ID: 963299278

View in Genome Browser
Species Human (GRCh38)
Location 3:143580908-143580930
Sequence TAATAGGTATAGGAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963299271_963299278 24 Left 963299271 3:143580861-143580883 CCACAGACATATGCACTAGGTGC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 963299278 3:143580908-143580930 TAATAGGTATAGGAAGTGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 275
963299273_963299278 -2 Left 963299273 3:143580887-143580909 CCATGTGACAAGTGACATATTTA 0: 1
1: 1
2: 1
3: 28
4: 245
Right 963299278 3:143580908-143580930 TAATAGGTATAGGAAGTGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 275
963299272_963299278 2 Left 963299272 3:143580883-143580905 CCTGCCATGTGACAAGTGACATA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 963299278 3:143580908-143580930 TAATAGGTATAGGAAGTGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963299278 Original CRISPR TAATAGGTATAGGAAGTGGG AGG Intronic
903510798 1:23873632-23873654 TAATAAGCAGAGCAAGTGGGAGG - Exonic
905081046 1:35320618-35320640 TGATTGGTATCTGAAGTGGGAGG + Intronic
905659162 1:39707929-39707951 TAATATTTATAGTAAGTGTGCGG + Intronic
905869083 1:41392734-41392756 GAATAGGTTTAGGAAGTTGAAGG - Intergenic
906081298 1:43090441-43090463 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
906744135 1:48209723-48209745 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
908461324 1:64350706-64350728 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
908852784 1:68391230-68391252 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
909550653 1:76895532-76895554 TAAAAGGTCTAAGAATTGGGAGG + Intronic
909792597 1:79697082-79697104 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
909978063 1:82068265-82068287 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
910419470 1:87042082-87042104 TAACAGGTATAGGAAGATGCTGG - Intronic
910690356 1:89959450-89959472 CAATTGGTATCAGAAGTGGGGGG - Intergenic
912767512 1:112427926-112427948 TAATAGCTACATGAATTGGGTGG + Intronic
914731482 1:150374518-150374540 TGATTGGCATGGGAAGTGGGGGG + Intronic
915881623 1:159678453-159678475 CAATGGGTATAGGAAGGCGGTGG - Intergenic
917631922 1:176898756-176898778 TAATAGGTGTGGGCAGTGGAGGG - Intronic
918188458 1:182148441-182148463 TAATAGGAGAAGGAAGTAGGAGG - Intergenic
918347496 1:183618608-183618630 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
920248348 1:204605374-204605396 TAAGGGGTATAGGAAGTGAGAGG + Intergenic
920356564 1:205377733-205377755 TAACTGGCATTGGAAGTGGGGGG - Intergenic
920772222 1:208899835-208899857 TAATATTGAGAGGAAGTGGGTGG + Intergenic
921732598 1:218594548-218594570 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
922672264 1:227519594-227519616 TAACAGTACTAGGAAGTGGGGGG + Intergenic
923245147 1:232123161-232123183 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
923417558 1:233778350-233778372 TCATAGGCATTGGAGGTGGGAGG - Intergenic
924822217 1:247504235-247504257 TAACAGTACTAGGAAGTGGGAGG + Intergenic
1063571709 10:7221167-7221189 CAATGGGTATAGGAAGGTGGAGG - Intronic
1065294090 10:24258392-24258414 TAATAGTTGGAGGAAGTGAGGGG + Intronic
1065442741 10:25769504-25769526 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1066412199 10:35183077-35183099 TAATTGGTACAGGAAGAGGTTGG - Intronic
1067538918 10:47137570-47137592 TAATAGGACTAAGGAGTGGGAGG - Intergenic
1068151591 10:53139379-53139401 TAAAAGGAATTGGAATTGGGAGG + Intergenic
1071317591 10:84417413-84417435 TAATTGGTATAAGAGGTGAGAGG - Intronic
1071961513 10:90812475-90812497 TAAAAGGTCTAAGAATTGGGAGG - Intronic
1072974485 10:100045845-100045867 TAATAGGGAAAGGTGGTGGGAGG + Intronic
1074067029 10:110025242-110025264 GCAGAGGTATAGAAAGTGGGAGG + Intronic
1075249080 10:120849797-120849819 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1075572131 10:123553758-123553780 TATTAAGTGTTGGAAGTGGGTGG - Intergenic
1077612575 11:3652901-3652923 TAAAAGGTCTAAGAATTGGGAGG - Intronic
1079703338 11:23578415-23578437 TACTAGGCATTGGAGGTGGGTGG + Intergenic
1080723574 11:34872704-34872726 CAATAGGCATTGGAAGTGGAGGG + Intronic
1084612897 11:70214980-70215002 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1086814057 11:91346715-91346737 TAATTGTTAGAGGAAGTGGTTGG - Intergenic
1086915614 11:92526923-92526945 TAATAGGTACAATAAGTGGTTGG - Intronic
1087036866 11:93764950-93764972 TGATTGGCATCGGAAGTGGGAGG - Intronic
1088921773 11:114264650-114264672 TGATTGGCATTGGAAGTGGGAGG - Intronic
1089349370 11:117813563-117813585 TAAAAGGTCTAAGAATTGGGAGG - Intronic
1092790087 12:12063350-12063372 TAAAAGGTCTAAGAATTGGGAGG - Intronic
1093267669 12:17022634-17022656 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1094812347 12:34150842-34150864 TAACAGTACTAGGAAGTGGGAGG - Intergenic
1095704321 12:45221043-45221065 TGATTGGTGTCGGAAGTGGGGGG + Intronic
1096626012 12:52896471-52896493 TAAAAAGGATAGGAAGGGGGTGG + Intergenic
1097398953 12:59106762-59106784 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1097416676 12:59323974-59323996 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1097639344 12:62160748-62160770 TAATGGGTATAGAACGTGGGAGG - Intronic
1099947417 12:89260293-89260315 TAATAGAAATAGGAATTGTGTGG - Intergenic
1100561737 12:95754125-95754147 TAAAAGGTCTAAGAATTGGGAGG - Intronic
1102277472 12:111594032-111594054 TTAAAGGTATAGGGAGTGTGGGG - Intronic
1102429196 12:112868480-112868502 TTATAGGCATAGGCTGTGGGAGG - Exonic
1103174233 12:118848059-118848081 TAATAGGTATGTGTTGTGGGAGG - Intergenic
1104148848 12:126062334-126062356 CATGAGGTATAGGAAATGGGGGG + Intergenic
1104406851 12:128525061-128525083 TTAGAGGTATAGAAGGTGGGAGG - Intronic
1108840589 13:54609236-54609258 AAAGAGGAATAGGAAGTGGACGG - Intergenic
1110244193 13:73303310-73303332 TAATTGGAATAGGAAGAAGGAGG - Intergenic
1110252515 13:73396486-73396508 GAATAGGATTAGGACGTGGGAGG + Intergenic
1111630812 13:90844375-90844397 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1112282275 13:98073440-98073462 ATATAGGTAAAGGAAGTGGAAGG - Intergenic
1114458579 14:22872614-22872636 TAATCGGAAGAGGGAGTGGGGGG - Intronic
1115937619 14:38572112-38572134 TAATTGGTATAAGAGGTGTGAGG - Intergenic
1116120322 14:40714824-40714846 TATTGGGCATAGGAAGTTGGTGG + Intergenic
1116573833 14:46548875-46548897 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1118697057 14:68395388-68395410 TGATAGGGATAGGAAGGGGGAGG + Intronic
1119317582 14:73708454-73708476 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1120665691 14:87304102-87304124 TGATAGTGATGGGAAGTGGGAGG - Intergenic
1121164223 14:91776233-91776255 TGATTGGCATAGGAAGTGGGGGG + Intronic
1123431920 15:20225307-20225329 TAAGAGGTATAGGTTGTGGGTGG - Intergenic
1124813655 15:32966915-32966937 TAATAGGTACAAAAAGTTGGAGG + Intronic
1130561366 15:84962007-84962029 TAAAAGCTATCGGAAGTTGGTGG + Intergenic
1131684570 15:94755730-94755752 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1131724877 15:95210433-95210455 TAAAAGGCATTGGAAGTAGGAGG + Intergenic
1131882138 15:96872619-96872641 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1133765335 16:8833775-8833797 TAAAAGGTCTAAGAATTGGGAGG + Intronic
1133869102 16:9671290-9671312 TAAAAGGTCTAAGAATTGGGAGG + Intronic
1136852718 16:33625832-33625854 TAAGAGGTATAGGTTGTGGGTGG + Intergenic
1137242173 16:46665075-46665097 TAATACTTCTAGGAAGTTGGCGG - Intronic
1138947278 16:61866746-61866768 GAATAAGAATAGGAAGTAGGTGG - Intronic
1139230205 16:65276000-65276022 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1141026977 16:80558012-80558034 TTATAAGTATAGACAGTGGGAGG - Intergenic
1141525386 16:84607697-84607719 GAAAAGGTGTTGGAAGTGGGAGG + Intronic
1203114321 16_KI270728v1_random:1474300-1474322 TAAGAGGTATAGGTTGTGGGTGG + Intergenic
1145887706 17:28394289-28394311 TAATGGGGATTGGAAGAGGGTGG + Intronic
1146598279 17:34188241-34188263 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1147301913 17:39536180-39536202 AAATAGGGAAAAGAAGTGGGTGG - Intronic
1149737726 17:59012186-59012208 TGATAGGGATAGGGAGTGGTTGG - Intronic
1149991958 17:61388316-61388338 GAACAGTTTTAGGAAGTGGGAGG - Intronic
1151573988 17:74942103-74942125 TCCTAGGCATAGGTAGTGGGAGG - Intronic
1151622877 17:75257539-75257561 TAAAAGGTCTAAGAATTGGGAGG - Intronic
1151837605 17:76593522-76593544 TGATGGGAATTGGAAGTGGGAGG + Intergenic
1153063053 18:1013849-1013871 TAATAGGAACAGGGAGTGGTAGG + Intergenic
1153191493 18:2545437-2545459 TAATAAGGATAGAAAGTGGGTGG + Intronic
1153848926 18:9075342-9075364 TAATAGATGTATGAAATGGGTGG + Intergenic
1155667703 18:28331438-28331460 TAAAAGGTATACAAATTGGGAGG - Intergenic
1156305981 18:35878592-35878614 TAATATATATAGGTTGTGGGTGG - Intergenic
1158563943 18:58538359-58538381 TAATAGCTAGAGGGAGTTGGGGG - Intronic
1158871630 18:61693894-61693916 TGATAGGCATCTGAAGTGGGGGG - Intergenic
1158881181 18:61780922-61780944 TGATAGGCATTGGAAGTTGGGGG + Intergenic
1159121934 18:64181110-64181132 GTTTAGGTATGGGAAGTGGGAGG - Intergenic
1162415475 19:10533876-10533898 TAAGAGGCATGGGAACTGGGTGG + Intergenic
1165132975 19:33644811-33644833 TAAGAGGGATTGGAAGTGTGGGG + Intronic
1165361104 19:35337581-35337603 CAAGAAGTAGAGGAAGTGGGAGG + Intronic
1165509949 19:36260238-36260260 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1166498555 19:43324253-43324275 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1167046230 19:47050589-47050611 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1168096320 19:54117220-54117242 TCAGAGGCAGAGGAAGTGGGGGG + Intronic
925828450 2:7873463-7873485 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
926463674 2:13164529-13164551 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
926501980 2:13667067-13667089 GAAGAGTTTTAGGAAGTGGGTGG - Intergenic
926815170 2:16792687-16792709 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
928928948 2:36603999-36604021 TAAAAGGTCTAAGAATTGGGAGG - Intronic
928969245 2:37009824-37009846 TAATAAGTCTAGGAAGGTGGAGG - Intronic
929383879 2:41382386-41382408 TGAGAGGTAGCGGAAGTGGGAGG - Intergenic
929792684 2:45035195-45035217 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
930955475 2:57197918-57197940 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
931608507 2:64075478-64075500 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
931888040 2:66639390-66639412 AAATAGGTTTAGGAAATTGGGGG + Intergenic
932234667 2:70111416-70111438 TAAGAGATACAGGAAATGGGCGG + Intergenic
932296241 2:70625679-70625701 TAAAAGGTCTAAGAATTGGGAGG - Intronic
932366845 2:71158518-71158540 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
933552026 2:83789668-83789690 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
935830885 2:106999815-106999837 TTATAGGCATAGGATGGGGGTGG - Intergenic
936964895 2:118117887-118117909 TCGCAGGTAGAGGAAGTGGGTGG + Intergenic
939476539 2:142694498-142694520 TTATAGCTAAAGCAAGTGGGTGG - Intergenic
941238523 2:163007509-163007531 TACTAGGTATAGGAAGAAGTCGG - Intergenic
942306705 2:174615271-174615293 TATTTTGTATAGGAAGTGGGAGG - Intronic
942875870 2:180796923-180796945 TAAAAGGTGTAGCAATTGGGAGG + Intergenic
943654207 2:190490210-190490232 TACTAGGGATAGGGAGTGAGTGG + Intronic
943807009 2:192135349-192135371 TAAAAGGTCTAAGAATTGGGAGG - Intronic
945376550 2:209083594-209083616 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
946214656 2:218174760-218174782 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
946512442 2:220373461-220373483 TAAAAAGTATAAAAAGTGGGGGG - Intergenic
948391073 2:237611914-237611936 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1170186197 20:13593675-13593697 GAATAGGTAAACGAAGTGGCTGG + Intronic
1170308895 20:14971436-14971458 TAGTAGGTAAAGGGAGGGGGGGG + Intronic
1173102278 20:40098247-40098269 TAAAAGGTATAAGAATTGGGAGG - Intergenic
1173746054 20:45437921-45437943 TAATAGGCATATTCAGTGGGAGG - Intergenic
1176952326 21:15063460-15063482 TCATAGGTTTAGTAAGTGGGTGG - Intronic
1177363627 21:20104924-20104946 TTATGGGTACAGGATGTGGGTGG - Intergenic
1177497374 21:21907403-21907425 TAATAGCTGTGGGATGTGGGTGG + Intergenic
1178993515 21:37375955-37375977 ATATTGGTATAGGAAGAGGGGGG - Intronic
1179387939 21:40959914-40959936 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1182266366 22:29118910-29118932 TAATTGGCATCTGAAGTGGGGGG - Intronic
1182597993 22:31437016-31437038 TAACAGGGAAGGGAAGTGGGAGG - Intronic
1182732659 22:32507739-32507761 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
951238631 3:20264751-20264773 TTATAGGCACAGGATGTGGGTGG - Intergenic
952895677 3:38077050-38077072 TAAAAGGTCTAAGAACTGGGAGG + Intronic
954509697 3:51112653-51112675 TTAGAGGTATGTGAAGTGGGAGG + Intronic
954968890 3:54635239-54635261 TAAAAGGTCTAAGAATTGGGAGG + Intronic
955889591 3:63635800-63635822 TCAAAGGTACAGGAGGTGGGCGG + Intergenic
956829321 3:73030062-73030084 TAAATGGTATTGGAACTGGGAGG + Intronic
959287977 3:104440672-104440694 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
960674066 3:120177924-120177946 TATGAGGTACAGGAATTGGGTGG - Intronic
961690426 3:128665603-128665625 TAAGTGGTAAAGGAAGGGGGAGG - Intronic
961711250 3:128829960-128829982 TAAAAGGTCTAGGAATTGGGAGG + Intergenic
961730963 3:128964626-128964648 TAAAAGGTCTAAGAATTGGGAGG - Intronic
961881428 3:130064233-130064255 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
961985192 3:131124502-131124524 TGTTAGGTAAAGGAAGTGGGGGG - Intronic
963168691 3:142230183-142230205 TAATAGGTATAAAAAATGGAAGG - Intergenic
963299278 3:143580908-143580930 TAATAGGTATAGGAAGTGGGAGG + Intronic
963424750 3:145111987-145112009 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
963562723 3:146886392-146886414 TAAGAGGAATAGAAAGGGGGAGG + Intergenic
963663730 3:148156601-148156623 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
963756547 3:149240166-149240188 TGATTGGCATTGGAAGTGGGGGG + Intergenic
965104861 3:164342878-164342900 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
965639595 3:170818327-170818349 TAAAAGGTCTAAGAATTGGGAGG + Intronic
965713795 3:171581390-171581412 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
965762732 3:172096865-172096887 TAAAAGGTATGGGATGAGGGCGG + Intronic
966232470 3:177666597-177666619 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
967364692 3:188672671-188672693 TCAAAGGTATAGGAAGAGGAAGG - Intronic
967740850 3:193000651-193000673 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
969653638 4:8483150-8483172 TAAAAGGTCTAAGAATTGGGAGG + Intronic
970042441 4:11811247-11811269 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
970533175 4:17003140-17003162 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
975224828 4:71859130-71859152 TAATAGGCATATTCAGTGGGAGG + Intergenic
975346041 4:73293658-73293680 TAATAGGTATATTTGGTGGGAGG - Intergenic
976123638 4:81809865-81809887 AAATATGTATAGAAAATGGGCGG - Intronic
977216781 4:94293997-94294019 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
977809786 4:101346382-101346404 TGACAGAAATAGGAAGTGGGTGG - Intronic
978000738 4:103554513-103554535 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
980708998 4:136539810-136539832 TAACAGATATAGGAAGTTTGTGG + Intergenic
981525425 4:145702725-145702747 TAAAAGGTCTAAGAATTGGGAGG - Intronic
982180103 4:152742107-152742129 TAAAAGGTCTAAGAATTGGGAGG + Intronic
982413792 4:155109033-155109055 TAAGAGGTCTAAGAATTGGGAGG + Intergenic
983414373 4:167436766-167436788 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
983659954 4:170121416-170121438 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
985263289 4:188135256-188135278 AGATAGGTAGAGGAAGTGGAAGG - Intergenic
986062395 5:4203570-4203592 TGAGAGGTAAAGGACGTGGGAGG + Intergenic
987505039 5:18757737-18757759 GAAGAGGTAGAGGAAGTGGAAGG + Intergenic
990086851 5:51989052-51989074 TAATGGGGGTAGGAATTGGGAGG - Intergenic
990684522 5:58286420-58286442 TAATAAAAAAAGGAAGTGGGGGG - Intergenic
990911301 5:60855051-60855073 GAAAAGGAATGGGAAGTGGGAGG - Intergenic
991049163 5:62254316-62254338 TAAGAGGTATAGGTTGTGGGTGG - Intergenic
991488261 5:67160159-67160181 TAATTGGTACAGGAAGTTGAGGG + Intronic
991707005 5:69368244-69368266 TAATAGGTATCAGAAGGGGAAGG - Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993837062 5:92828946-92828968 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
995659413 5:114464168-114464190 TTTTAGGTATAGGAAATGGGAGG + Intronic
996202882 5:120698347-120698369 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
997126484 5:131232403-131232425 GAATAGGTATAGGCAGGGTGTGG - Intergenic
997769475 5:136541686-136541708 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
997770243 5:136547072-136547094 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
998537266 5:142945315-142945337 GAATAGGTATAGTGAGTGGCAGG - Intronic
1002968483 6:1991069-1991091 TAAGAGGAATAGGAAGGGGTAGG - Intronic
1003429798 6:6028548-6028570 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1004867497 6:19868642-19868664 CAATAGGAATAGGAAGTGTCTGG - Intergenic
1004989785 6:21124556-21124578 TAGTGGGTAAAGGGAGTGGGAGG - Intronic
1006353521 6:33539555-33539577 TTATAGGTAAAGAAAGTGGCTGG - Intergenic
1008897710 6:56576422-56576444 TGATTGGTATCTGAAGTGGGGGG + Intronic
1009290895 6:61880971-61880993 TAAAAGGTAGAGGATGTGGCAGG + Intronic
1009807298 6:68617509-68617531 TAATAAGTTTAGGAAGTAGGTGG + Intergenic
1010176373 6:73032804-73032826 AAATAGGTTTAGGATGGGGGAGG + Intronic
1010314675 6:74433766-74433788 GAAGAGGGATAGGAAGAGGGAGG + Intergenic
1010890715 6:81307025-81307047 TAGTAGCTATGGGAAGGGGGTGG + Intergenic
1010894049 6:81344666-81344688 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1011140923 6:84155494-84155516 TAATAGGTTAAGGAAATGGAAGG - Exonic
1011770565 6:90670958-90670980 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1012675536 6:102107426-102107448 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1014023634 6:116618851-116618873 TAATTGGCATTGGAAGTGTGGGG - Intronic
1014719274 6:124896998-124897020 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1014823034 6:126014543-126014565 TAATAAATATAGGAATTGGCCGG - Intronic
1015296788 6:131603971-131603993 AAAAAGGAATAGGAAGTGTGAGG - Intronic
1016059160 6:139610496-139610518 TTAAAGGTATAGGAAGAGGGGGG + Intergenic
1016535376 6:145103899-145103921 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1016788170 6:148036383-148036405 TGATAGGTATGGGAAAAGGGGGG + Intergenic
1017389884 6:153926443-153926465 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1017694691 6:157003028-157003050 AAAGAAGTGTAGGAAGTGGGAGG + Intronic
1018692312 6:166356920-166356942 TGTTAGGTACAGGAGGTGGGAGG - Intergenic
1020514131 7:9094760-9094782 TTGAAGGTAGAGGAAGTGGGAGG + Intergenic
1020990670 7:15192264-15192286 TTATGGGTACAGGATGTGGGGGG - Intergenic
1021977529 7:26024948-26024970 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1022854373 7:34300878-34300900 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1023367258 7:39476041-39476063 TTATAGGTTTAGGAAGTGCTAGG - Intronic
1023396479 7:39756536-39756558 TAATAGATATAGAAAGTAGGAGG + Intergenic
1024115759 7:46191534-46191556 CAGTAGGTATAGGATGGGGGTGG - Intergenic
1031082661 7:117273605-117273627 TATTAGCTAGTGGAAGTGGGAGG + Intergenic
1031364392 7:120886379-120886401 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1031422032 7:121564358-121564380 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1032453206 7:132052420-132052442 TAATAGGCAGGGGTAGTGGGTGG - Intergenic
1033187253 7:139239166-139239188 TAATATGTATAAAAAGGGGGTGG - Intronic
1033408374 7:141092762-141092784 GAAAAGGGATAGGAAGTGTGAGG + Intronic
1033675574 7:143537977-143537999 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1033696262 7:143791467-143791489 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1039229753 8:35430542-35430564 CAATTGGCATAGGAAGTGGAGGG + Intronic
1040922054 8:52632046-52632068 TCATCAGTAGAGGAAGTGGGTGG - Intronic
1041527262 8:58821296-58821318 TAGTAGGTATAGAAAGGAGGGGG - Intronic
1041710196 8:60887394-60887416 GAATAGGTACATGAAGTGAGAGG - Intergenic
1042784611 8:72534848-72534870 TACATGGTATAGGAAGTGGAAGG + Intergenic
1042994153 8:74675494-74675516 TAGTATCTATAGGGAGTGGGGGG + Intronic
1043353287 8:79386850-79386872 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1043524559 8:81082509-81082531 TAAGAAGCATAGGAAGAGGGAGG - Intronic
1043717464 8:83505407-83505429 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1044258248 8:90090968-90090990 TAAAAGGTCTAAGAATTGGGAGG + Intronic
1044625889 8:94234843-94234865 TATTAGCAATAGGAAGTGTGTGG - Intergenic
1045197905 8:99948848-99948870 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1045645238 8:104291347-104291369 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1046315657 8:112498006-112498028 TAATAGGTGAAGACAGTGGGTGG + Intronic
1046552550 8:115734729-115734751 AAATAGGGATAGAAAGTGCGTGG - Intronic
1048015883 8:130497682-130497704 TATGAGATACAGGAAGTGGGAGG + Intergenic
1048640887 8:136359732-136359754 TAATTGATATAGCAAGTGGGAGG - Intergenic
1049131200 8:140844277-140844299 TAATAAGGAAAGGAAGTGTGGGG - Intronic
1049868392 8:144954630-144954652 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1050277214 9:4012305-4012327 TATTAGGTATTGGAAGAGTGTGG + Intronic
1050665937 9:7936582-7936604 TTTTAGGTTTAGGAAGTAGGTGG + Intergenic
1052469153 9:28871408-28871430 AAATAGGAATGGAAAGTGGGAGG + Intergenic
1056704374 9:88939567-88939589 TAAAAAGTTAAGGAAGTGGGAGG - Intergenic
1057358425 9:94351202-94351224 CAATTGGCATAGGAAGTGGGGGG + Intergenic
1057649326 9:96906408-96906430 CAATTGGCATAGGAAGTGGGGGG - Intronic
1058473013 9:105300385-105300407 TAAAAGGTATAGTAAGAAGGGGG - Intronic
1059545796 9:115175373-115175395 TAAAAGGTCTAAGAATTGGGAGG + Intronic
1060946078 9:127569717-127569739 CAACAGCTATAGGAAGGGGGTGG + Intronic
1185858040 X:3553882-3553904 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1185991452 X:4896554-4896576 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1186112468 X:6272933-6272955 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1191110019 X:56796975-56796997 GAAAAAGAATAGGAAGTGGGAGG - Intergenic
1193527386 X:82610537-82610559 TAATATGAATAAGAAGTGGTTGG - Intergenic
1194293242 X:92100995-92101017 TAAAAGGTCTAAGAATTGGGAGG + Intronic
1194308166 X:92273818-92273840 TAAAAGGTCTAAGAATTGGGAGG + Intronic
1195906792 X:109852085-109852107 AAATAGCTATGGGAAGTGGCTGG + Intergenic
1196331209 X:114471727-114471749 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1196572872 X:117284109-117284131 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1196773485 X:119318526-119318548 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1197143896 X:123149369-123149391 TAATTGGCATATGAAGTCGGAGG - Intergenic
1197351669 X:125389602-125389624 TAAAAGGTCTAAGAATTGGGAGG + Intergenic
1197933473 X:131717022-131717044 TAAAAGGTCTAAGAATTGGGAGG - Intergenic
1198464512 X:136892802-136892824 TCATATTTATAGGAAGTGTGAGG + Intergenic
1199910456 X:152281247-152281269 TCAGATGTATAGGAAGAGGGTGG - Intronic
1199936690 X:152581622-152581644 TAACAAGTATTTGAAGTGGGGGG - Intergenic
1200610753 Y:5325540-5325562 TAAAAGGTCTAAGAATTGGGAGG + Intronic