ID: 963301281

View in Genome Browser
Species Human (GRCh38)
Location 3:143599964-143599986
Sequence TGGCGTTTTACCTACCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963301279_963301281 -7 Left 963301279 3:143599948-143599970 CCCGATTATTGTTCTCTGGCGTT 0: 1
1: 0
2: 0
3: 7
4: 91
Right 963301281 3:143599964-143599986 TGGCGTTTTACCTACCAGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
963301280_963301281 -8 Left 963301280 3:143599949-143599971 CCGATTATTGTTCTCTGGCGTTT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 963301281 3:143599964-143599986 TGGCGTTTTACCTACCAGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
963301277_963301281 22 Left 963301277 3:143599919-143599941 CCAACATAAAGCAACTAAACAGT 0: 1
1: 0
2: 1
3: 27
4: 218
Right 963301281 3:143599964-143599986 TGGCGTTTTACCTACCAGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963301281 Original CRISPR TGGCGTTTTACCTACCAGCC CGG Intronic
902216981 1:14940495-14940517 AGGCATTTTTCCTCCCAGCCAGG + Intronic
912374267 1:109197738-109197760 GGGCCTTTTACCTCCCAGACTGG - Intronic
914673155 1:149887292-149887314 CGGCGTTTTGCCTAACATCCAGG + Exonic
920641526 1:207756128-207756150 AGGAGTTGTAGCTACCAGCCAGG + Intronic
1062874779 10:934125-934147 TGAAGTTTAACCTACCAGCCGGG - Intergenic
1062923067 10:1294474-1294496 TGGCGTTTCACCTTACAGCTGGG + Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1073528816 10:104212019-104212041 TGCCTCTTTGCCTACCAGCCCGG + Exonic
1077265961 11:1650368-1650390 TGGCGTTTGGCCAAACAGCCTGG + Intergenic
1078252384 11:9626964-9626986 TGCAGTTTTTCCAACCAGCCAGG - Intergenic
1078668347 11:13344101-13344123 GGGCATTCTCCCTACCAGCCAGG + Intronic
1080660743 11:34293933-34293955 TAACATTTTACCGACCAGCCTGG - Intronic
1088997553 11:115014850-115014872 TGGCTTCTTACTCACCAGCCTGG - Intergenic
1090976235 11:131682892-131682914 GCACATTTTACCTACCAGCCGGG + Intronic
1094202872 12:27810975-27810997 TGGCCGTTTTCCCACCAGCCCGG - Intergenic
1098948452 12:76614262-76614284 TGGAGTTTTAGACACCAGCCTGG + Intergenic
1107688116 13:42924529-42924551 TGGAGTTTCGCCTACCAGGCTGG - Intronic
1119643153 14:76329741-76329763 TGCCGTTGTTCCTGCCAGCCCGG + Intronic
1122816373 14:104316126-104316148 TGGCCTGTGACCTTCCAGCCTGG + Intergenic
1125485064 15:40105891-40105913 TGGCCTTCGACCCACCAGCCAGG - Exonic
1130944168 15:88538611-88538633 TGGCGTTTTCTCTAACACCCCGG + Intronic
1132972887 16:2697522-2697544 TGGCATTTTCCCTCCAAGCCTGG - Intronic
1133039267 16:3051527-3051549 TGGTGTTTCACCAACCAGCTGGG + Intronic
1152989877 18:353416-353438 TGGAGTTAAACCTTCCAGCCTGG - Intronic
1163469046 19:17486379-17486401 GGGCCATTTACCAACCAGCCAGG - Intronic
929032543 2:37662628-37662650 TGGTGCTTTACTTGCCAGCCTGG - Intronic
932290775 2:70576781-70576803 TGGCTTTTTACCTAGCAGCGGGG - Intergenic
941635389 2:167930314-167930336 TGGCTTTTTCCCTTCCACCCGGG + Intergenic
943701265 2:190990321-190990343 TGACATTGTACCTACCAGCCAGG + Intronic
948295439 2:236856992-236857014 TGCAGTTTTACAGACCAGCCGGG + Intergenic
948425116 2:237882606-237882628 TGGCGATGTCCCTACCAACCTGG + Intronic
1169570425 20:6899799-6899821 TTCCCTTTTACCTACCAGTCTGG - Intergenic
1182067805 22:27442870-27442892 TGGCCTTTAAACCACCAGCCAGG - Intergenic
956257776 3:67302893-67302915 GGGCATTTTACCTATCATCCGGG - Intergenic
956617946 3:71191977-71191999 TGGGTTTTTACCTACTAGCAAGG + Intronic
963301281 3:143599964-143599986 TGGCGTTTTACCTACCAGCCCGG + Intronic
967782579 3:193456325-193456347 TGGTGGTGTACATACCAGCCTGG + Intronic
969905851 4:10395629-10395651 TGCAGTTTGACCTACAAGCCAGG + Intergenic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
981348388 4:143700529-143700551 CGGCGCTTTACCTGCCCGCCCGG - Exonic
985197672 4:187449655-187449677 TAGTGTTTTACCAAACAGCCAGG + Intergenic
986312898 5:6567964-6567986 TGTCTTTCTAGCTACCAGCCAGG + Intergenic
989459603 5:41682290-41682312 TGGCGTTTTACCTTGCTGCCTGG - Intergenic
996715709 5:126586395-126586417 TGGCCTTTTACCTCCCATTCTGG + Intronic
1003161961 6:3643843-3643865 TGGTGTATTACCTACCACCAGGG - Intergenic
1013682268 6:112537725-112537747 TGGGGTTTTAACTACAAACCAGG + Intergenic
1013959417 6:115881031-115881053 GGCCGTATTACCTACCAGCTTGG + Intergenic
1020208713 7:6141393-6141415 TGGGGTTTCACCTATCGGCCAGG + Intronic
1020449555 7:8305732-8305754 TGGCTTTTTCTCAACCAGCCTGG - Intergenic
1021438838 7:20653922-20653944 TGGTGTTTTAGCTACTTGCCTGG - Intronic
1021526895 7:21597963-21597985 TGCTGTGTTGCCTACCAGCCAGG - Intronic
1031691936 7:124799665-124799687 TGGAGTTTTGCTTATCAGCCAGG + Intergenic
1040301027 8:46188116-46188138 TGGTGCTTTACATTCCAGCCGGG + Intergenic
1042787883 8:72569484-72569506 AGGCATTTTACTTTCCAGCCAGG + Intronic
1049425066 8:142534306-142534328 TGGCGATTTCCATCCCAGCCTGG + Intronic
1188837791 X:34979278-34979300 TGTCATTTTAGCTATCAGCCTGG - Intergenic