ID: 963309968

View in Genome Browser
Species Human (GRCh38)
Location 3:143699469-143699491
Sequence CATGCTACACTGCTGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963309968_963309970 1 Left 963309968 3:143699469-143699491 CCTGGCAGCAGCAGTGTAGCATG 0: 1
1: 1
2: 4
3: 31
4: 268
Right 963309970 3:143699493-143699515 ATAAAGAGAATCTGTGCTTCTGG 0: 1
1: 0
2: 2
3: 33
4: 299
963309968_963309971 2 Left 963309968 3:143699469-143699491 CCTGGCAGCAGCAGTGTAGCATG 0: 1
1: 1
2: 4
3: 31
4: 268
Right 963309971 3:143699494-143699516 TAAAGAGAATCTGTGCTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 299
963309968_963309972 7 Left 963309968 3:143699469-143699491 CCTGGCAGCAGCAGTGTAGCATG 0: 1
1: 1
2: 4
3: 31
4: 268
Right 963309972 3:143699499-143699521 AGAATCTGTGCTTCTGGGACAGG 0: 1
1: 0
2: 9
3: 57
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963309968 Original CRISPR CATGCTACACTGCTGCTGCC AGG (reversed) Intronic
900514799 1:3076552-3076574 CAGGCTCCAGTGCTTCTGCCCGG - Intronic
901648962 1:10732546-10732568 CCTGCTTCACTGATGCTGCCAGG + Intronic
902390538 1:16102164-16102186 CATGCCACAGTGCTGCAGTCTGG - Intergenic
903105106 1:21071370-21071392 CATGCTACCATGCTCCAGCCTGG + Intronic
903294922 1:22337604-22337626 CATGGTACCCTGCATCTGCCTGG - Intergenic
903988452 1:27247098-27247120 CATGCCACTCTGCTCCAGCCTGG - Intronic
905218797 1:36429789-36429811 CATGCTACTGTGCTCCAGCCTGG - Intronic
906713668 1:47951501-47951523 CCGCCTACACTCCTGCTGCCAGG + Intronic
908276990 1:62483624-62483646 CATGCTACTATGCTCCAGCCTGG - Intronic
910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG + Intergenic
910724836 1:90327745-90327767 CATACCACATGGCTGCTGCCAGG - Intergenic
910761285 1:90734323-90734345 CCTGATGTACTGCTGCTGCCAGG - Intergenic
910941462 1:92539497-92539519 CATGCCACTGTGCTGCAGCCTGG + Intronic
911031295 1:93491431-93491453 CATGCCACAGTGCTCCAGCCTGG - Intronic
917246364 1:173005194-173005216 CATACCACACAGCTGCTGCTCGG + Intergenic
921270898 1:213468902-213468924 TATGCTTGACTCCTGCTGCCTGG + Intergenic
923809647 1:237298948-237298970 CATGCTACTGTGCTCCAGCCTGG + Intronic
924768234 1:247053985-247054007 TATGCTATGCGGCTGCTGCCAGG - Intronic
1064313986 10:14237693-14237715 TATGCTACACAGCTGTTGCTAGG + Intronic
1066558980 10:36647598-36647620 CATCCTACACTAATGCAGCCGGG + Intergenic
1069470189 10:68681551-68681573 CATGCCACTGTACTGCTGCCTGG - Intronic
1070830826 10:79417240-79417262 CATGCTCCTCTGCTCCTTCCTGG - Intronic
1072468470 10:95690034-95690056 CATGCTACTATACTGCAGCCTGG - Intronic
1074543738 10:114386650-114386672 CCTGCTCCACAGCAGCTGCCAGG + Intronic
1074840291 10:117344691-117344713 CATGCTAGACTTCTATTGCCAGG + Intronic
1076376700 10:129993098-129993120 CAAGCCACACAGCTGCTGCTAGG - Intergenic
1078020867 11:7655047-7655069 GATGCTAGACTCCTGCTACCAGG - Intronic
1079188004 11:18254431-18254453 CATGCAACACTCCTGTTGCCTGG - Intergenic
1079293179 11:19207070-19207092 GCTGCTACACTGCTGTGGCCAGG + Intronic
1080088866 11:28319831-28319853 CATGCTACACTCCTTTTTCCAGG - Intronic
1080451128 11:32379839-32379861 CAGGCCCCACTGCTGGTGCCTGG - Intergenic
1080966647 11:37220615-37220637 CATGCCACATGACTGCTGCCAGG + Intergenic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1081717856 11:45263591-45263613 CATGGGCCACTGCTGCTGCTGGG + Intronic
1081855899 11:46303598-46303620 CATGCTACTATGCTCCAGCCTGG + Intronic
1082898340 11:58217519-58217541 CATGCCACTCTGCTCCAGCCTGG - Intergenic
1083834201 11:65254142-65254164 CATGCTACACTGCCACCACCTGG + Intergenic
1084007755 11:66332272-66332294 CAAGCTACTCCTCTGCTGCCCGG + Exonic
1084763970 11:71295449-71295471 CATGCCACGCGGCTGCTGCCAGG + Intergenic
1086210872 11:84317106-84317128 CAAGCAACACAGCTGCAGCCGGG - Intronic
1087785413 11:102348204-102348226 CCTGCTGTACTGCTGCTGACAGG + Intronic
1088274055 11:108065646-108065668 CATGCCATACAGCTGCTGCTGGG + Intronic
1088945120 11:114504161-114504183 CATACTGCACTGCTACTGGCAGG - Intergenic
1090076160 11:123581282-123581304 AAGGCTCCACTGCTGCTCCCTGG + Intronic
1090733734 11:129593431-129593453 CAGGCTTCATGGCTGCTGCCTGG + Intergenic
1092069180 12:5618860-5618882 GATGATACTCTGCTGCTGACAGG - Intronic
1093122894 12:15294558-15294580 TGTGCCACACGGCTGCTGCCAGG - Intronic
1093990978 12:25590202-25590224 CTCACCACACTGCTGCTGCCAGG - Intronic
1094112968 12:26880903-26880925 CATGCTCTGCTTCTGCTGCCTGG - Intergenic
1095184344 12:39184551-39184573 CATGCTCCTCTGCTGCCGCTGGG - Intergenic
1095946178 12:47754892-47754914 CAGGCCACAGTGCTGGTGCCAGG - Intronic
1097463795 12:59897740-59897762 CATGCTACTGTGCTCCAGCCTGG - Intergenic
1097714963 12:62956014-62956036 CATGCTGCATGGCTGCTGCAGGG + Intergenic
1099433611 12:82618495-82618517 CACACTACACCACTGCTGCCAGG - Intergenic
1099826234 12:87780599-87780621 TGTGCTGCACAGCTGCTGCCAGG + Intergenic
1101423215 12:104566078-104566100 CATGCCACAGTCATGCTGCCTGG - Intronic
1101573142 12:105973598-105973620 CATGCCACTGTGCTCCTGCCTGG + Intergenic
1101904548 12:108814902-108814924 CATCCCACTCCGCTGCTGCCTGG - Intronic
1102251097 12:111388096-111388118 CACGCTTCGCTGCAGCTGCCTGG + Intergenic
1104010259 12:124925275-124925297 CATCCTGCTCTTCTGCTGCCAGG - Intergenic
1104391833 12:128397436-128397458 CTTGCTACACTGCTGCAGCTGGG - Intronic
1105209504 13:18249650-18249672 CCTGCTGCACTGCTGTTGCCAGG + Intergenic
1105958499 13:25306527-25306549 CCAGCCACACTACTGCTGCCAGG + Intronic
1108178967 13:47822218-47822240 AATACCACACTGCTGCTCCCAGG - Intergenic
1109367305 13:61372311-61372333 CATGGCTCACTGCTGCAGCCTGG - Intergenic
1110101650 13:71613778-71613800 CATGGCTCACTGCTGCAGCCTGG + Intronic
1111561618 13:89957269-89957291 CATGCTACTGCGCTGCAGCCTGG - Intergenic
1112020139 13:95364363-95364385 CATGCCACTGTGCTCCTGCCTGG - Intergenic
1114542544 14:23472454-23472476 CATGCCACTGTGCTGCAGCCTGG + Intronic
1114783854 14:25571001-25571023 CATGCCACACAGCTGCTTCAAGG + Intergenic
1116380622 14:44263174-44263196 CATGTTACACTTTTGCTCCCAGG + Intergenic
1116689975 14:48093363-48093385 CATGCTACACTGGTTATGACAGG - Intergenic
1117233869 14:53751532-53751554 TGTGCTGCACAGCTGCTGCCAGG - Intergenic
1117681377 14:58205976-58205998 CATGCCACTGTGCTGCAGCCTGG + Intronic
1118297699 14:64585471-64585493 CATGCTACTGTGCTCCAGCCTGG + Intronic
1118530428 14:66699105-66699127 CATGCTACACTGCTGATAACTGG - Intronic
1120975899 14:90248055-90248077 CATGCTTCCCTTCTGCTGCCAGG - Intergenic
1121242314 14:92439721-92439743 AATGCTCCACTGCAGCTGGCAGG - Intronic
1122031100 14:98913181-98913203 GATGCTGCACTGGGGCTGCCTGG + Intergenic
1122205635 14:100146601-100146623 CAGCCCACACTGCTGTTGCCAGG + Exonic
1122612565 14:102995643-102995665 CAGGTTTCACAGCTGCTGCCTGG - Intronic
1122690333 14:103529240-103529262 CCTGCGACGCTCCTGCTGCCGGG - Exonic
1125406945 15:39362654-39362676 CATTCTACAATGTTGCAGCCAGG + Intergenic
1125434529 15:39630811-39630833 TATGGTACCATGCTGCTGCCAGG - Intronic
1125647093 15:41281989-41282011 CAGTCTACTCTGCTGCTGCCTGG + Intergenic
1125688644 15:41578866-41578888 CATGCTTCCCTGCAGCTGACCGG + Exonic
1131059452 15:89395623-89395645 CATGCTGCTGTGCTGTTGCCAGG + Intergenic
1132416643 15:101625068-101625090 CATGCAACACCGCAGCTGCAGGG + Intronic
1202971470 15_KI270727v1_random:242083-242105 GATGCTACACTGCTGGTGGTGGG + Intergenic
1132488064 16:207263-207285 CATGCTACTTTGCTTCAGCCTGG - Intronic
1132869914 16:2111380-2111402 CATGCTCCACTGTTGCCTCCGGG + Exonic
1133228179 16:4353023-4353045 CATGCTACTGTACTGCAGCCTGG - Intronic
1133324221 16:4933640-4933662 TATGCTCCATTGCTCCTGCCTGG + Intronic
1133936175 16:10271296-10271318 CATGCTACCGTGCTCCAGCCTGG + Intergenic
1138148998 16:54637794-54637816 CTTGCTCCACTACTTCTGCCAGG + Intergenic
1139366962 16:66439426-66439448 CATGCTGGGCTGCTCCTGCCTGG - Intronic
1142006537 16:87692047-87692069 CATGCTGCCCTGGTCCTGCCCGG + Intronic
1142388219 16:89780578-89780600 CATGCTACCCTACTGCAGCCTGG + Intronic
1145752252 17:27363548-27363570 CAAGCCAAACTGCTGGTGCCTGG + Intergenic
1146502234 17:33374037-33374059 CATGCTACTGTGCTGCAGCCTGG - Intronic
1146790324 17:35747218-35747240 CATGCTGCACTGGTGGGGCCGGG + Exonic
1147584755 17:41647855-41647877 CATCCTTTTCTGCTGCTGCCGGG - Intergenic
1147859316 17:43508506-43508528 CATGTTACCTTTCTGCTGCCTGG - Exonic
1147886780 17:43689670-43689692 CAGGCATCACTGCTGCTGCTGGG - Intergenic
1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG + Intronic
1151579169 17:74968485-74968507 CATGTTACCCTGCAGCTCCCTGG - Intronic
1152722400 17:81929360-81929382 TATGCTACTCTGCAGGTGCCTGG - Intergenic
1154172295 18:12060856-12060878 CATGCTACATGGCTGGTGGCGGG + Intergenic
1154229768 18:12544887-12544909 CATGTTACATTACTGGTGCCAGG + Intronic
1155087031 18:22468700-22468722 CTTGCCACACAGCTGCTGCCAGG + Intergenic
1155281948 18:24249561-24249583 CATGCTGTACAGCTGTTGCCAGG - Intronic
1155767339 18:29652325-29652347 CATGCCACACTGTTGCTGCTGGG - Intergenic
1159241921 18:65751826-65751848 CATGGTACACTGCTACTTGCCGG + Intronic
1162412850 19:10517126-10517148 CATACTTCAGTCCTGCTGCCGGG - Intronic
1164525374 19:29009493-29009515 CATGCTAAAATGCTGATTCCCGG + Intergenic
1166154700 19:40902164-40902186 CCAGCTTCACTGCTGCTGCTGGG - Intergenic
1166173370 19:41048065-41048087 CCAGCTTCACTGCTGCTGCTGGG + Intergenic
1166297589 19:41896592-41896614 CATGCTCCTCTGCTGCTCTCTGG + Intronic
1166928789 19:46288467-46288489 CATGCTACAGTACTCCAGCCTGG + Intergenic
1168015939 19:53573173-53573195 CACGCTACTGTGCTGCAGCCTGG + Intronic
1168548244 19:57271695-57271717 CCTGCTACAGTACTGCAGCCTGG + Intergenic
924997964 2:381404-381426 GAGGCTGCCCTGCTGCTGCCTGG + Intergenic
925081710 2:1074168-1074190 GGGGCTACACTGCAGCTGCCGGG - Intronic
925725197 2:6865336-6865358 CAGGCTGCTCTGCTACTGCCCGG - Exonic
928623088 2:33110893-33110915 CATGCTAAATTTCTGCTGTCTGG - Intronic
930041652 2:47129631-47129653 CATGCCACGTGGCTGCTGCCAGG + Intronic
930475344 2:51875101-51875123 AATGCCGCACAGCTGCTGCCAGG - Intergenic
930493785 2:52111262-52111284 CATGCCACTGTGCTCCTGCCTGG + Intergenic
933704082 2:85277003-85277025 CATGCTGCCCTGCTGCTCCCCGG - Intronic
935344557 2:102093868-102093890 GATGCCCCACTGCAGCTGCCGGG - Intronic
936007690 2:108905584-108905606 CAGGCTCCACTCCCGCTGCCCGG + Intronic
937315644 2:120930602-120930624 CAGGGGACACTGCTGCTGCTTGG - Intronic
938863745 2:135397084-135397106 CATGCTACTGTGCTCCAGCCTGG + Intronic
939800305 2:146699739-146699761 CGTACCACACAGCTGCTGCCAGG - Intergenic
942541082 2:177016189-177016211 TGTGCTACACAGGTGCTGCCTGG + Intergenic
943774438 2:191750040-191750062 CCTGCTAAACAGCTGCTGCCTGG + Intergenic
944894538 2:204150764-204150786 CATGCTAGACTGCAGCCGCCAGG + Intergenic
945563501 2:211367678-211367700 CATGCATCTCTGCTGCTCCCAGG + Intergenic
945649090 2:212537871-212537893 CCTGCTGCACTCCGGCTGCCCGG + Intronic
946103662 2:217351032-217351054 CATGCTAGTCTGCTGCAGCAAGG + Intronic
1168918324 20:1509870-1509892 CATTCTGCTCTTCTGCTGCCAGG - Intergenic
1173103328 20:40107838-40107860 CATCCTACAATGCTGCTTCTTGG + Intergenic
1178121306 21:29473158-29473180 CATCTTTCACTGCTCCTGCCCGG + Intronic
1178668337 21:34568170-34568192 CATTCAGCACTGCAGCTGCCTGG + Intronic
1179542024 21:42089211-42089233 CAGGCTAGTCTGCTGCTCCCAGG + Intronic
1180375693 22:12091032-12091054 CCTGCTCCACTGCAGCAGCCAGG + Intergenic
1180762005 22:18217621-18217643 CATATTACATGGCTGCTGCCTGG - Intergenic
1180766762 22:18349750-18349772 CGTGCTGCACTGCGGTTGCCAGG - Intergenic
1180773662 22:18406989-18407011 CATATTACATGGCTGCTGCCTGG + Intergenic
1180779552 22:18512628-18512650 CGTGCTGCACTGCGGTTGCCAGG + Intergenic
1180805732 22:18712875-18712897 CATATTACATGGCTGCTGCCTGG - Intergenic
1180812267 22:18769949-18769971 CGTGCTGCACTGCGGTTGCCAGG + Intergenic
1180937276 22:19634027-19634049 CATGCGACTGTGCTGCAGCCTGG + Intergenic
1181198426 22:21204196-21204218 CGTGCTGCACTGCGGTTGCCAGG + Intergenic
1181648217 22:24245286-24245308 CCTGCTGCACTGCGGTTGCCAGG + Intergenic
1181703282 22:24632685-24632707 CCTGCTGCACTGCGGTTGCCAGG - Intergenic
1183212890 22:36461852-36461874 TCTGCCACACTGCTGCTCCCAGG - Intergenic
1184292855 22:43507407-43507429 CCCGATACAGTGCTGCTGCCAGG - Exonic
1184684173 22:46088577-46088599 CACAGTACACTGTTGCTGCCGGG + Intronic
1185092431 22:48783453-48783475 CATGCCCCACTGCTCCTGGCCGG + Intronic
1203228381 22_KI270731v1_random:90641-90663 CGTGCTGCACTGCGGTTGCCAGG - Intergenic
949263069 3:2124727-2124749 CATGCTACTCTACTCCAGCCTGG + Intronic
949888534 3:8714892-8714914 CATGTTTCTCTGCTACTGCCTGG + Intronic
949954640 3:9257746-9257768 CATGCTACTGTGCTCCAGCCTGG - Intronic
950187372 3:10953459-10953481 CGTGTTAGCCTGCTGCTGCCAGG - Intergenic
952857808 3:37786547-37786569 CATGCCACTCTGCTCCAGCCTGG + Intronic
953024908 3:39139213-39139235 CATGCTACCCTGAGTCTGCCTGG + Intergenic
954369487 3:50162726-50162748 CACGACACACTGCTGCTGCCTGG + Intronic
955976200 3:64482663-64482685 CATGATATAGTGCTGCTTCCTGG + Intergenic
959443876 3:106413066-106413088 TGTGCCACACGGCTGCTGCCAGG + Intergenic
959918296 3:111843432-111843454 CATGCTACTGTGCTCCAGCCTGG - Intronic
960479346 3:118170394-118170416 CGTGCTACACTGCTGCTCCTAGG - Intergenic
963224430 3:142847578-142847600 CATGCCACTGTGCTGCAGCCTGG - Intronic
963309968 3:143699469-143699491 CATGCTACACTGCTGCTGCCAGG - Intronic
964179214 3:153864237-153864259 CATGCCACATGGCTGCTGCTGGG - Intergenic
964479498 3:157127659-157127681 GATGCTACCCTGCTGCTGGCGGG - Intergenic
964505133 3:157391009-157391031 CTTGCAACTCTGCTGATGCCTGG + Intronic
964570587 3:158105078-158105100 CAGGCTACGCTGCTTCTCCCGGG - Exonic
965685258 3:171295677-171295699 CATTTTACACTGTGGCTGCCTGG + Intronic
966830366 3:184002791-184002813 CAGGCTACCCTGCTGTTGTCCGG - Intronic
967206583 3:187128551-187128573 CATGCTACTCTGCTCCAGCATGG - Intronic
968236518 3:197033929-197033951 CATGTTACACTCTTGCTGACTGG + Intergenic
969084914 4:4649086-4649108 CAGCACACACTGCTGCTGCCTGG + Intergenic
969426851 4:7129470-7129492 CACTCTGCACGGCTGCTGCCTGG + Intergenic
970102195 4:12537489-12537511 CATGCAGCCCTGCTGCTGTCTGG - Intergenic
971391385 4:26189171-26189193 CATGCTACTGTACTCCTGCCTGG + Intronic
971567116 4:28159605-28159627 CATTCTACACTGTTGCTGTGGGG - Intergenic
972425283 4:38927105-38927127 CTTGCTACACTGCAGCTGGAAGG + Intronic
972530300 4:39955555-39955577 CATGCTACTGTGCTCCAGCCCGG + Intronic
975489828 4:74976253-74976275 CATTCTCCCCTGCTGGTGCCAGG + Intronic
975891389 4:79032830-79032852 CGTGCTACTCTGCTCCAGCCTGG + Intergenic
976302504 4:83528613-83528635 CATGCTACTGTGCTCCAGCCTGG + Intergenic
976468750 4:85402221-85402243 CATGCCACACTGCTCCAGCCTGG - Intergenic
978008780 4:103652425-103652447 CATGCCACATGGCTGCTGCTGGG + Intronic
980570252 4:134607162-134607184 CATGCCACTGTGCTGCAGCCTGG - Intergenic
981681931 4:147409252-147409274 CCTGCTGCACTGCTACTGACTGG + Intergenic
982683495 4:158459990-158460012 CATGCCATACAGCTGCTGCCAGG + Intronic
983332617 4:166350725-166350747 CATGCTACTCTACTCCAGCCTGG + Intergenic
985384867 4:189434668-189434690 CATGCCACACAGCTGCTGCCAGG + Intergenic
986052805 5:4105549-4105571 CCTGCCCCACTGCTCCTGCCTGG - Intergenic
986885341 5:12226800-12226822 CATGCCACACAGCTACTCCCAGG + Intergenic
988429820 5:31106434-31106456 CTTGCCACTCTTCTGCTGCCAGG - Intergenic
989215459 5:38900269-38900291 CATGACACAGGGCTGCTGCCAGG + Intronic
989502360 5:42182758-42182780 CATGCCACATGGCTGCTGCCAGG - Intergenic
990037641 5:51341702-51341724 CATTCTATACTTCTGCTTCCTGG - Intergenic
990724358 5:58736815-58736837 CATAATACACTGCTGCCACCTGG + Intronic
991237570 5:64417451-64417473 CATGCCAAATGGCTGCTGCCAGG - Intergenic
991676311 5:69092872-69092894 CATGCTACTGTGCTCCAGCCTGG - Intergenic
991690360 5:69219389-69219411 GATGCCACACTCCTGCTGCCAGG - Intronic
992579329 5:78155286-78155308 CATGCCACACTGCTGCTGCCAGG + Intronic
993287457 5:86017181-86017203 CATGCTGCACAGCTGCTGCCAGG + Intergenic
994881199 5:105498598-105498620 CCAGCTACACAGCTGCTGCTAGG + Intergenic
997341395 5:133147840-133147862 GAAGCTTCACTGCTTCTGCCAGG + Intergenic
998265873 5:140667377-140667399 CATGCTACTCTCCTGCTACAAGG + Intronic
998329883 5:141316062-141316084 CATGCTACTGTGCTCCAGCCTGG - Intergenic
1000365223 5:160484517-160484539 CATGCTGCTCTGCTGTTCCCTGG + Intergenic
1001074321 5:168614376-168614398 CATTCTGCACTCCAGCTGCCAGG - Intergenic
1001958633 5:175866169-175866191 GATGCTACACTGATTGTGCCTGG + Intronic
1002575224 5:180170519-180170541 CGCGCTACGCAGCTGCTGCCTGG + Intronic
1004661282 6:17712033-17712055 CATGCTACGGTACTGCAGCCTGG + Intergenic
1004996905 6:21202436-21202458 CAGGTTACACTGCTCCTTCCTGG - Intronic
1005157195 6:22820084-22820106 CATGCTGCATGGCTGCTGGCAGG + Intergenic
1008848691 6:55997762-55997784 CATGCCATGCAGCTGCTGCCAGG + Intergenic
1008899789 6:56597988-56598010 GCTGCTTCACTGCTGCTACCTGG + Exonic
1010425689 6:75726698-75726720 CATGCTACTGTGCTCCAGCCTGG - Intergenic
1010560427 6:77341884-77341906 CATGCCACATGGCTGCTGCCAGG + Intergenic
1013351467 6:109309788-109309810 CCTGCTCCACTGTTGCTCCCAGG - Intergenic
1014074041 6:117216206-117216228 CATGCCACACAGCTGCTGCTGGG + Intergenic
1015150833 6:130035303-130035325 CATGGTAGACTGGGGCTGCCAGG + Intronic
1016228583 6:141772746-141772768 CATGCCACACAGCTGCTGCTGGG + Intergenic
1017118070 6:150997373-150997395 CATGCTACATTTTTGCTGTCCGG + Intronic
1018040710 6:159919448-159919470 CATGCCACACTGCAGCAGCTGGG - Intergenic
1018369713 6:163156495-163156517 CCTCTTCCACTGCTGCTGCCTGG + Intronic
1018787586 6:167120260-167120282 GGTGGTGCACTGCTGCTGCCTGG + Intergenic
1019173340 6:170147097-170147119 CATGCCAGGATGCTGCTGCCTGG - Intergenic
1020136480 7:5590899-5590921 CCTGGTCCACAGCTGCTGCCAGG - Intergenic
1025999877 7:66552362-66552384 CATGCTACTCTACTCCAGCCTGG + Intergenic
1030629326 7:111878615-111878637 CATGCTGCATAGCTACTGCCGGG - Intronic
1031057284 7:117006325-117006347 CATGCTACACTGCTACTGACTGG - Intronic
1031410369 7:121434234-121434256 CTTTCTCCACTGCTGCTTCCTGG - Intergenic
1032028333 7:128461132-128461154 CATGCCACTGTGCTGCAGCCTGG + Intergenic
1032676473 7:134134275-134134297 CATGCTAAACTGCTCCACCCTGG - Intronic
1034172549 7:149073519-149073541 CATGCTACTGTGCTCCAGCCTGG + Intronic
1035030149 7:155851605-155851627 AATGCTAAGCTGCTGCAGCCGGG + Intergenic
1036224228 8:6944518-6944540 CAGGCCACACTCCTGCTGCAGGG - Intergenic
1037551226 8:19973669-19973691 CATGCAACACTTGTGCTGACAGG - Intergenic
1038245865 8:25855351-25855373 CTTGGCACACTGCTACTGCCAGG + Intronic
1041144060 8:54853324-54853346 CTTCCTTCACTGCTGCTTCCTGG - Intergenic
1041232427 8:55767493-55767515 CCTGCTAAACTGCTGATGTCCGG - Intronic
1041852361 8:62405609-62405631 CATGCGGCAGTGCTGCTGCTGGG + Intronic
1042408605 8:68435450-68435472 CATGCTTCCCTGCTGCAGGCTGG - Intronic
1043214876 8:77573608-77573630 CATGCTACATGGCTGCTGCCAGG - Intergenic
1043307031 8:78807146-78807168 CATACTTCAATGCTGCTGTCAGG - Intergenic
1043760711 8:84063935-84063957 CACGGCACACCGCTGCTGCCGGG + Intergenic
1044058137 8:87598187-87598209 CATGCTACACAACTGCTTACAGG + Intronic
1046050394 8:109014819-109014841 CATGCCACTCTGCTCCAGCCTGG + Intergenic
1046310058 8:112423901-112423923 CATACTTCACAGCTTCTGCCAGG - Intronic
1047352549 8:124089359-124089381 CATGCTACAGGGCCACTGCCAGG + Intronic
1047986946 8:130245034-130245056 TATTCTGCACTGCTGCTTCCTGG - Intronic
1050145091 9:2559322-2559344 TGTGCTACACGGCTGCTGCCAGG - Intergenic
1050644419 9:7703339-7703361 CATCCTACATTGCTGCTGCTTGG + Intergenic
1052372683 9:27683399-27683421 CAGGCTAGACTGCTGGTCCCAGG + Intergenic
1052409032 9:28098970-28098992 CATGCTACACTGAAGCTGGTGGG + Intronic
1053592909 9:39532722-39532744 CAGGCCACCCTGCTGCGGCCAGG + Intergenic
1053850644 9:42287429-42287451 CAGGCCACCCTGCTGCGGCCAGG + Intergenic
1054573397 9:66832556-66832578 CAGGCCACCCTGCTGCAGCCAGG - Intergenic
1055580092 9:77699126-77699148 CATGCCACATGGCTGCTACCAGG + Intergenic
1055591558 9:77820448-77820470 CATACTGAACTGCTGCTGGCTGG + Intronic
1056180240 9:84075953-84075975 CACACTACAAGGCTGCTGCCAGG - Intergenic
1056454893 9:86750910-86750932 CATGCCACACGCCTGCGGCCTGG + Intergenic
1057206692 9:93177813-93177835 CCTGCTTCCCTGCTGCTGCTAGG - Intergenic
1059268759 9:113059924-113059946 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059269895 9:113065373-113065395 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059271029 9:113070821-113070843 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059272162 9:113076267-113076289 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059273297 9:113081709-113081731 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059274433 9:113087155-113087177 CTTTCTGCTCTGCTGCTGCCGGG + Intergenic
1059555610 9:115277179-115277201 CATGCCACATGGCCGCTGCCAGG + Intronic
1060467758 9:123922529-123922551 TGTTCTAAACTGCTGCTGCCAGG + Intronic
1060954979 9:127632316-127632338 CATGCTACTGTGCTCCAGCCTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062426388 9:136508062-136508084 CACGCACCACTGCCGCTGCCAGG - Exonic
1062582657 9:137235348-137235370 CATGCTGCACCGCCGCTGACAGG + Intronic
1203538081 Un_KI270743v1:61334-61356 CCTGCTCCACTGCAGCAGCCAGG + Intergenic
1186474371 X:9845764-9845786 GTTGCGACACTGCAGCTGCCAGG - Intronic
1187612755 X:20960584-20960606 CATGCCACACAGCTACTGCCAGG - Intergenic
1187688525 X:21840100-21840122 CCTGCTGCACTGCAGCTGCTGGG - Intronic
1188210505 X:27418677-27418699 CATGCCACATTGCTGCTACTGGG - Intergenic
1188237861 X:27751516-27751538 CTGTCTACACTGCTGCTCCCTGG + Intergenic
1189628042 X:42920689-42920711 CATGCCACACAGCTACTGCCAGG - Intergenic
1190108720 X:47576064-47576086 CAGTTTGCACTGCTGCTGCCTGG + Intronic
1191947028 X:66545404-66545426 CATTCCACACAGCTGCTGTCAGG + Intergenic
1192726052 X:73753158-73753180 CACACCACGCTGCTGCTGCCAGG + Intergenic
1192836506 X:74805091-74805113 CATGCCCCATGGCTGCTGCCAGG + Intronic
1193092426 X:77509578-77509600 CCTGCCACACGGCTGCTGCCAGG - Intronic
1194787737 X:98107021-98107043 CCCCCCACACTGCTGCTGCCAGG + Intergenic
1195222549 X:102760335-102760357 CTTGCTTCTCTGCTGCTGACAGG + Intergenic
1195290165 X:103424472-103424494 CAGGCTTCACAGCTGCTGCCAGG + Intergenic
1196669744 X:118352854-118352876 CAAGTTACAGTGCTGCTTCCTGG + Intronic
1196806178 X:119588297-119588319 GTTGCTACAAGGCTGCTGCCCGG + Intergenic
1198795445 X:140389518-140389540 CATGCCTCACTGCAGCTGGCAGG + Intergenic
1198992999 X:142537661-142537683 CATGCCACTCTACTGCAGCCTGG + Intergenic
1199845701 X:151691640-151691662 CATGCTAAGCTTCTGCTCCCAGG + Intergenic
1200038650 X:153349915-153349937 CAAGCCCCACTGCTGCTGGCGGG - Exonic
1200788299 Y:7277692-7277714 CATGCTACTCTACTCCAGCCTGG + Intergenic