ID: 963301108

View in Genome Browser
Species Human (GRCh38)
Location 3:143598052-143598074
Sequence ACCAGGGACTGGAGAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963301108 Original CRISPR ACCAGGGACTGGAGAGCTCA GGG (reversed) Intronic
900284348 1:1891830-1891852 AGCGGGGACTGGAGACCTCCAGG + Intergenic
900313105 1:2043877-2043899 TCCAGGGTCTGGAGAGGCCAGGG - Intergenic
901005967 1:6171674-6171696 AGGAGGGACTGGTGGGCTCAAGG - Intronic
901400968 1:9014939-9014961 GTCAGGGAATGGTGAGCTCAGGG - Intronic
901913547 1:12480081-12480103 ACCAGGGACAGCACAGCTCCTGG - Intronic
901916107 1:12501934-12501956 ACACGGGACAGAAGAGCTCACGG + Intronic
902203695 1:14852204-14852226 ACCCGGCACTGGACAGCTCCAGG + Intronic
903186022 1:21629500-21629522 GCCAGGAACTGGAGAGCCAAGGG - Intronic
904408866 1:30312808-30312830 ACCAGGTCCTGGGGAGATCATGG - Intergenic
904540323 1:31228386-31228408 CACAGGGCCTGGTGAGCTCATGG - Intronic
906458913 1:46022514-46022536 ACCAGGGACTTGGAAGCCCATGG - Intronic
906556972 1:46721770-46721792 ACCAGGGACTGAGGAACCCAGGG + Intergenic
906609618 1:47192451-47192473 ACCTGGGACTTGAGTGCTGAGGG - Intergenic
906641040 1:47440439-47440461 GCCAGGGACTGGAGAGGTGGGGG + Exonic
906678850 1:47711430-47711452 ACCAGAGAACCGAGAGCTCAGGG + Intergenic
907437982 1:54461875-54461897 CCCAGGGGCTGGAGAGCCCATGG + Intergenic
908160062 1:61398062-61398084 ACCAGGGACTGGAAAACTATTGG + Intronic
910396672 1:86800595-86800617 ACCAGGAACTGGAGAGCCACTGG - Intergenic
911703581 1:100984364-100984386 ACCAGGAAGTGGAGAGATTATGG + Intergenic
912522632 1:110256310-110256332 TCTAGGGACTGGAGAGATCTGGG - Intronic
913187178 1:116379469-116379491 GCCAGGGACTGGAGGGCTAAGGG - Intronic
915327969 1:155091143-155091165 ACCAAGGTCTGCAGAGCCCAGGG + Intergenic
917998829 1:180471316-180471338 ACCTGAGACTGGAGAGGTCAAGG + Intronic
920173395 1:204085171-204085193 ACTAGGGACTGGGGAGGACATGG + Intronic
920304613 1:205010507-205010529 ACCTGAGCCTGGAGAGGTCAAGG + Intronic
921620534 1:217321668-217321690 ACCATGAACTCGAGAGCACATGG - Intergenic
923273181 1:232375548-232375570 AGCAGGGAGTGGAGAGCCCAGGG - Intergenic
1062858095 10:789564-789586 ACCAGAGACTGGAAAGTTCCCGG - Intergenic
1065629702 10:27665949-27665971 ACCAGAGACTGGAGAGGGAAGGG + Intergenic
1068496348 10:57789291-57789313 CCCTTGGTCTGGAGAGCTCATGG + Intergenic
1068560970 10:58513480-58513502 CCCAGGGACTGGAGACTTCGCGG + Intronic
1069572991 10:69505859-69505881 CTGAGGGACTGCAGAGCTCAGGG - Intronic
1071525043 10:86353693-86353715 GCCTGGGCCTGGAGAGCTGAGGG - Intronic
1071797155 10:89019192-89019214 ACATGAGAATGGAGAGCTCAGGG + Intergenic
1072083116 10:92053073-92053095 ACCATGGACTGGAGAGGAAAAGG + Intronic
1073140916 10:101247072-101247094 AGCAGGGAGTTGAAAGCTCATGG + Intergenic
1076039294 10:127229392-127229414 ACCAAGGACTGGAGAGCGGGGGG - Intronic
1076494382 10:130887330-130887352 CTCAGCGACTGGAGAGCTGATGG - Intergenic
1076603784 10:131676469-131676491 ACAAGGGCATGGAGAGCCCAGGG - Intergenic
1077057680 11:603136-603158 ACCTGGGCCTGGGGAGGTCAAGG - Intronic
1077143202 11:1033873-1033895 AGAAGGGCCTGGAGAGGTCACGG - Intronic
1077285196 11:1762469-1762491 CCCAGGGACTTGAGAGTACAAGG + Intronic
1077863820 11:6206670-6206692 AGCAAAAACTGGAGAGCTCAAGG + Intronic
1078573007 11:12475632-12475654 ACTAGGGACTGGAGGACTGAGGG + Intronic
1080945807 11:36972759-36972781 AACAAGGAATGGAGAACTCAAGG + Intergenic
1081538178 11:44010627-44010649 ACCTGGGATTGGAGACTTCAGGG - Intergenic
1082897580 11:58208821-58208843 ACCAGAGACTGGAGAGGAAATGG + Intergenic
1082897707 11:58210097-58210119 ACCAGAGACTGGAGAGGAAATGG - Intergenic
1083166363 11:60890670-60890692 ACCTGGGACTGGGAAGGTCAAGG - Intergenic
1089644095 11:119866533-119866555 AGTAGGGACTGGAGTGGTCAAGG - Intergenic
1089763793 11:120748495-120748517 CCCAGGCACTGGTGACCTCATGG + Intronic
1090028468 11:123187216-123187238 AGCAGGGTCTGGGGAGCCCAGGG + Intronic
1091754387 12:3042178-3042200 CTCAGAGACTGGAGAGATCAAGG + Intergenic
1091821735 12:3480577-3480599 ACAAGTTACTGGAGACCTCAGGG - Intronic
1092090747 12:5801899-5801921 ACCAGGTGTTGGAGAGCCCAGGG - Intronic
1092449790 12:8591412-8591434 ACCACGGACTTGAGCGCTCGAGG + Intergenic
1095982032 12:47979427-47979449 AACAGGGTCTGGAGAGCTCCAGG - Intronic
1096774821 12:53957388-53957410 AGCAGGGACCTGAGAGCCCAGGG + Exonic
1097809521 12:64003167-64003189 ACCTGAGCCTGGAGAGGTCAAGG - Intronic
1099324953 12:81203104-81203126 ACCAGAGGCTTGAGAACTCAGGG + Intronic
1100917969 12:99448430-99448452 ACCAGGGACTGGGGAGATGTTGG + Intronic
1101963402 12:109266117-109266139 AGCAGGGACTCGGGAGCTCTGGG + Intronic
1103272152 12:119682207-119682229 CCCAGGGCTTGGAGAACTCATGG - Intergenic
1106320606 13:28634409-28634431 ACCAGGGTATTGAGAGCTGAGGG - Intergenic
1106559223 13:30834060-30834082 CCCAGGCACTGGGGAGCTCCTGG + Intergenic
1107158969 13:37203356-37203378 ACCAAAGACTGGAGAGATTAAGG + Intergenic
1107632110 13:42352744-42352766 ACCAGAGACTGGAGAGGTTGGGG - Intergenic
1109127158 13:58531715-58531737 ACCTGGCTCTGGAGTGCTCAGGG + Intergenic
1110118999 13:71858657-71858679 ACCAGGGACTGGAGAGCTGTTGG - Intronic
1110545408 13:76749939-76749961 ACCAGGGACTGGGGAGCAGATGG - Intergenic
1112136617 13:96585611-96585633 ACCAGGGGCTGGGGAGGTTAGGG - Intronic
1113426792 13:110214706-110214728 GCCAGCGGCTGGAGAGCCCAAGG - Intronic
1114565053 14:23624430-23624452 ACCAGGGACTGGTGAGAGAATGG - Intergenic
1115585400 14:34806830-34806852 ACCTGAGCCTGGAGAGGTCAAGG - Intronic
1115787040 14:36837661-36837683 GGCTGGGATTGGAGAGCTCAAGG + Intronic
1117232377 14:53733943-53733965 ACCAGGGACTGGTGAGGAGAGGG + Intergenic
1117452623 14:55865739-55865761 TTCAGGCACTGGAGAGCCCAGGG - Intergenic
1119112315 14:71986625-71986647 ACCTGAGCCTGGGGAGCTCAAGG + Intronic
1120119421 14:80660018-80660040 ACCAGGGATTGCAGATCTGATGG + Intronic
1120301654 14:82714967-82714989 ACCAGAGACGGGAGAGCACTGGG - Intergenic
1121026001 14:90616550-90616572 GGCAGGGGCTGGACAGCTCATGG + Intronic
1122054310 14:99082238-99082260 AGAAGGGACTGATGAGCTCATGG - Intergenic
1122102047 14:99420494-99420516 ACCAGGGACTGGCAACCCCAGGG + Intronic
1122154754 14:99743319-99743341 CCCAGGGGCTGCAGAACTCAGGG - Intronic
1124963146 15:34413015-34413037 GCCAGGGGCTGGAGAGAGCAGGG + Intronic
1124979769 15:34559241-34559263 GCCAGGGGCTGGAGAGAGCAGGG + Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126218682 15:46186672-46186694 ACCAGGTATTTGAAAGCTCATGG - Intergenic
1126285883 15:47009847-47009869 ACCATGGACTAAAGAGCTCTGGG - Intergenic
1126534897 15:49750801-49750823 CCCAGGAACTGGAGAGTCCAGGG - Intergenic
1128656659 15:69467672-69467694 ACCAGGGGCCAGAGAGGTCAGGG - Intergenic
1129114528 15:73357840-73357862 CCCAGGGACTGCAGAACTCTAGG + Intronic
1129193254 15:73949855-73949877 AACTGGGACTGCAGAGCTCATGG - Intronic
1129267927 15:74403960-74403982 AGCAGGGAGTGCTGAGCTCAGGG + Intergenic
1129335921 15:74852179-74852201 ACCACGGCCTGGAGAGAACAGGG + Exonic
1130426734 15:83808971-83808993 ACCAGAGACTGGGGAGGACAGGG + Intronic
1130744023 15:86631218-86631240 CCCAGGGACTTGAAAGCTTAAGG - Intronic
1130844050 15:87727472-87727494 ACCAGGGCCTGGGGAGCTGGGGG + Intergenic
1131545177 15:93309796-93309818 ACTTGGGCCTGGAGAGGTCAGGG + Intergenic
1131703280 15:94964315-94964337 ACCAGAGACTGGAGAGGCAAGGG + Intergenic
1132346845 15:101113780-101113802 CCCAGGGAGTTGAGACCTCAGGG - Intergenic
1132503194 16:293669-293691 ACAAGGGTCTGGAGTTCTCATGG + Exonic
1134142780 16:11736161-11736183 GTCAAGGACTGGAGACCTCAAGG + Exonic
1135721707 16:24823245-24823267 ACCAGGCCCTGGAGAGCTGTGGG + Intronic
1136276583 16:29182532-29182554 ACCAGTGACCTGGGAGCTCAGGG - Intergenic
1137785604 16:51134974-51134996 ACCTGGGCCGGGAGAGTTCAGGG - Intergenic
1138081180 16:54092872-54092894 CCCAGGGACTGCAGAGGTCATGG + Intronic
1138286309 16:55812841-55812863 ACCAGAGACAGGAGGGCTGATGG + Intronic
1138320372 16:56106154-56106176 AGAAGGGGCTGGAGGGCTCAGGG + Intergenic
1138349460 16:56338770-56338792 CCCATGGGCTGCAGAGCTCAGGG - Intronic
1139103907 16:63802582-63802604 ACCATGGGCTGAAGAGCTCTGGG - Intergenic
1141694304 16:85612524-85612546 CCCAGGGGCTGGAGAACCCACGG - Intronic
1141715876 16:85726558-85726580 GACAGGGACAGGAAAGCTCAGGG + Intronic
1141851845 16:86651544-86651566 ACCAGGATGTGAAGAGCTCAGGG + Intergenic
1141926284 16:87172363-87172385 ACCAGGAACTGCACAGCTGATGG + Intronic
1142080965 16:88148593-88148615 ACCAGTGACCTGGGAGCTCAGGG - Intergenic
1142105978 16:88302988-88303010 ACCCGGGACAGGAGTGTTCAGGG - Intergenic
1143702618 17:8672526-8672548 ACCAAGGCCCGCAGAGCTCAGGG + Intergenic
1144649772 17:17000042-17000064 AGCAGGGACTGGGAAGCTGAAGG - Intergenic
1145370098 17:22300667-22300689 ACCAGTGAAGAGAGAGCTCAAGG - Intergenic
1146688913 17:34859685-34859707 ACCAGGGACTGGGGAGGGAAGGG - Intergenic
1146889258 17:36495073-36495095 ACCAGCAACTGGGGAGGTCAAGG - Intronic
1147996141 17:44361437-44361459 AGCAGGGCCTGGGGAGGTCAGGG + Intronic
1150654055 17:67028118-67028140 ACCCAGGACTGGTGTGCTCAGGG + Intronic
1151706836 17:75773661-75773683 ACCAGGGACAAGAGGGCTCCAGG - Intergenic
1151765530 17:76131532-76131554 CCCAGGGACTGGAGAACCCCTGG + Intergenic
1152526740 17:80892582-80892604 AGCAGGGGCTGCACAGCTCAGGG - Intronic
1154213697 18:12400173-12400195 ACCAGGGAGTGGAGGGAGCATGG - Intergenic
1155201080 18:23518237-23518259 ACCAGTGACTGGGGAGGCCAAGG + Intronic
1156364200 18:36410170-36410192 ACCAGGGATTGGAGACGGCAGGG - Intronic
1157069934 18:44394400-44394422 AGCAGAGCCTGGAGAGCACAGGG + Intergenic
1159436063 18:68418926-68418948 CCGAGGGAGTGGAGAGATCAAGG + Intergenic
1159458467 18:68693397-68693419 TCCAGGCCCCGGAGAGCTCAGGG - Intronic
1159657281 18:71047039-71047061 ACCAGGAACTGGAGAGATAATGG - Intergenic
1159833887 18:73312416-73312438 GTCAAGGACTGGAGAGCCCAGGG + Intergenic
1160663990 19:314372-314394 ACAAGGCAGGGGAGAGCTCAGGG + Intronic
1160904983 19:1447744-1447766 GCCAGGGCCTGGAGGGCTGAGGG - Intronic
1160969009 19:1759234-1759256 GCCAGGGACTGGGGACCTGAGGG + Intronic
1161008649 19:1949306-1949328 GCCAGGGGCTGGAGAGGGCACGG - Intronic
1162005683 19:7777295-7777317 ACCAGGGACTGGGGAGAAAAAGG + Intergenic
1166088550 19:40492917-40492939 ACCAGGGCCTGGAGAGCTTGAGG - Intronic
1166798642 19:45443085-45443107 ACCAGGGACTCAGGAGCTGAGGG + Intronic
1166836002 19:45668338-45668360 GCCAGAGACTTGAGAGGTCAAGG - Intronic
1166930598 19:46299080-46299102 GCCAGGGCCTGGCGGGCTCAGGG - Intronic
1167439446 19:49499963-49499985 ACCAGGGCCTGGAGGACCCAGGG - Intergenic
1168145250 19:54416611-54416633 GGCTGGGATTGGAGAGCTCAGGG + Intronic
1168373827 19:55858988-55859010 ACCAGTGCCTGAAGAGCTTAGGG + Exonic
1168697077 19:58409525-58409547 ACCAGGTACTTGAGACCTAAGGG + Intronic
925298730 2:2795178-2795200 ACCAGGTACTGTGGGGCTCAAGG - Intergenic
926002570 2:9345721-9345743 ACCAGGGACTGGAGGGACAAGGG - Intronic
927179201 2:20432402-20432424 ACAAGTGACTGTAGAGCTCTTGG - Intergenic
929417871 2:41761938-41761960 CCTAGGGACTGGAGAACACAGGG - Intergenic
931220466 2:60284294-60284316 GCCAGTGAGTGGAGAGGTCAGGG - Intergenic
931222599 2:60301615-60301637 TCCAAGAACTGAAGAGCTCATGG + Intergenic
932428935 2:71661936-71661958 TCCAGGGGCTGGCGAGCTCCAGG + Intronic
933087698 2:78076647-78076669 GCCAAGGGCTGGAGAGCTCCTGG + Intergenic
933979984 2:87541467-87541489 ACCAGGGGCTGCAGAGGTAAGGG - Intergenic
935460872 2:103332285-103332307 ACCTGAGACAGGACAGCTCAAGG + Intergenic
936313837 2:111409324-111409346 ACCAGGGGCTGCAGAGGTAAGGG + Intergenic
938950617 2:136251251-136251273 ATCAGGGAAAGGAGATCTCAGGG + Intergenic
940449932 2:153824614-153824636 ACCAGGGACTGGAAATCTTGGGG - Intergenic
940971400 2:159900600-159900622 ACCAGGGACTGGTGACTTGAGGG + Intronic
942161241 2:173190152-173190174 ACCAGGAAGAGGAGAGCTGAGGG - Intronic
942321379 2:174739541-174739563 ACCAGGGATTGGGAAGCACAGGG - Intergenic
944396275 2:199270895-199270917 AAAAGGGACAGGAGAGATCAGGG + Exonic
945934594 2:215890185-215890207 ACCAGGGACTAGAGAATTCCAGG - Intergenic
946292690 2:218757272-218757294 AACAGGGTCTAGATAGCTCATGG + Intergenic
946328199 2:218995796-218995818 ACCAGGGAAAAGAGAGCCCAAGG - Intergenic
946418926 2:219554080-219554102 TCAAGGGACTGGAGTGGTCACGG + Intronic
947507865 2:230723732-230723754 ACCAGGGCATGGAGAGGGCAGGG - Intronic
947546524 2:231014591-231014613 ACCTGGGATTGCAGAGCTGAGGG - Intronic
1168851273 20:978699-978721 TCCAGAGACTGGAGACATCAGGG + Intronic
1169000392 20:2163920-2163942 GCCAGAGCCTGGAGAGCTCTGGG + Intronic
1170814168 20:19698639-19698661 GCCAGGGTCTGCAGAGCCCAGGG - Exonic
1170815680 20:19712282-19712304 GCCAGGGACTGGAGGGGTGAGGG + Intronic
1172098766 20:32473515-32473537 GCCAGGGGCTGGGGAGCACAGGG - Intronic
1172230437 20:33332515-33332537 ATCAGGGGCTGGAAAACTCATGG - Intergenic
1172290909 20:33776167-33776189 ACCTGAGACTGGGGAGGTCAAGG - Intronic
1173002795 20:39116934-39116956 ACCAGGGGCTGGAGAGAGGAGGG - Intergenic
1173040618 20:39459029-39459051 ACCAGGAAGTGGATAGGTCAGGG + Intergenic
1173111923 20:40199035-40199057 ACCAGGGGGTGGAGAACACATGG + Intergenic
1173918395 20:46726205-46726227 CCCAGGGAGGGCAGAGCTCAGGG - Exonic
1174173513 20:48631048-48631070 ACCAGGGCCTGGGGAGCAGAGGG - Intronic
1174379612 20:50148228-50148250 AGCTGGGCCTGGAGAGGTCAAGG + Intronic
1175748214 20:61476540-61476562 ACCTGGGGCTGGAGAGTTGAAGG + Intronic
1175796794 20:61776286-61776308 TGCAGGGCCTGGAGAGCTCCCGG - Intronic
1178762638 21:35418425-35418447 TCCAGGTGCTGGAGATCTCAAGG + Intronic
1178918982 21:36726098-36726120 ACCTGGGAGTGGAGAGGGCAGGG - Exonic
1179556721 21:42183182-42183204 ATCAGGGACTGGTCAGCTGAGGG + Intergenic
1181577618 22:23805333-23805355 AACAGGGACAGGACAGCCCATGG + Intronic
1182260685 22:29071595-29071617 ACCAGGGACTTGAAAGCGCCCGG + Intergenic
1183138371 22:35912505-35912527 CTCAGGTACTGGAGAGCTTAGGG - Intronic
1183317868 22:37146724-37146746 TCCAGGGACTGCTGAGCACAGGG + Intronic
1183615812 22:38944684-38944706 TCCTGGGATTGGAGAGCTCATGG + Intergenic
1183782049 22:40005235-40005257 TCCATGTACTTGAGAGCTCAAGG + Intronic
1185131102 22:49039327-49039349 ACCAGGGTCTGGAGAGCAGCGGG - Intergenic
1185417635 22:50719172-50719194 TGCAGGGGCTGGAGTGCTCAGGG - Intergenic
950430549 3:12948439-12948461 TCCCTGGACTGGGGAGCTCATGG + Intronic
951692317 3:25409158-25409180 AACAAGGAGTGGTGAGCTCATGG - Intronic
952395697 3:32918728-32918750 CCCAGGTACTGGGGAGCCCAAGG + Intergenic
952472122 3:33666360-33666382 GCCTAGGACTGGAGAGATCAGGG - Intronic
952638773 3:35565906-35565928 ACCATGGAATGGAGAGAACATGG - Intergenic
954649980 3:52155072-52155094 ATCATGGAGTGGAGAGATCAAGG + Intergenic
954659553 3:52219654-52219676 ACCAGTGTTTGGAGAGGTCAGGG - Intergenic
954836737 3:53476394-53476416 GCCAGGGAGTGGGGGGCTCAGGG - Intergenic
955218898 3:57007634-57007656 ACCAGGGACGGGTGAGTTCCGGG + Intronic
956685407 3:71822794-71822816 CCCAGGGACTGGAAAGAACATGG - Intergenic
956988292 3:74730498-74730520 ATCAGGAACTGGAGAGCTATCGG + Intergenic
957902515 3:86513333-86513355 AACTGGGACTGCTGAGCTCAAGG - Intergenic
960211859 3:114977925-114977947 ACCTGAGCCTGGAGAGGTCAAGG + Intronic
963301108 3:143598052-143598074 ACCAGGGACTGGAGAGCTCAGGG - Intronic
963541679 3:146598828-146598850 TTTAGAGACTGGAGAGCTCAGGG - Intronic
965148690 3:164941951-164941973 TCCAGGGAATGCAGAGCACAAGG + Intergenic
968359615 3:198137976-198137998 ACCAGGGGTGGGAGAGGTCAAGG - Intergenic
968507875 4:980137-980159 ACCAGGGGCTGCCGAGCCCAGGG - Intronic
968564124 4:1300734-1300756 AACAGGGAGCGCAGAGCTCAGGG + Intronic
968813268 4:2809438-2809460 AGGAGGGTCTGCAGAGCTCAGGG - Intronic
969410072 4:7022242-7022264 TCCAGGGGCTGGAGAGGCCATGG + Intronic
969843962 4:9904974-9904996 ACCAGGAACCTGAGAGCTGAAGG - Intronic
970441436 4:16083720-16083742 GCCAGGGTCTGGCGAGCTAAGGG - Intronic
971316394 4:25571705-25571727 ACCAGGGGCTGGAGACCCCAGGG - Intergenic
971889048 4:32493868-32493890 ACCAGGAGCTGGAGTCCTCAAGG - Intergenic
972337423 4:38119854-38119876 ACCACAGACTGGAGGGCTGAGGG + Intronic
978573161 4:110162427-110162449 ACCTGAGCCTGAAGAGCTCAAGG - Intronic
979127908 4:116999550-116999572 ACCAGAGACTGGAGAGTTGATGG + Intergenic
980798356 4:137714673-137714695 ACCAGAAACTGGTGATCTCAGGG + Intergenic
984785026 4:183559967-183559989 ACCAGGGACTGGGGAGTTAGGGG - Intergenic
984820712 4:183879564-183879586 GCCAGGGACAGAAGAGATCATGG - Intronic
985081384 4:186268326-186268348 ATCAGGGACTTGAGCGTTCATGG + Intronic
985965903 5:3338618-3338640 ACCTGGGCCTGGAGACCTCCAGG + Intergenic
989322538 5:40153391-40153413 ACCAGAGACTGGAGAGGGTATGG + Intergenic
989697526 5:44220648-44220670 ACCAGGGCCTGGAAAGTCCACGG - Intergenic
990030145 5:51248986-51249008 CCCAGCTACTGGAGAGGTCAAGG + Intergenic
990423437 5:55660328-55660350 ACCTGAGCCTGGAGAGGTCAAGG + Intronic
990896499 5:60705507-60705529 ATCAGGGGCTGGGGATCTCAGGG - Intergenic
991363006 5:65840684-65840706 ACGAGGGACGGCAGAGCTTAGGG - Intronic
992228846 5:74643766-74643788 ACCAGGGACAGGACAGCTCAGGG + Intronic
993814193 5:92520660-92520682 ACCAGAGGCTGGAGAGCAGAGGG - Intergenic
993940549 5:94052818-94052840 ACCAGGGAGTTGAACGCTCAAGG + Intronic
996180375 5:120411147-120411169 ACCATGGACTTGAGAGCTCTGGG + Intergenic
997032405 5:130146439-130146461 ACCAGAGACTGGAGAGGGAAGGG + Intronic
997226275 5:132211611-132211633 GCCAGGGACTGGGGGGCTCCTGG + Intronic
998404220 5:141864635-141864657 ACCCGAGACTGGAGAGATCCAGG - Exonic
998798559 5:145844396-145844418 ACCTGGGCCTGGAGAGGTCAAGG + Intergenic
999093651 5:148958882-148958904 GCCTGGGACTGAAGAGCCCATGG - Intronic
1002639964 5:180626084-180626106 GTCAGGGACGGGAGAGCGCACGG - Intronic
1003550860 6:7101000-7101022 ACCAGAGACAGGAGATGTCAAGG - Intergenic
1003613160 6:7631114-7631136 AACAGGGCCTGGAGAGCTGTTGG + Intergenic
1003913753 6:10766417-10766439 ACCATGGAGTGGGGAGCTCTTGG - Intronic
1005597872 6:27396641-27396663 ACCTGAGCCTGGAGAGGTCAAGG + Intronic
1005886244 6:30100185-30100207 ACCAGGCCCTGTAGTGCTCAAGG + Intergenic
1006589997 6:35147979-35148001 ACCAGGGTCTGGAGGGAGCAAGG - Intronic
1007769888 6:44184015-44184037 AGCAGAGACCGGAGAGCTGAGGG - Exonic
1009197849 6:60708879-60708901 ACCAGGGTCTAGAGATTTCAAGG + Intergenic
1009657779 6:66568483-66568505 GCCTGGGTCTAGAGAGCTCATGG - Intergenic
1010410275 6:75553563-75553585 ACCAGTGACTGGGAAACTCAGGG + Intergenic
1011322881 6:86116369-86116391 ACCACAGACTGCACAGCTCATGG - Intergenic
1012086780 6:94836730-94836752 ACCAGGGACTTGAGCATTCATGG - Intergenic
1013476359 6:110510805-110510827 AACAGGGTTTGGAGAGCTCCTGG + Intergenic
1015156429 6:130101605-130101627 ACCAGGGCCTGGAAAGGGCAGGG + Intronic
1016212483 6:141555103-141555125 ACCAGAGGCTGGGGAGATCAGGG + Intergenic
1017537245 6:155361958-155361980 ACCAGAGACTGGAGGGTTAAGGG + Intergenic
1019206978 6:170370149-170370171 AGCAGGGCCAGGAAAGCTCAAGG - Intronic
1019260377 7:78675-78697 ACCAGGGGTGGGAGAGGTCAAGG + Intergenic
1020903857 7:14040570-14040592 AACAGAGACGGAAGAGCTCAGGG - Intergenic
1021578609 7:22128723-22128745 ACCTGGGACTAGTGAGCTCCTGG - Intronic
1021594817 7:22303817-22303839 AACATGGACTGGAGACATCATGG + Intronic
1023295195 7:38707761-38707783 GCCAGGGACTGGAGAGAGGAGGG + Intergenic
1026369059 7:69680606-69680628 ACCAGGGGCTGGAGGGAACAAGG - Intronic
1029553039 7:101248305-101248327 ACCAGGGGTTTGAGAGCTGAAGG - Intronic
1031503921 7:122557479-122557501 AACAGGGACAGGAGAGCTATGGG - Intronic
1032017036 7:128386978-128387000 GGCAGGGAGAGGAGAGCTCAAGG + Intergenic
1035855065 8:2965526-2965548 ACCAGGAACTGGAGATGTCGGGG - Intronic
1036003048 8:4630843-4630865 ACCAGGGCCTGGATAGTTCCAGG - Intronic
1036597025 8:10222823-10222845 ACCAGGGGCTGGAGAGATGTTGG + Intronic
1036952293 8:13152731-13152753 ACCAGAGTCTGGGGAGGTCAAGG + Intronic
1037619117 8:20547651-20547673 GCCAGGGACTGGGGAGGGCATGG + Intergenic
1038252558 8:25919212-25919234 ACCAGGATCAGCAGAGCTCAAGG + Intronic
1038388504 8:27172768-27172790 ACCAGAGCCTGGGGAGGTCAAGG - Intergenic
1038672940 8:29596944-29596966 ACCAGGGACTGGAAACCCCTGGG + Intergenic
1039183418 8:34891336-34891358 ACCTTGGTCTGGAGAGCACATGG + Intergenic
1039858728 8:41438251-41438273 ACTGAGGGCTGGAGAGCTCAAGG + Intergenic
1039912472 8:41835944-41835966 ACCAGGGAGGGGAGAGGGCAGGG + Intronic
1041022210 8:53649081-53649103 CCCAAGGGCTGGAGAGTTCAAGG + Intergenic
1041941362 8:63391664-63391686 ACCAAGGACAGGAAATCTCAAGG - Intergenic
1042669452 8:71245785-71245807 ACCAGGCACTGTCCAGCTCAGGG + Intronic
1043829041 8:84965652-84965674 ACTTGGGACTTGTGAGCTCAAGG - Intergenic
1044357355 8:91238644-91238666 ACCAAAGACTTAAGAGCTCAAGG - Intronic
1045444632 8:102247969-102247991 ACCAGGCACTGGAGAGAAAAAGG + Intergenic
1047387990 8:124427123-124427145 ACCAAGGCCTGGAGAACGCATGG - Intergenic
1048332302 8:133479182-133479204 TCCAGGGCCTGGAGAACGCAAGG - Intronic
1048600171 8:135911266-135911288 ACATGTGACTGGAGACCTCAGGG + Intergenic
1049018652 8:139939265-139939287 ACCGGGGTCTGGAGAGGTCAAGG + Intronic
1049284280 8:141766214-141766236 ACCAGGCACTGCTGAGCGCATGG - Intergenic
1049290900 8:141801280-141801302 AACAGGGTTTGGTGAGCTCAAGG - Intergenic
1049371209 8:142268324-142268346 AGCAGGGACTCGAGAACTTAGGG - Intronic
1049394920 8:142395493-142395515 CCCAGGGGCTGGAAAGCCCATGG + Intronic
1049579499 8:143404890-143404912 CACAGGGGCTGGAGAGGTCAGGG - Intergenic
1050471351 9:5994543-5994565 ACAAGGGACTGGAGGTCTGAAGG - Intronic
1052568237 9:30186465-30186487 AACAGGTACTGGAGAGGACATGG + Intergenic
1052716049 9:32118668-32118690 ACCAGAAGCTGGAGGGCTCAGGG - Intergenic
1053083109 9:35193980-35194002 ACCTAGGACTGGAGAGCACATGG - Intronic
1054455054 9:65426232-65426254 ATCAGAGACTGCTGAGCTCAAGG + Intergenic
1055117750 9:72623925-72623947 ACCAGGTACTGGTGAGCCCTTGG + Intronic
1055755891 9:79556862-79556884 AGGAGGGTCTGGAAAGCTCAAGG - Intergenic
1056682705 9:88733017-88733039 CCCAGGGCCTGGAAAGCTGAGGG - Intergenic
1056848682 9:90062453-90062475 ACCAGGGACCAGACAACTCAAGG + Intergenic
1057057827 9:91977548-91977570 GCCAGGAGCTGGGGAGCTCAAGG - Intergenic
1057217204 9:93235730-93235752 AGCAGGGACTGCAGGGATCAGGG - Intronic
1057428433 9:94973083-94973105 AGCAGAAACTGCAGAGCTCAGGG - Intronic
1058813877 9:108666153-108666175 ACCAGGGACTGGACACCTCCAGG - Intergenic
1059243473 9:112828917-112828939 GCCAGGGGCTGGAGAGATCGGGG - Intronic
1060122740 9:121010028-121010050 ACCATGGGCTGGAGTGCTCTAGG + Intronic
1060839815 9:126784541-126784563 ACCAGGAACTGGAGAGCTATTGG + Intergenic
1061165212 9:128918407-128918429 ACCTGAGCCTGGAGAGGTCAAGG - Intergenic
1061226249 9:129282763-129282785 GCCTTGGACTGGGGAGCTCAGGG - Intergenic
1061323212 9:129845245-129845267 ACAGGGGCCTGGAGAGCTCCAGG + Intronic
1062429564 9:136521020-136521042 TCCCGGGCCTGCAGAGCTCAGGG + Intronic
1062640671 9:137516393-137516415 ACCAGGGCCGGGGGTGCTCATGG - Intronic
1062662723 9:137647220-137647242 ACAGAGGACTGGATAGCTCAGGG - Intronic
1062729585 9:138101623-138101645 CCCAGGGACTGGAGAGCCACTGG - Intronic
1062744303 9:138201706-138201728 ACCAGGGGTGGGAGAGGTCAAGG - Intergenic
1062744322 9:138201797-138201819 ACCAGGGGTGGGAGAGGTCAAGG - Intergenic
1185485412 X:478147-478169 CCCAGGGACTCGAGAAGTCAAGG - Intergenic
1186974193 X:14882325-14882347 ACCAGGGGCTGGAGGGGTGAGGG + Intronic
1187571055 X:20502520-20502542 ACCAGGGTCTGGGGAGGTGATGG - Intergenic
1190358863 X:49630673-49630695 TCCAGGGACTGGAGAAGTGAAGG - Intergenic
1192331330 X:70177678-70177700 CCCAAGGGCTGGAGAGCACATGG + Intronic
1193246253 X:79233045-79233067 ACCATGAACTGAAGAGCTCTGGG - Intergenic
1195666981 X:107440680-107440702 ACCAGAGACTGCAGAGCTGCGGG + Intergenic
1196335381 X:114525905-114525927 ACCTGAGTCTGGAGAGGTCAAGG + Intergenic
1197146102 X:123174354-123174376 ACCTGAGACTGGAGAGGTCGAGG - Intergenic
1197391870 X:125877723-125877745 ACAAGTGACTGAAGAGCTCTTGG - Intergenic
1197792082 X:130266324-130266346 ACCAGAGACTTGGGAGTTCAGGG + Intronic
1199593493 X:149488903-149488925 CCCAGGGAATGATGAGCTCAGGG + Intronic
1200257601 X:154592733-154592755 ATCCCAGACTGGAGAGCTCATGG + Intergenic
1200479911 Y:3688054-3688076 AGCAGGGACTGAAGAGTTCTAGG - Intergenic
1200826600 Y:7651237-7651259 ACCAGAGAATGAAGAGCACAAGG - Intergenic
1201562609 Y:15333738-15333760 ACCAGGGGCTGGGCACCTCAGGG + Intergenic
1202183613 Y:22160174-22160196 ACCAGAGAAAGGAGAGCACAAGG - Intergenic
1202207746 Y:22426227-22426249 ACCAGAGAAAGGAGAGCACAAGG + Intergenic