541626-143541648 | CCTTGAGCAATGACCCATGTCCA | 0: 1 1: 2 2: 0 3: 12 4: 115 |
||
| Right | 963295492 | 3:143541639-143541661 | CCCATGTCCAGGTTGACCCTGGG | 0: 1 1: 0 2: 0 3: 11 4: 123 |
||||
| 963295488_963295496 | 2 | Left | 963295488 | 3:143541626-143541648 | CCTTGAGCAATGACCCATGTCCA | 0: 1 1: 2 2: 0 3: 12 4: 115 |
||
| Right | 963295496 | 3:143541651-143541673 | TTGACCCTGGGTTGGAAAACTGG | 0: 1 1: 0 2: 0 3: 17 4: 164 |
||||
| 963295488_963295494 | -6 | Left | 963295488 | 3:143541626-143541648 | CCTTGAGCAATGACCCATGTCCA | 0: 1 1: 2 2: 0 3: 12 4: 115 |
||
| Right | 963295494 | 3:143541643-143541665 | TGTCCAGGTTGACCCTGGGTTGG | 0: 1 1: 0 2: 0 3: 13 4: 177 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963295488 | Original CRISPR | TGGACATGGGTCATTGCTCA AGG (reversed) | Intronic | ||