ID: 963295544

View in Genome Browser
Species Human (GRCh38)
Location 3:143542099-143542121
Sequence AGGTGTTCTTGCCATGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963295544 Original CRISPR AGGTGTTCTTGCCATGATGT GGG Intronic
900223428 1:1521626-1521648 AGGTGGTGTTGCCACCATGTTGG + Intronic
900827683 1:4939823-4939845 AGCTGTTCATGGAATGATGTGGG + Intergenic
901887932 1:12236945-12236967 AGCTGTTCTTGGCATATTGTAGG + Intronic
907952849 1:59200609-59200631 AGGTGTTCTTTCCATAAAATAGG + Intergenic
911155330 1:94630556-94630578 AGTAGTTCTTGCCAGGAAGTGGG - Intergenic
911160202 1:94676255-94676277 AGGTGCTCTGGCCATGAGGCTGG + Intergenic
912651616 1:111444586-111444608 ATGTGTTCTTTCTATGAAGTGGG - Intronic
913532990 1:119746312-119746334 AGCTGCTCTTGCCATGGTGGCGG + Intergenic
915335407 1:155138088-155138110 AGTTGTGCTTACCATGATATAGG - Exonic
919773611 1:201178895-201178917 AGATGTTGGTGCCATGCTGTTGG + Intergenic
920376723 1:205512743-205512765 AGGGGTTCTTGTCAGAATGTGGG + Intronic
920830172 1:209457372-209457394 AGTTGTTCTTGCCAAAATATAGG + Intergenic
923956270 1:239025282-239025304 AGGTTTGTTTGCCTTGATGTTGG + Intergenic
1065244387 10:23742683-23742705 AGGTGTTTTTGTCATGAGGGTGG - Intronic
1066701348 10:38132620-38132642 AGATGATCTTGCCCTGCTGTAGG + Intergenic
1067348049 10:45452218-45452240 AGGTGTTTTTTTCCTGATGTAGG - Intergenic
1070266686 10:74909678-74909700 AGGTGTTTTTGACATAATTTAGG + Intronic
1073589234 10:104740569-104740591 AGGAGTTCATGCCATTATGGAGG - Intronic
1074464160 10:113667211-113667233 AGGTGTTCCTCCCATGCTGGGGG + Intergenic
1075562982 10:123481821-123481843 AGGTGCTCATGCCATGCTGAAGG + Intergenic
1075662031 10:124204426-124204448 AAGTCTGGTTGCCATGATGTAGG - Intergenic
1076575816 10:131466467-131466489 AGGTGATCTTGGCATGGTGATGG - Intergenic
1076790777 10:132775596-132775618 AGGTGTCCTGGCCAGGCTGTTGG - Intronic
1077893368 11:6435773-6435795 AGGTGTTCTCTCCATGCTGTGGG + Intronic
1079075466 11:17382922-17382944 AGGTGTTCTGGACATAATCTAGG + Intergenic
1084602427 11:70154078-70154100 TGGTGTTTTTCACATGATGTGGG + Intronic
1085233818 11:74995723-74995745 AGTGGGTCTTGCCCTGATGTTGG + Intronic
1087005270 11:93464561-93464583 CTGTGTTCTTGCCATTATTTAGG - Intergenic
1087981109 11:104615844-104615866 AGGTGATCTTCCCCTGAAGTAGG + Intergenic
1088617965 11:111651767-111651789 TGGAGTTCTTGCCATAGTGTAGG - Intronic
1089751685 11:120655885-120655907 AGGTGTTTGTGGCATGCTGTGGG + Intronic
1093471210 12:19504076-19504098 AGGCGTGCTTGACATAATGTAGG + Intronic
1103947724 12:124535893-124535915 CGGTGGTCTTGCCAGGGTGTGGG - Intronic
1107096790 13:36545927-36545949 AGGTGTTCTTGCCAACCAGTGGG + Intergenic
1109152416 13:58860819-58860841 TGGGGTTCTTGCCTTGGTGTAGG + Intergenic
1110385583 13:74906868-74906890 AGGTGATCTTCCCATGGAGTCGG + Intergenic
1111376652 13:87388055-87388077 AAGTGTTCTTGGCATAATTTTGG - Intergenic
1112175353 13:97017906-97017928 AGTTGCTTTTGGCATGATGTAGG - Intergenic
1114127563 14:19747685-19747707 AGATGCTCTTGCCCTGCTGTAGG - Exonic
1118876901 14:69793638-69793660 AGGTCTCCCAGCCATGATGTAGG - Intronic
1119256084 14:73198596-73198618 AGATGATATTGCCATGATCTAGG + Intronic
1120832854 14:89013458-89013480 AGTTCTTCTTTCCATGAGGTGGG - Intergenic
1121752267 14:96367027-96367049 AGGTGCTCTTTACATTATGTGGG - Intronic
1123571014 15:21609358-21609380 AGATGCTCTTGCCCTGCTGTAGG - Intergenic
1123607126 15:22044715-22044737 AGATGCTCTTGCCCTGCTGTAGG - Intergenic
1123668753 15:22631624-22631646 AGTTGTTCTTGCCATGTTAAAGG + Intergenic
1125445585 15:39751805-39751827 AGCTGCTCTTCCCATGATGGGGG + Intronic
1126069547 15:44853832-44853854 ATGTTTCCTTGCCATGATGTTGG + Intergenic
1126089261 15:45036928-45036950 ATGTTTCCTTGCCATGATGTTGG - Intronic
1127467400 15:59257686-59257708 CAGTGTTCTTCCCATGCTGTAGG + Intronic
1131167041 15:90149815-90149837 AGGTGTTCTGACCCTGTTGTGGG - Intergenic
1202979366 15_KI270727v1_random:336482-336504 AGATGCTCTTGCCCTGCTGTAGG - Intergenic
1133434314 16:5766185-5766207 AGCTTGTCTAGCCATGATGTGGG + Intergenic
1135581308 16:23628976-23628998 AGTTGTTCTTGCCAATAGGTTGG + Intronic
1140774347 16:78236371-78236393 AGGTGTTTTTGTGATGATTTTGG + Intronic
1141351072 16:83297609-83297631 AGATGTTTTTGCCAAAATGTTGG + Intronic
1143243595 17:5464834-5464856 AGGTGTTCTGCCCATAGTGTGGG - Intronic
1146774954 17:35605645-35605667 AGGTGTTGGTGCCAAGCTGTTGG - Intronic
1153205553 18:2696134-2696156 AGGTGTTATTTCCAAAATGTTGG + Intronic
1155176906 18:23308607-23308629 AGGGGCTCTTGCCATGATCTAGG - Intronic
1159108664 18:64031374-64031396 AAGTGTTTATGCCATGATCTTGG + Intergenic
1160622084 18:80178789-80178811 AGGGGACCTTGCCATGCTGTCGG - Intronic
1165326861 19:35119002-35119024 AGGTGCTCTAGCCAGGAAGTAGG - Intronic
926286301 2:11491680-11491702 AAGTGTTCTTGGCATGTAGTAGG + Intergenic
927362601 2:22253553-22253575 AGGTTCTCTTGCCATTGTGTTGG + Intergenic
927481867 2:23460400-23460422 AGATATTTTTGTCATGATGTAGG + Intronic
933639722 2:84746654-84746676 AGGTGTTGATGCTATGTTGTAGG + Intronic
935661617 2:105471570-105471592 ATGTGTTCCTGGCTTGATGTTGG - Intergenic
942940395 2:181608660-181608682 AGGTATTCTTGCCCTGTTTTTGG - Intronic
945143297 2:206710651-206710673 AGGATTTCCTTCCATGATGTGGG - Intronic
946610915 2:221456772-221456794 ATTTTATCTTGCCATGATGTAGG - Exonic
946622629 2:221575083-221575105 AGGTTGTCTTCCCATAATGTGGG - Intergenic
1170333229 20:15238558-15238580 ATGTGTTCTTTCAATGATTTGGG + Intronic
1170742494 20:19070407-19070429 TGCTGTTCCTGCCATGATGGAGG + Intergenic
1174949156 20:55025301-55025323 AGATGCTTTTGCCATTATGTTGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1178273119 21:31211833-31211855 AGGCATTCTAGCCAGGATGTGGG + Intronic
1179568220 21:42262274-42262296 AAGAATTCTTGCCAGGATGTGGG - Intronic
949165730 3:938554-938576 AGGTGTAATGGCCATGTTGTAGG - Intergenic
954928345 3:54257670-54257692 AGGTTTTCTTGCTTTAATGTTGG - Intronic
955250546 3:57277499-57277521 TGGTGTTGTTTCCATGATTTAGG + Intronic
956937929 3:74124989-74125011 GGATGTTCTTGCTAGGATGTTGG + Intergenic
957137946 3:76313498-76313520 AGGTGTTCTACACATGAGGTGGG + Intronic
957481803 3:80807631-80807653 AGGGGTTCTTGTCAAGGTGTGGG - Intergenic
958266325 3:91441761-91441783 AGGAGATCTTGCTATGATGCCGG + Intergenic
959072299 3:101714131-101714153 AGGTGGTCTTGCGATAATGTGGG - Intergenic
959177663 3:102936260-102936282 AGTTAATTTTGCCATGATGTAGG - Intergenic
961212512 3:125136688-125136710 AGATGTTCCTGCTATGAAGTAGG - Intronic
963295544 3:143542099-143542121 AGGTGTTCTTGCCATGATGTGGG + Intronic
965237417 3:166143206-166143228 AGTTGTTCTTTGCATGTTGTTGG + Intergenic
968707344 4:2086149-2086171 AGGTGTTCTTGCGACGCTGCTGG + Intronic
971214079 4:24647657-24647679 AGGTGGTCCTGGCATGATGCAGG - Intergenic
971524106 4:27594297-27594319 ATGTGTTTTTGACATGATGAAGG - Intergenic
971924988 4:32997081-32997103 ATTTGTTCTTGCCATGTTTTTGG + Intergenic
971947789 4:33304082-33304104 AGGTTTTCCTGCCTTGATGTGGG - Intergenic
972029196 4:34431273-34431295 AGGTGTTATTGCCAGAAGGTAGG - Intergenic
978995435 4:115144973-115144995 AGGTTTACTGGCCATGCTGTTGG - Intergenic
985890379 5:2710701-2710723 AGTTGGTCTTGCCAAGAAGTTGG + Intergenic
988669636 5:33367205-33367227 AGAAGGTCTTGCCTTGATGTTGG + Intergenic
989517731 5:42363034-42363056 AGGTGTTTTTCCTGTGATGTGGG + Intergenic
993262917 5:85683596-85683618 AAGTGTTCTTTTCTTGATGTAGG + Intergenic
994186549 5:96821606-96821628 AGGTTTCCTTGCTTTGATGTTGG - Intronic
999133694 5:149303048-149303070 AGGGGTTCATAACATGATGTAGG + Intronic
999892792 5:155997018-155997040 AGGTATTCTAGCCATGACTTTGG + Intronic
1000087493 5:157900883-157900905 AGGTGTTCTCCCCACGTTGTTGG + Intergenic
1004026576 6:11825125-11825147 AGCTGTTCTTGACATGAAGGTGG + Intergenic
1007657469 6:43460067-43460089 TGGACTTCTTGACATGATGTTGG - Intergenic
1007969356 6:46035105-46035127 AGGTGATATTGCCATCATCTTGG + Intronic
1007969611 6:46037538-46037560 AGGTGATATTGCCATCATCTTGG - Intronic
1008988950 6:57580215-57580237 AGGAGATCTTGCTATGATGCCGG - Intronic
1009177491 6:60478453-60478475 AGGAGATCTTGCTATGATGCCGG - Intergenic
1010651316 6:78458343-78458365 AGGTTTTCTTAACAGGATGTGGG + Intergenic
1012005649 6:93710013-93710035 AGCTGTTCTTGCCAAGGGGTGGG - Intergenic
1013142129 6:107347627-107347649 ATGGGTTCTTTCCTTGATGTTGG + Intronic
1013202780 6:107917057-107917079 AGGTGTTCTTGCCCTCATTCCGG - Intronic
1018592291 6:165440409-165440431 ATGTGTTCTTCCCAGTATGTGGG + Intronic
1022478339 7:30726629-30726651 AGGTGTCCTAGCCATGGTGTAGG + Intronic
1024261561 7:47577528-47577550 TGGAGTTCTTGCCAAGATGAGGG - Intronic
1026501743 7:70948523-70948545 AGGTGTTCGGGTCATGAAGTTGG + Intergenic
1029818334 7:103120299-103120321 AGCTCTTCTTGCCATTATTTAGG - Intronic
1034922190 7:155092601-155092623 AGGTGATATTGCCAGGAAGTGGG + Intergenic
1038068865 8:23991732-23991754 AAGCTTTCTTGCCATGATGCAGG + Intergenic
1038168518 8:25107638-25107660 ACAAGTTCTTGCCATGCTGTTGG + Intergenic
1038681167 8:29669908-29669930 TGGTGCTCTTCCCATAATGTGGG - Intergenic
1038712005 8:29955921-29955943 AGGTCTTCTTGCCAGGATTTAGG + Intergenic
1038938956 8:32282630-32282652 AGGTCTTCTTTCCATTATTTGGG + Intronic
1040548218 8:48418630-48418652 AGGTGGTCTAGGCATGATCTTGG - Intergenic
1043636432 8:82389592-82389614 AGATGCTTTTGCCATCATGTTGG + Intergenic
1045717599 8:105066923-105066945 AGGTTTTCTTCCCCTGGTGTCGG + Intronic
1046019203 8:108643678-108643700 ATGCGTTCTTGCCATGTTGCTGG - Intronic
1048076495 8:131077263-131077285 AGGTGTTCTTTCCAGGATACTGG + Intergenic
1049156452 8:141070027-141070049 CGGTTTTCTTGCCTTGATGATGG + Intergenic
1050934681 9:11380233-11380255 AGATGTTCTTCCCCTGAAGTTGG + Intergenic
1055538842 9:77279275-77279297 AGGTGGTCTTCCCCTGAGGTTGG + Intronic
1055731228 9:79281195-79281217 AGATGTTCCTGCCATAATGTAGG + Intergenic
1056301789 9:85249624-85249646 AGGTGATCTTCCCCTGGTGTTGG + Intergenic
1056939425 9:90942233-90942255 AGCTGTTCCTGGCATGCTGTAGG + Intergenic
1189344996 X:40234040-40234062 TGGTGTTCCTAGCATGATGTTGG - Intergenic
1191062324 X:56312474-56312496 ATGTGTTGTTGCCTTGATCTTGG - Intergenic
1197100409 X:122646623-122646645 AGGTATTCTTACCAAGTTGTTGG - Intergenic
1198279350 X:135126537-135126559 AGGTCTCCTTCCCAGGATGTGGG + Intergenic
1198291607 X:135245983-135246005 AGGTCTCCTTCCCAGGATGTGGG - Intergenic