ID: 963295488

View in Genome Browser
Species Human (GRCh38)
Location 3:143541626-143541648
Sequence TGGACATGGGTCATTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 2, 2: 0, 3: 12, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963295488_963295492 -10 Left 963295488 3:143541626-143541648 CCTTGAGCAATGACCCATGTCCA 0: 1
1: 2
2: 0
3: 12
4: 115
Right 963295492 3:143541639-143541661 CCCATGTCCAGGTTGACCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 123
963295488_963295494 -6 Left 963295488 3:143541626-143541648 CCTTGAGCAATGACCCATGTCCA 0: 1
1: 2
2: 0
3: 12
4: 115
Right 963295494 3:143541643-143541665 TGTCCAGGTTGACCCTGGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 177
963295488_963295496 2 Left 963295488 3:143541626-143541648 CCTTGAGCAATGACCCATGTCCA 0: 1
1: 2
2: 0
3: 12
4: 115
Right 963295496 3:143541651-143541673 TTGACCCTGGGTTGGAAAACTGG 0: 1
1: 0
2: 0
3: 17
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963295488 Original CRISPR TGGACATGGGTCATTGCTCA AGG (reversed) Intronic
902234481 1:15048711-15048733 TGGTCCTGGGTCGTTGGTCATGG + Intronic
911355040 1:96806283-96806305 TGGTCATGGATCATGGTTCAAGG - Intronic
912841568 1:113043825-113043847 AGGAAATGGGTCACTGCCCATGG - Intergenic
916828008 1:168462421-168462443 TGGACATAGTCCATTTCTCAAGG - Intergenic
919130437 1:193443649-193443671 TGTTCAAGGGTCATTCCTCAAGG - Intergenic
919802267 1:201361108-201361130 TGGACATGGAACACTGCTGAAGG + Intronic
920420352 1:205828908-205828930 TGCACATTGGTCGTTTCTCAGGG + Intronic
922079978 1:222286279-222286301 TTTGCCTGGGTCATTGCTCAGGG - Intergenic
1065776468 10:29125122-29125144 AGGAGATGGGCCTTTGCTCAAGG + Intergenic
1068708700 10:60107430-60107452 TGAACAAGGGTCTTTGATCAAGG + Intronic
1068777886 10:60887746-60887768 TTGTCATGGGTCAGTGCTGAAGG + Intronic
1070555217 10:77522234-77522256 TGGAGATGGCTCATGGCTCATGG - Intronic
1072171026 10:92861699-92861721 TGGATGTGGGTCATGGGTCAAGG + Intronic
1072238619 10:93474665-93474687 TGTACATGTGACATTGCACATGG - Intronic
1076045024 10:127285611-127285633 TGGACATGGCTCCCTGCTAAGGG - Intronic
1076058891 10:127397897-127397919 ATGACATGGGTCATGGCTCCTGG + Intronic
1083365691 11:62140337-62140359 TGGCCTTGTGTCCTTGCTCAGGG + Intronic
1087020111 11:93594138-93594160 TGGTTATGGTTCATTTCTCATGG + Intergenic
1089415934 11:118290611-118290633 TGGAGGTGGGTCATGGATCATGG - Intergenic
1089458328 11:118638677-118638699 GGCACAGGGGTCATTGGTCAAGG + Intronic
1093071639 12:14711687-14711709 TGGACATGGGTAAGTGTGCAAGG + Intergenic
1097770212 12:63575020-63575042 AGCACATGGATCATTCCTCAAGG + Intronic
1098954508 12:76675822-76675844 TGGTGAGGGGTCATTCCTCATGG - Intergenic
1100371341 12:93971625-93971647 TGGGCATGGTTCATTGGTCCTGG + Intergenic
1101710880 12:107264548-107264570 TGGCCATGTGTGGTTGCTCACGG + Intergenic
1103943771 12:124514959-124514981 TGGGCATGGGTCGTAGCTTAGGG - Intronic
1104349523 12:128032847-128032869 TGGATATTGATCATTGATCAAGG - Intergenic
1104854880 12:131896826-131896848 TGCACATGCGTCATGGCTCTGGG + Intronic
1109331833 13:60940680-60940702 GGGCCATGGATCACTGCTCAGGG + Intergenic
1114565620 14:23630629-23630651 TGGACCTGTGTCATGGGTCATGG - Intronic
1120096385 14:80393312-80393334 GGGAAATGGGGCATTTCTCAAGG + Intergenic
1122375387 14:101253567-101253589 TGGACATGGGAAATTCCTCAGGG + Intergenic
1122696695 14:103557416-103557438 TTCACATGGGTAATTGGTCATGG - Intronic
1122772596 14:104103982-104104004 TGGACAAGGGTGTTTGCTCTGGG + Intronic
1125925857 15:43562562-43562584 TGGACTTGGGTCTTTTCTCATGG + Intronic
1125939001 15:43662113-43662135 TGGACTTGGGTCTTTTCTCATGG + Intronic
1126062145 15:44792978-44793000 TGGACATGGGTCATTTCTCACGG - Intergenic
1128325646 15:66722457-66722479 TGGGCATGGGTCATGCCTGAGGG - Intronic
1130417708 15:83709498-83709520 TGGATATTGGTCACTGCACATGG + Intronic
1132108734 15:99086465-99086487 TGGCCATGGGGCATTTGTCATGG + Intergenic
1133619937 16:7516533-7516555 TGGACAAGGTTAACTGCTCATGG + Intronic
1134268869 16:12716330-12716352 TACACATGAGGCATTGCTCAAGG + Intronic
1134828301 16:17302488-17302510 TTGACACAGGCCATTGCTCATGG - Intronic
1135994918 16:27240506-27240528 TGGACCTGGCCCAGTGCTCAGGG - Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1141336794 16:83163521-83163543 TGGACATGGGTGAGTGCCAATGG - Intronic
1146572635 17:33966054-33966076 TGTACATGGGCTATTGTTCAAGG + Intronic
1147241643 17:39094525-39094547 GGGACACTGGACATTGCTCAGGG - Intronic
1151527572 17:74681435-74681457 TGGACAGGGGTCTTTGCACTGGG - Intronic
1153695170 18:7633116-7633138 TGGTCATGGCTCATTGCACATGG - Intronic
1158697876 18:59718778-59718800 TGAATCTGGGTCAGTGCTCATGG + Intergenic
1160121431 18:76133799-76133821 TGGAGATGGGACTTTTCTCACGG + Intergenic
1161163337 19:2772674-2772696 AGGACATTGGTTATTGCTCTAGG - Intronic
1164513421 19:28915194-28915216 TTAATAGGGGTCATTGCTCAAGG + Intergenic
925735293 2:6958481-6958503 GCCACATGGGTTATTGCTCAAGG - Intronic
930802057 2:55453136-55453158 AGGTCATGGTTCATTGCTCTAGG + Intergenic
935537686 2:104313218-104313240 TTTACATGGTTCAGTGCTCAAGG - Intergenic
937468474 2:122155314-122155336 TGGACAGGGGCCACTGCTCTGGG + Intergenic
938157224 2:128951989-128952011 TGGACTTGGGCCGTTGCTCCTGG + Intergenic
940064171 2:149608147-149608169 TGGACATGGGACATGGGACATGG - Intergenic
942363385 2:175196593-175196615 TAGACATGGGTCATTAATCTGGG + Intergenic
946123343 2:217536558-217536580 AGGACATGGGCCATTCCTCATGG - Intronic
947689414 2:232120962-232120984 TGGACATGGTTAATTGCTGATGG - Intronic
948076913 2:235172185-235172207 GAGACTGGGGTCATTGCTCAGGG + Intergenic
1169340219 20:4790646-4790668 TGGACCTGGGACATGGCACATGG + Intronic
1170359588 20:15530319-15530341 TGAACATGGGTCAGTTTTCAAGG + Intronic
1170445340 20:16421026-16421048 TGGACAGGGGTCATGGGTGAGGG + Intronic
1171420237 20:25012973-25012995 GGGACATGGGTCCTGGCTCAGGG - Intronic
1173153805 20:40590585-40590607 TAAACATGGGTCATTTCTCCTGG + Intergenic
1181005617 22:20012118-20012140 AGAACATGGGTCCTTCCTCATGG + Intronic
1181666897 22:24404723-24404745 TTGACATGGGCCAGGGCTCAAGG - Intronic
1183406356 22:37632471-37632493 AGGACCTGGGTGATTGCTGAGGG - Exonic
1184161847 22:42701673-42701695 TGGACCTGAGTCAGTGCTTATGG - Intronic
1185080819 22:48708471-48708493 TGGACATGGGCCTTTTCTGAAGG + Intronic
950702583 3:14760533-14760555 AGGACATGGGGAAATGCTCATGG - Intronic
952525906 3:34210476-34210498 TGGACATGGGTCATTTCTCACGG + Intergenic
958196457 3:90247237-90247259 TGGAAATGGGTAATGGCTAAAGG - Intergenic
963240046 3:142994013-142994035 AGGACAAGCATCATTGCTCAAGG + Intronic
963295488 3:143541626-143541648 TGGACATGGGTCATTGCTCAAGG - Intronic
963420290 3:145053336-145053358 TGTACTTGGGTCCTTCCTCAAGG - Intergenic
963443024 3:145365284-145365306 TGGAAAGGGTTCAATGCTCATGG - Intergenic
963975511 3:151475830-151475852 TTGTCATGAGTCCTTGCTCAAGG + Intergenic
967264695 3:187680202-187680224 TGCAGGTGGGTCATGGCTCAAGG - Intergenic
969207214 4:5655967-5655989 TAGACATGGTTCCTTGCACATGG - Intronic
969216423 4:5726162-5726184 TGGAAATCGGTCATTGGTGATGG + Intronic
970885184 4:20979897-20979919 TGGATATGGCTCGTTGCACATGG - Intronic
973737590 4:53888018-53888040 TGGACATGAGCCATTGCGCCTGG - Intronic
975712876 4:77177834-77177856 TGGACATGAGGCAGAGCTCATGG + Intronic
975752039 4:77533795-77533817 TGCCCATGGGCCCTTGCTCATGG - Intronic
976145231 4:82036085-82036107 TGGACATAGGTCATTGTTAGAGG + Intronic
976723110 4:88189263-88189285 TGGGCATGAGTCATTGCACCTGG - Intronic
977345757 4:95814144-95814166 TGGGCATGGGTCAGTGATGAGGG + Intergenic
984119214 4:175722007-175722029 TGGGCATGGGACATTGCACCTGG - Intronic
985532120 5:439930-439952 AGGGCCTGGGTCATGGCTCATGG + Intergenic
986125882 5:4882137-4882159 TGGCCAGGGGACATTGTTCATGG - Intergenic
986714561 5:10513575-10513597 TGGCCAAGGGTCATTGTTCTAGG - Intronic
986759663 5:10868464-10868486 GGGGCCTGGGTCCTTGCTCAGGG + Intergenic
986995401 5:13601839-13601861 AGGACATGGGGCAATGCTGATGG - Intergenic
992142835 5:73816737-73816759 TGGACATGGGTCATTTCCAAAGG - Intronic
993398551 5:87420820-87420842 TGGTAATGGGTCCATGCTCATGG - Intergenic
995702145 5:114948110-114948132 TGGAGATGGTTCATTTCCCAGGG - Intergenic
996060743 5:119030446-119030468 TAGAAATGGCTCATTGGTCATGG + Intergenic
999302139 5:150497817-150497839 TGGGCATGGATCGGTGCTCAGGG - Intronic
999977802 5:156929260-156929282 TGTACATGTGTCAGAGCTCAGGG - Intronic
1001248831 5:170129121-170129143 TGGACATGCTTCATTTCTCTTGG - Intergenic
1007098874 6:39231068-39231090 TGGCCAGGGGACAGTGCTCAGGG - Intergenic
1008051308 6:46902835-46902857 TGGAGATGGGTAAATGCTCTTGG + Intronic
1008169346 6:48183430-48183452 TTGGCATGGGTCATCACTCATGG - Intergenic
1012605916 6:101157550-101157572 TGCTCAGGGGTCATTGGTCAGGG + Intergenic
1014366512 6:120549943-120549965 TGGACAGAGGTCATTGTTCTAGG - Intergenic
1017482226 6:154869004-154869026 GGAACTTGGGTCATTGCACAAGG - Intronic
1018133740 6:160757707-160757729 TGTACAGGGGCCATAGCTCAGGG - Intergenic
1018767446 6:166945183-166945205 TGGACATGGGTCTGTGGACATGG - Intronic
1019227567 6:170526696-170526718 TGGACACTTGGCATTGCTCACGG + Intergenic
1020920882 7:14262848-14262870 TGAACAAGGGTCATTGCCCAGGG + Intronic
1023198303 7:37665811-37665833 TGGACATGAGGCACTGCTCAGGG + Intergenic
1023771051 7:43557030-43557052 TGGACAGGGGTCACTATTCAGGG - Intronic
1026446847 7:70492153-70492175 GGCACAGGGGGCATTGCTCAGGG + Intronic
1029679949 7:102101461-102101483 TGGACCCGGGTGAGTGCTCACGG - Intronic
1029825581 7:103189706-103189728 AGCACATGGCTCATTCCTCAAGG + Intergenic
1048847791 8:138616552-138616574 AGGACATGGGTGATTTCCCAAGG - Intronic
1049047769 8:140166174-140166196 TGGGCATGCGTTATTGCACAGGG - Intronic
1053266007 9:36714107-36714129 TTGACAAGGATCATTGTTCAAGG - Intergenic
1057022990 9:91714809-91714831 TGGACTTGGGTCTCTTCTCAGGG + Intronic
1186603500 X:11064425-11064447 TGCTCATGGCTCATGGCTCATGG - Intergenic
1189251138 X:39601460-39601482 AGGACATGGGTCATCCATCATGG - Intergenic
1189885178 X:45535940-45535962 AGCACATGGCTCATTTCTCAAGG + Intergenic
1192404702 X:70872900-70872922 AGGACATGGATTATTTCTCATGG - Intronic
1193418834 X:81258637-81258659 TGGCCATGGGCCATTTCTAAGGG + Intronic
1201620520 Y:15951954-15951976 TGGACATGGGATATTTCTCAGGG + Intergenic