ID: 963306051

View in Genome Browser
Species Human (GRCh38)
Location 3:143654473-143654495
Sequence TTTTAGACGTTGCAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963306051 Original CRISPR TTTTAGACGTTGCAGTTGGT GGG Intronic
901357518 1:8664065-8664087 TTGTGGACTTTGCAGTTAGTGGG - Intronic
906011866 1:42534702-42534724 TTTGAGACTTTGCTGTTGTTTGG - Intronic
907760748 1:57356684-57356706 TTTCAAACGATGCAGTTTGTAGG + Intronic
912836131 1:112998056-112998078 TTTTAGACTTTGCAGTGGAGGGG + Intergenic
916269429 1:162924018-162924040 TTTTTGATGTTGCACTTTGTGGG + Intergenic
917109959 1:171537692-171537714 TATTAGATGTTGAAATTGGTAGG + Intronic
922738492 1:228002688-228002710 TTTTTGACTTTGCAGGGGGTTGG - Intergenic
924927836 1:248700316-248700338 TTTTACACGCTATAGTTGGTTGG - Intergenic
1065168604 10:23005979-23006001 TTTTAGAAGTTGCAGTCAGGTGG + Intronic
1067951993 10:50748884-50748906 TTTTAGTCGTTTCAGGTGGGAGG + Intronic
1076015682 10:127025748-127025770 TTTTAAACGTTGCTGTTTTTGGG - Intronic
1078156570 11:8804838-8804860 TTTTAGAAGTAGCTGCTGGTTGG - Intronic
1079452686 11:20610815-20610837 TTTTAGTTGTTGCAGCTGGGTGG + Intronic
1087340536 11:96900218-96900240 TTTTAGGCATTTCAGTAGGTGGG + Intergenic
1090577925 11:128129164-128129186 TTTTGGATGTTGCTGCTGGTAGG - Intergenic
1090996394 11:131869579-131869601 TTTTAGAAATAGCAGTTGGAAGG - Intronic
1096128000 12:49134152-49134174 TATAAGAATTTGCAGTTGGTGGG + Intergenic
1104196724 12:126547030-126547052 TTTTAAACATTGCAATTGTTTGG - Intergenic
1104247743 12:127059795-127059817 TTTCAGTCATTGCAGTTGTTGGG + Intergenic
1104554060 12:129784116-129784138 TTTCAGTTGTTGCAGTAGGTGGG - Intronic
1110281513 13:73699193-73699215 TTTTAGAGATTGCAGTGGGGGGG - Intronic
1112331509 13:98480190-98480212 TTTTAGATATTACAGTTGGAAGG - Intronic
1128933928 15:71729627-71729649 TTTTAGACTGTCCAGTTGGTTGG + Intronic
1134146554 16:11769341-11769363 TTTTAGTAGTTGCAGTTGGTGGG - Intronic
1137011060 16:35320555-35320577 TTGTAGTCTTAGCAGTTGGTAGG - Intergenic
1137544110 16:49387688-49387710 TTGTTGTCGTTGTAGTTGGTAGG + Intronic
1140671367 16:77282951-77282973 ATTTAAACGTATCAGTTGGTAGG + Exonic
1140810385 16:78571570-78571592 TTAGAGGCGTTGCAGTTGGCTGG + Intronic
1143498547 17:7325972-7325994 TTTTAGAGATTGCAGGAGGTGGG + Intronic
1149243689 17:54680578-54680600 TGTGAGGCGTTGCAGTGGGTGGG - Intergenic
1164733134 19:30520762-30520784 CTTTAGACCTTGTAGATGGTGGG + Intronic
1165697270 19:37910057-37910079 TTTCAGACATTGCAGTTGTTAGG + Intronic
926487574 2:13481349-13481371 TTTAAGACGTGGTAGTCGGTTGG + Intergenic
926686047 2:15698492-15698514 TTCTAGAAGTTGCAGTTGTGGGG - Intronic
929493997 2:42423492-42423514 TTTTGGCAGTTGCACTTGGTTGG - Intronic
929556492 2:42928782-42928804 TTTTAGACTTTGCACTTCTTAGG - Intergenic
931307282 2:61042086-61042108 TTTTATACTTTTCAGTTGCTGGG + Intronic
931651367 2:64471861-64471883 TTTTAGGCCTTGGAGTGGGTAGG - Intergenic
934165600 2:89291333-89291355 TGTTAGAGGTTGCATTTGGAGGG - Intergenic
934201677 2:89891129-89891151 TGTTAGAGGTTGCATTTGGAGGG + Intergenic
944525754 2:200617871-200617893 TTTCATATGTTGCAGATGGTAGG - Intronic
946969524 2:225076290-225076312 ATTTAGATGTTGCATCTGGTAGG + Intergenic
1179370662 21:40803619-40803641 TGTTAAACCTTGTAGTTGGTTGG + Intronic
949463254 3:4317052-4317074 TTAAAGACGTGGTAGTTGGTTGG - Exonic
949860982 3:8504504-8504526 TTTATGACTTTCCAGTTGGTGGG - Intronic
954817480 3:53294214-53294236 TTTTAGAACGTGCACTTGGTCGG + Intronic
956204426 3:66740893-66740915 TTTTAGAAGTTGCTGTGGGGAGG + Intergenic
962180074 3:133197417-133197439 TTACAGAGGTTGCATTTGGTAGG + Intronic
963306051 3:143654473-143654495 TTTTAGACGTTGCAGTTGGTGGG + Intronic
964097854 3:152954033-152954055 TTTTAAACGTAGCTGTTGGGTGG - Intergenic
964163674 3:153675520-153675542 TTTTTGTCGTTGTTGTTGGTTGG + Intergenic
970604029 4:17662823-17662845 TTTTAGCCATTCCAGTGGGTGGG + Intronic
971540492 4:27810687-27810709 TTATAGACGTTTCTGTTGTTTGG - Intergenic
972288607 4:37670389-37670411 TTTTAGATGTTTCCATTGGTTGG + Intronic
972872508 4:43317312-43317334 TTTTACAAGTGGAAGTTGGTAGG + Intergenic
973302652 4:48605513-48605535 TTTTGGTTGTTGCAGATGGTAGG - Intronic
974212366 4:58795653-58795675 TTTTAGAAGTTGTATTTGGCAGG - Intergenic
975936066 4:79582418-79582440 GTTTAGATGTAGAAGTTGGTGGG - Intergenic
980893360 4:138837878-138837900 TTCTAGACCTTACAGTTAGTAGG - Intergenic
989802555 5:45561932-45561954 TTTAAGACTTTGCATTTGGCTGG + Intronic
997423209 5:133785526-133785548 TTTTAGAGGTTGGAGTTTGGGGG + Intergenic
1004964371 6:20831302-20831324 TTAAAGAAGTGGCAGTTGGTTGG + Intronic
1009479694 6:64141258-64141280 TTTTAGACAATGATGTTGGTTGG + Intronic
1010907814 6:81514549-81514571 TTTTAGACGTTTCATTTGGGAGG - Intronic
1011226664 6:85115644-85115666 TTTTAGCAGTTGCAGCTGTTGGG + Intergenic
1012304748 6:97640497-97640519 TTTAAGAGGTTGCAATTGGTGGG + Intergenic
1016271197 6:142292598-142292620 TTTTAGGAGTTGCAGGTGGAGGG - Intergenic
1017263047 6:152409863-152409885 TTTTAGACATTGGAGTAAGTAGG - Intronic
1018397787 6:163392888-163392910 TTTTAAACTTTGCAGTGAGTTGG + Intergenic
1018438600 6:163787289-163787311 TTTTGGGCATTGCAGTTTGTAGG - Intergenic
1023565461 7:41520318-41520340 TTTGTGACATTGCTGTTGGTTGG + Intergenic
1028119230 7:87039142-87039164 TTTTAGGTTTTCCAGTTGGTTGG - Intronic
1032794789 7:135268874-135268896 TTACAGACATTGCACTTGGTGGG + Intergenic
1039491685 8:37952604-37952626 TTTAAGACCATGAAGTTGGTGGG - Intergenic
1043563931 8:81526971-81526993 TATTAGTCGTTGCAGAAGGTGGG + Intronic
1044617646 8:94158571-94158593 TTTCAGAGCTTGCAGTGGGTTGG - Intronic
1053750403 9:41248471-41248493 TTCTTGCAGTTGCAGTTGGTTGG + Intergenic
1055787056 9:79882861-79882883 TTTTAGTTTTTGCACTTGGTAGG - Intergenic
1057048965 9:91907643-91907665 TTGTAGACATTGCAGTGAGTGGG - Intronic
1058257572 9:102787933-102787955 TTTCAGATGTTGCAATTTGTAGG + Intergenic
1062019433 9:134309656-134309678 TTTTAGCCATTTCAGTGGGTGGG + Intergenic
1196256003 X:113519898-113519920 TTTTACACTTTGCACTTTGTTGG - Intergenic
1196428779 X:115600119-115600141 CTCTAAACATTGCAGTTGGTTGG + Intronic
1198777702 X:140198390-140198412 TTATAGATGTGGCAGTTGGGAGG - Intergenic
1199994583 X:153013625-153013647 TTTTAAAAGATGCAGTTTGTAGG + Intergenic
1201066690 Y:10103354-10103376 TTCTTGCGGTTGCAGTTGGTTGG + Intergenic