ID: 963310811

View in Genome Browser
Species Human (GRCh38)
Location 3:143708232-143708254
Sequence CAGCCCATTCAGTTTGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963310804_963310811 18 Left 963310804 3:143708191-143708213 CCTGATTGTGTGTCTATCATATC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 963310811 3:143708232-143708254 CAGCCCATTCAGTTTGAAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 315
963310807_963310811 -4 Left 963310807 3:143708213-143708235 CCACTATCTGGGAGCATACCAGC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 963310811 3:143708232-143708254 CAGCCCATTCAGTTTGAAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963310811 Original CRISPR CAGCCCATTCAGTTTGAAAG GGG Intronic
901439880 1:9271504-9271526 CAGTGCATTCCGTTTGCAAGAGG + Intergenic
903461266 1:23522486-23522508 CAGCTCACTCAGCTAGAAAGTGG + Intronic
903598040 1:24511715-24511737 GAGCACATCCCGTTTGAAAGCGG + Intronic
906977176 1:50588464-50588486 CAGCCCATAAAGTCTGGAAGAGG - Intronic
907337514 1:53710091-53710113 CTGCCCATTCAGCTTGGAAGAGG + Intronic
907730672 1:57062359-57062381 CTGCCCATCTAATTTGAAAGTGG - Intronic
908463497 1:64368983-64369005 CATCTGAGTCAGTTTGAAAGAGG - Intergenic
908910574 1:69068115-69068137 TTGCCCATTCAGTTTGATATTGG + Intergenic
909870621 1:80734111-80734133 TTGCCCATTCAGTATGAAATTGG - Intergenic
910425112 1:87113840-87113862 CAACACATTCTTTTTGAAAGAGG + Intronic
911927497 1:103853126-103853148 TTGCCCATTCAGTTTGATATTGG + Intergenic
911932728 1:103925378-103925400 AAGCCCATTCAGTATGATATTGG - Intergenic
912028887 1:105214284-105214306 CTGCCCATTCAGTATGATATTGG - Intergenic
912456175 1:109799064-109799086 CAGCCCATCCATTATGAAAATGG + Intergenic
912874468 1:113343658-113343680 TAGCCCATTCAGTATGATATTGG - Intergenic
912881026 1:113413983-113414005 TAGCCCATTCAGTATGATATTGG + Intronic
914683099 1:149954152-149954174 CTGCCCATTCAGTATGATATTGG + Intronic
915438252 1:155925722-155925744 CAGCACATTCAGATTGAAACAGG - Exonic
916647579 1:166801151-166801173 TTGCCCATTCAGTTTGATATTGG + Intergenic
916936591 1:169633985-169634007 CAGCCCATACAGCCTGAAATTGG + Intergenic
917192770 1:172435631-172435653 CTGCCCATTCAGTATGATATTGG - Intronic
917576136 1:176323629-176323651 CAGAGCATTCAGTTTGAGGGTGG - Intergenic
918404823 1:184201328-184201350 GAGCCCATTCAGACTCAAAGAGG + Intergenic
919818392 1:201456539-201456561 CAGCCCTGTGAGTTTGGAAGAGG - Intergenic
921248286 1:213270753-213270775 CAGACAATTCAGTTTTAAAATGG + Intronic
922387662 1:225103996-225104018 TTGCCCATTCAGTGTGATAGTGG + Intronic
924066055 1:240223090-240223112 CTGCCCATTCAGTATGATATTGG + Intronic
924296398 1:242590963-242590985 TTGCCCATTCAGTATGATAGTGG - Intergenic
1068115420 10:52732486-52732508 CTGCCCATTCAGTATGATATTGG + Intergenic
1068134486 10:52938472-52938494 CAGTCCATGCATTTTGATAGAGG + Intergenic
1071421176 10:85501154-85501176 CTGCCCATTCAGTATGATATTGG + Intergenic
1072493322 10:95930501-95930523 CTGCCCATTCAGTTTGATATTGG + Intronic
1073864426 10:107785698-107785720 CATTCTATTCAGTTTGAAAAGGG + Intergenic
1074194447 10:111169145-111169167 CAGCCCATTCAGTATGATATTGG - Intergenic
1075582481 10:123632597-123632619 TAGCCCATTCAGTATGATATTGG - Intergenic
1076123434 10:127954367-127954389 CAGCACCTTCATTGTGAAAGGGG + Intronic
1078119659 11:8493983-8494005 TTGCCCATTCAGTATGATAGTGG - Intronic
1079133343 11:17762181-17762203 CAGCCCATGCAGTGTGAGTGAGG - Intronic
1079232664 11:18662790-18662812 TTGCCCATTCAGTATGATAGTGG - Intergenic
1081410616 11:42753492-42753514 CTGCCCATTCAGTATGATATTGG + Intergenic
1082155106 11:48800552-48800574 TTGCCCATTCAGTTTGATATTGG + Intergenic
1082196238 11:49309850-49309872 CTGCCCATTCAGTATGATATTGG + Intergenic
1085221707 11:74879570-74879592 CTGCCCATTCAGTATGATATTGG + Intronic
1085222969 11:74891439-74891461 CTGCCCATTCAGTATGATATTGG - Intronic
1085828040 11:79868733-79868755 CTGCCCATTCAGTATGATATTGG - Intergenic
1086440702 11:86826598-86826620 CTGCCCATTCAGTATGATATTGG + Intronic
1087337218 11:96859794-96859816 TAGCCCATTCAGTATGATATTGG + Intergenic
1089106324 11:116008927-116008949 TTGCCCATTCAGTATGATAGTGG - Intergenic
1089952552 11:122542962-122542984 AAGGGCATCCAGTTTGAAAGAGG - Intergenic
1091050799 11:132368931-132368953 CTGCCCATTCAGTATGATATTGG - Intergenic
1093828309 12:23722862-23722884 AAGCGCAATCAGTTTGGAAGCGG + Intronic
1094873183 12:34610613-34610635 CTGCCCATTCAGTATGATATTGG + Intergenic
1095862249 12:46930512-46930534 CAGTCCATTAATGTTGAAAGTGG - Intergenic
1096485151 12:51975337-51975359 CATCCCATCCAGATTGAAAATGG - Exonic
1097560988 12:61205986-61206008 TTGCCCATTCAGTATGAAATTGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098733715 12:74070035-74070057 TTGCCCATTCAGTTTGATAGTGG - Intergenic
1098982154 12:76968242-76968264 CAGCCCATTATCTTTCAAAGAGG + Intergenic
1098993539 12:77092559-77092581 TTGCCCATTCAGTTTGATATTGG + Intergenic
1099239778 12:80125143-80125165 CTGCCCATTCAGTATGATATTGG + Intergenic
1099820116 12:87698375-87698397 TTGCCCATTCAGTTTGATATTGG + Intergenic
1100110278 12:91233533-91233555 CTGCCCATTCAGTATGATATTGG - Intergenic
1100522174 12:95385619-95385641 CAGCCCATGCAGTTAGGAAGAGG - Intergenic
1100963313 12:99986433-99986455 CATCACATTCATTTTGAAAATGG + Intergenic
1102428701 12:112864731-112864753 CAGGACATTCATTTTCAAAGGGG + Intronic
1103154320 12:118670677-118670699 CTGCCCATTCAGTATGATATTGG + Intergenic
1104401754 12:128481999-128482021 CTGCCCATTCAGTGTGATATTGG + Intronic
1104788351 12:131466361-131466383 CAGCCCATTCATTTTGGGAAGGG + Intergenic
1106415051 13:29539479-29539501 CTGCCCCTTCATTTTGAAGGGGG - Intronic
1107304419 13:39002952-39002974 CTGCCCATTCAGTATGATATTGG + Intergenic
1108779113 13:53806272-53806294 AAGGCCATTCATCTTGAAAGGGG + Intergenic
1110101241 13:71607058-71607080 CATCCCATTTTCTTTGAAAGTGG - Intronic
1110426298 13:75370962-75370984 CAGTGCTTACAGTTTGAAAGAGG + Intronic
1111237606 13:85430387-85430409 CATGTCAATCAGTTTGAAAGTGG + Intergenic
1113020940 13:105886539-105886561 TTGCCCATTCAGTTTGATATTGG + Intergenic
1113762938 13:112862829-112862851 CAGCCCATGCAGTTTCCCAGCGG + Intronic
1114677113 14:24449668-24449690 TTGCCCATTCAGTTTGATATTGG + Intergenic
1114828569 14:26110298-26110320 TTGCCCATTCAGTTTGATATTGG - Intergenic
1115395967 14:32908674-32908696 CAGAGCTTTCTGTTTGAAAGAGG + Intergenic
1117469844 14:56032095-56032117 CAACCCCTTCAGATTGTAAGAGG + Intergenic
1117793424 14:59365157-59365179 CACCCCAGTCAGTGTGCAAGGGG - Intronic
1118856294 14:69625896-69625918 CAGGCCATCCAGGTTGAAAGCGG - Intronic
1120262828 14:82209239-82209261 CAGCCCATTCAACTTAAAAAAGG - Intergenic
1120638233 14:86977977-86977999 CTGCCCATTCAGTATGATATTGG - Intergenic
1121146607 14:91589192-91589214 CTGCCCATTCAGTGTGACAGAGG - Intronic
1122093504 14:99354826-99354848 GAGCCCATGCACTCTGAAAGAGG - Intergenic
1122980422 14:105189647-105189669 CAACACATTCCGTTTGATAGTGG + Intergenic
1123821553 15:24035692-24035714 CAGCCCATTCAAATGCAAAGAGG - Intergenic
1125079730 15:35658137-35658159 CACTCTATTCTGTTTGAAAGAGG - Intergenic
1125207776 15:37174341-37174363 TTGCCCATTCAGTTTGATATTGG + Intergenic
1125453968 15:39838718-39838740 TTGCCCATTCAGTTTGATACTGG - Intronic
1127011642 15:54636915-54636937 CAGCCTATAAAGTCTGAAAGAGG + Intergenic
1127030383 15:54855128-54855150 TTGCCCATTCAGTTTGATATTGG - Intergenic
1127095018 15:55503810-55503832 TTGCCCATTCAGTTTGATATTGG - Intronic
1127507972 15:59613212-59613234 CAGATCATTCAGCTTGAATGTGG + Intronic
1127629699 15:60815446-60815468 CAGCAAATTGAGATTGAAAGAGG - Intronic
1128751810 15:70155468-70155490 CAGACCATTCATTCTGAATGGGG + Intergenic
1129096821 15:73218032-73218054 TTGCCCATTCAGTATGATAGTGG + Intronic
1129343794 15:74903817-74903839 AAGCCCATTCCCTTTGACAGAGG - Intronic
1130754624 15:86749616-86749638 TTGCCCATTCAGTTTGATATTGG + Intronic
1131334774 15:91537945-91537967 CAGCCTTTTCAGTGTGCAAGGGG - Intergenic
1131764879 15:95664785-95664807 CAGCCCATTGAGATTTAAAATGG + Intergenic
1132420418 15:101661197-101661219 CAGCCCATTTAGGATGACAGTGG - Intronic
1132556887 16:576458-576480 CAGCCCCTTCAGAAGGAAAGGGG - Intronic
1133839087 16:9392676-9392698 CAGCCTTTTCAATATGAAAGTGG + Intergenic
1133956562 16:10448916-10448938 CTGCCCATTCAGTATGATATTGG + Intronic
1134767251 16:16771104-16771126 TTGCCCATTCAGTATGATAGTGG + Intergenic
1137295554 16:47089395-47089417 CATCCCCTTCATTTTAAAAGAGG - Intronic
1137870412 16:51944819-51944841 CAGCCCATCTAGTTTGAATCTGG - Intergenic
1138258714 16:55596680-55596702 CTGCCCATTCAGTATGATATTGG - Intergenic
1139257327 16:65555146-65555168 TTGCCCATTCAGTATGAAATTGG - Intergenic
1144007598 17:11115177-11115199 CGGCCCATTCAGCTTGGAGGAGG - Intergenic
1145842817 17:28010382-28010404 AAGACCACTCAGTTTGCAAGTGG + Intergenic
1146312946 17:31784422-31784444 TAGCCCATTCAGTATGATATTGG - Intergenic
1146766558 17:35527738-35527760 CTGCCCATTCAGTATGATACTGG - Intronic
1149404670 17:56335821-56335843 CTGCCCATTCAGTATGATATTGG + Intronic
1149504973 17:57186650-57186672 CACCCCACCCAGCTTGAAAGAGG - Intergenic
1151913714 17:77102226-77102248 CAGCCCATGCACTGTGTAAGTGG + Intronic
1155893066 18:31290025-31290047 TTGCCCATTCAGTTTGATATTGG + Intergenic
1156591846 18:38498833-38498855 CAGCCTCTTCATTTTGAATGAGG - Intergenic
1156937205 18:42724657-42724679 TTGCCCATTCAGTATGAAATTGG - Intergenic
1157944979 18:51969013-51969035 CTGCCCATTCAGTATGATATTGG + Intergenic
1158279068 18:55800909-55800931 CTGCCCATTCAGTATGACATTGG + Intergenic
1158471111 18:57737786-57737808 CAGCCCTTTGAGGTTGAGAGAGG + Intronic
1159523323 18:69554960-69554982 CAGACAATCCAGTTTTAAAGAGG - Intronic
1160103912 18:75951225-75951247 TATTCCATTCATTTTGAAAGTGG - Intergenic
1161354241 19:3810319-3810341 CAGCCCATCCTGGTAGAAAGGGG - Intronic
927334409 2:21905424-21905446 CTGCCCATTCAGTATGATATTGG + Intergenic
927883242 2:26703563-26703585 AAGCCAATTCAATTTGGAAGGGG - Intronic
928456569 2:31428099-31428121 CAGCCCAGTAACTCTGAAAGTGG + Intergenic
928765381 2:34639345-34639367 CTGCCCATTCAGTATGATATTGG - Intergenic
928850379 2:35738288-35738310 TTGCCCATTCAGTGTGATAGTGG - Intergenic
929232821 2:39577124-39577146 TTGCCCATTCAGTATGATAGTGG + Intergenic
929293599 2:40221417-40221439 TTGCCCATTCAGTATGATAGTGG - Intronic
929294787 2:40234705-40234727 TTGCCCATTCAGTATGATAGTGG + Intronic
930057659 2:47264481-47264503 CAGCCTATTCCCTTTGACAGAGG - Intergenic
931943456 2:67278725-67278747 GAGCCTATTCATTTTGAAGGAGG - Intergenic
933299412 2:80525358-80525380 CAGATCATTCAGATTGAAAGAGG - Intronic
933305800 2:80596814-80596836 TTGCCCATTCAGTTTGATATTGG + Intronic
933896312 2:86813618-86813640 TAGACCATTCACATTGAAAGTGG + Intergenic
935200918 2:100855896-100855918 CAGCCCACTCAGCTTGAATGGGG + Intronic
936256339 2:110917439-110917461 TTGCCCATTCAGTATGATAGTGG - Intronic
936596787 2:113855649-113855671 GAGTCCATTCAGTTGGCAAGAGG - Intergenic
936624827 2:114137329-114137351 TTGCCCATTCAGTATGAAATTGG + Intergenic
936881979 2:117264703-117264725 CAGTCCATTAAGATTGGAAGAGG - Intergenic
936929069 2:117768122-117768144 CTGCCCATTCAGTATGATATTGG + Intergenic
937031312 2:118743399-118743421 CAGCCCAGTCACTCTGAGAGAGG - Intergenic
937723619 2:125132860-125132882 TAGCCCATTCAGTATGATATTGG - Intergenic
937801926 2:126090606-126090628 GTGCACCTTCAGTTTGAAAGTGG - Intergenic
938990888 2:136628708-136628730 CAGCCTACTGAGTGTGAAAGAGG - Intergenic
940861947 2:158779907-158779929 AAGCCCATTTAGTTTCAAAGTGG - Intergenic
940934190 2:159472590-159472612 TAGCCCATTCAGTATGATATTGG + Intronic
945329361 2:208521657-208521679 CTGCCCATTCAGTATGATACTGG + Intronic
945343835 2:208688969-208688991 TTGCCCATTCAGTATGATAGTGG + Intronic
945628051 2:212236072-212236094 TTGCCCATTCAGTATGATAGTGG + Intronic
1169304849 20:4480656-4480678 CAGCACATGCAGTATGTAAGTGG - Intergenic
1170985581 20:21255150-21255172 CTGCCCATTCAGTATGATATTGG - Intergenic
1174929634 20:54798839-54798861 CAGCCCATTCAATATGATATTGG - Intergenic
1177233489 21:18354536-18354558 CAGCACATACATTTTCAAAGGGG + Intronic
1178927992 21:36791913-36791935 CAGCCCTTTCTTTGTGAAAGTGG - Intronic
1180377482 22:12107915-12107937 CTGCCCATTCAGTATGATATTGG + Intergenic
949842372 3:8333859-8333881 TTGCCCATTCAGTATGATAGTGG + Intergenic
950969948 3:17176385-17176407 CAGCCTTCCCAGTTTGAAAGGGG - Intronic
951178958 3:19636675-19636697 TTGCCCATTCAGTTTGATATTGG - Intergenic
951311273 3:21128913-21128935 CTGCCCATTCAGTATGATATTGG - Intergenic
951501804 3:23396624-23396646 GAGGCCATACAGATTGAAAGTGG - Intronic
951872384 3:27378614-27378636 AAGACCATTCAGTTTTACAGTGG - Intronic
953433775 3:42861898-42861920 CTGCCCATTCAGTATGATATTGG - Intronic
955548392 3:60056770-60056792 CAGCAAAAGCAGTTTGAAAGAGG + Intronic
957256240 3:77841503-77841525 TTGCCCATTCAGTTTGATATTGG + Intergenic
957851664 3:85815631-85815653 CTGCCCATTCAGTATGACATTGG - Intronic
959828632 3:110832958-110832980 TTGCCCATTCAGTTTGATATTGG + Intergenic
960866829 3:122210123-122210145 CTGCCCATTCAGTATGATATTGG - Intronic
962633137 3:137300055-137300077 CAGTCCATTCAGTTTGTGGGGGG + Intergenic
962666408 3:137658224-137658246 TAGCCCATTCAGTATGATATTGG - Intergenic
963310811 3:143708232-143708254 CAGCCCATTCAGTTTGAAAGGGG + Intronic
964238187 3:154559241-154559263 CTGCCTATTCAGTTTTATAGGGG - Intergenic
965097959 3:164258416-164258438 TTGCCCATTCAGTATGACAGTGG - Intergenic
967575148 3:191080952-191080974 CTGCCCATTCAGTATGATATTGG - Intergenic
970983342 4:22127194-22127216 TTGCCCATTCAGTATGAAATTGG - Intergenic
971321334 4:25608287-25608309 CAGGTCATTCACTTAGAAAGAGG + Intergenic
971475967 4:27072342-27072364 CTGCCCATTCAGTATGATATTGG + Intergenic
971586521 4:28411303-28411325 CTGCCCATTCAGTATGATATTGG - Intergenic
971694019 4:29874310-29874332 CTGCCCATTCAGTATGATATTGG + Intergenic
971706242 4:30047267-30047289 CTGCCCATTCAGTATGATATTGG - Intergenic
972130815 4:35831226-35831248 CTGCCCATTCAGTATGATATTGG + Intergenic
972685968 4:41353493-41353515 TTGCCCATTCAGTTTGATATTGG - Intergenic
972755937 4:42046120-42046142 CTGCCCATTCAGTATGATATTGG - Intronic
973326391 4:48866686-48866708 TAGCCCATTCAGTATGATATTGG + Intergenic
973689043 4:53406114-53406136 TTGCCCATTCAGTTTGATATTGG + Intronic
974342185 4:60628459-60628481 TAGCCCATTCAGTGTGATATTGG + Intergenic
974937362 4:68424212-68424234 TTGCCCATTCAGTGTGATAGTGG - Intergenic
975187704 4:71422873-71422895 CTGCCCATTCAGTATGATATTGG - Intronic
975617226 4:76258398-76258420 CAGACCATGCAGGTTGAGAGTGG + Intronic
976527500 4:86111332-86111354 TTGCCCATTCAGTATGATAGTGG + Intronic
977517077 4:98033987-98034009 TTGCCCATTCAGTTTGATATTGG - Intronic
977863627 4:101997035-101997057 TTGCCCATTCAGTATGAAAATGG + Intronic
978204956 4:106070246-106070268 TAGCCCATTCAGTATGATATTGG + Intronic
978858960 4:113426620-113426642 CTGCCCATTCAGTATGATATTGG + Intergenic
979007456 4:115318941-115318963 CAGGTCATTCAGCTTGCAAGAGG - Intergenic
979896645 4:126166019-126166041 TTGCCCATTCAGTATGAAATTGG + Intergenic
979976415 4:127201868-127201890 CTGCCCATTCAGTATGATATTGG - Intergenic
980205749 4:129717587-129717609 TTGCCCATTCAGTATGATAGTGG + Intergenic
981273434 4:142870399-142870421 CTGCCCATTCAGTATGATATTGG - Intergenic
981284998 4:143006035-143006057 CAGCCCATGAAGTCTGGAAGTGG + Intergenic
981299454 4:143170464-143170486 TTGCCCATTCAGTATGATAGTGG - Intergenic
981947632 4:150366945-150366967 CTTCCCATTCATTTTGAAAGGGG + Intronic
983182971 4:164670198-164670220 TTGCCCATTCAGTATGAAATTGG - Intergenic
983699481 4:170574246-170574268 TTGCCCATTCAGTATGAAATTGG - Intergenic
984244611 4:177260006-177260028 CTGCCCATTCAGTATGATATTGG + Intergenic
984340158 4:178446903-178446925 TTGCCCATTCAGTTTGATATTGG + Intergenic
984349731 4:178575583-178575605 CAGCCAATTGATTTTGAAATAGG + Intergenic
984380619 4:178987867-178987889 TTGCCCATTCAGTTTGATATTGG + Intergenic
984654272 4:182300354-182300376 CAGGCCATACAGTTGAAAAGGGG + Intronic
1202759090 4_GL000008v2_random:93374-93396 CTGCCCATTCAGTATGATATTGG + Intergenic
986095297 5:4548525-4548547 CAAGACATTCAGTTAGAAAGTGG - Intergenic
988118328 5:26925977-26925999 CTGCCCATTCAGTATGATATTGG - Intronic
990060477 5:51640645-51640667 CTGCCCATTCAGTATGATATTGG - Intergenic
990519360 5:56563645-56563667 CAGGCCATCCAGCTAGAAAGTGG + Intronic
992526147 5:77612679-77612701 TTGCCCATTCAGTTTGATATTGG - Intronic
994564665 5:101427152-101427174 TATCCCATCCAGTTTGAAAAGGG - Intergenic
994948547 5:106427489-106427511 CTGCCCATTCAGTATGATATTGG + Intergenic
995045354 5:107640667-107640689 CAGCCCTGTCAATTTGGAAGAGG + Intronic
995263270 5:110130501-110130523 CTGCCCATTCAGTATGATATTGG - Intergenic
996752777 5:126905921-126905943 CTGCCCATTCAGTATGATATTGG + Intronic
998901850 5:146863900-146863922 CAGCCAATATACTTTGAAAGTGG + Intronic
1001076748 5:168634907-168634929 TTGCCCATTCAGTATGATAGTGG - Intergenic
1003388165 6:5688306-5688328 TTGCCCATTCAGTATGAAATTGG + Intronic
1003742512 6:8958757-8958779 CAACCCTTTCAGTTTGAAAAAGG + Intergenic
1005154133 6:22784412-22784434 AAGCACATTCAGTTTTAAAGGGG - Intergenic
1006277310 6:33015706-33015728 CAGCCCTTCCTGTTTAAAAGAGG + Intergenic
1007511292 6:42376111-42376133 CAGCCCAATCAGTGTGAAGGGGG + Intronic
1008263093 6:49390777-49390799 CTGCCCATTCAGTATGATATTGG - Intergenic
1008474346 6:51920232-51920254 CTGCCCATTCAGTATGATATTGG + Intronic
1008823475 6:55662292-55662314 TTGCCCATTCAGTTTGATATTGG + Intergenic
1008969707 6:57352812-57352834 CAGTCCATTCAGTGTAGAAGGGG + Intronic
1009158673 6:60254645-60254667 CAGTCCATTCAGTGTAGAAGGGG + Intergenic
1011006307 6:82649368-82649390 TTGCCCATTCAGTATGATAGTGG - Intergenic
1011318346 6:86061897-86061919 TTGCCCATTCAGTATGAAATTGG + Intergenic
1011833529 6:91403032-91403054 CTGCCCATTCAGTATGATATTGG + Intergenic
1012312054 6:97737629-97737651 TTGCCCATTCAGTTTGATATTGG - Intergenic
1012490315 6:99776095-99776117 CTGCCCATTCAGTATGATATTGG + Intergenic
1012698541 6:102421436-102421458 TTGCCCATTCAGTATGACAGTGG - Intergenic
1014702606 6:124708944-124708966 CTGCCCATTCAGTATGATATTGG + Intronic
1014704537 6:124729594-124729616 CTGCCCATTCAGTATGATATTGG - Intronic
1014907467 6:127047280-127047302 TTGCCCATTCAGTATGATAGTGG - Intergenic
1015149990 6:130026357-130026379 CATATCATGCAGTTTGAAAGGGG + Intronic
1015782070 6:136878410-136878432 TTGCCCATTCAGTATGATAGTGG + Intronic
1016115366 6:140276480-140276502 AAGCTCATTCATTTTGACAGTGG + Intergenic
1017498033 6:154998468-154998490 CAGCCAATTCAGCTTGCAAATGG - Intronic
1018555603 6:165047287-165047309 CAGCCCATTCAGTATGATGCGGG - Intergenic
1019357783 7:589997-590019 CAGCAGATTCCGTCTGAAAGTGG - Intronic
1020609427 7:10376579-10376601 TTGCCCATTCAGTATGATAGTGG - Intergenic
1021766154 7:23951195-23951217 CTGCCCATTCAGTATGATATTGG - Intergenic
1021993291 7:26156704-26156726 AAGCCCTCTCAGTTTCAAAGTGG - Intronic
1022131661 7:27410331-27410353 CAGACCACCCAATTTGAAAGTGG + Intergenic
1022563032 7:31369582-31369604 CAGGCCTTTCGGTTTGAAGGTGG + Intergenic
1025639061 7:63350256-63350278 CAGCCCACTGACATTGAAAGGGG + Intergenic
1025643638 7:63397836-63397858 CAGCCCACTGACATTGAAAGGGG - Intergenic
1028200168 7:87952247-87952269 CTGCCCATTCAGTATGATATTGG + Intronic
1028211645 7:88081376-88081398 CTGCCCATTCAGTATGATATTGG - Intronic
1030462769 7:109861527-109861549 CTGCCCATTCAGTATGATATTGG - Intergenic
1031275287 7:119713149-119713171 AAAGCCATTCAGTTTTAAAGGGG - Intergenic
1031446923 7:121866117-121866139 CAGCACATTCAGTAGGAAGGCGG + Intergenic
1032661771 7:133991737-133991759 CAGCCAATTCATTTTGACAAAGG - Intronic
1033962586 7:146932472-146932494 CTGCCCATTCAGTATGATATTGG - Intronic
1035474307 7:159131006-159131028 CAGCGCATTCTGTCTGGAAGAGG - Intronic
1036221357 8:6923623-6923645 AAGTCCATTCAGGTAGAAAGTGG + Intergenic
1036938869 8:13032089-13032111 CCCCCCATGCAGTTTGAAGGTGG - Intergenic
1038677172 8:29633769-29633791 CAAGCCATTCAGCTTCAAAGGGG + Intergenic
1039141325 8:34391904-34391926 GACCTCATTCATTTTGAAAGGGG + Intergenic
1040277991 8:46023695-46023717 CAGCACATTAGGGTTGAAAGGGG - Intergenic
1040441964 8:47452747-47452769 CTGCCCATTCAGTATGATATTGG - Intronic
1040828423 8:51649288-51649310 CAGCCTTTTCACCTTGAAAGAGG + Intronic
1041418664 8:57642760-57642782 CGGCCCATTCAGTATGATACTGG + Intergenic
1041818158 8:61998197-61998219 TTGCCCATTCAGTTTGATATTGG - Intergenic
1042644932 8:70976332-70976354 TTGCCCATTCAGTATGATAGTGG + Intergenic
1043177998 8:77046150-77046172 TTGCCCATTCAGTTTGATATTGG - Intergenic
1045285812 8:100790447-100790469 CAGTCCTTTAAGTTTGCAAGTGG + Intergenic
1045839717 8:106565016-106565038 CTGCCCATTCAGTATGATATTGG - Intronic
1046031577 8:108788541-108788563 CAGTCCACTCTGGTTGAAAGAGG - Intergenic
1046047598 8:108982719-108982741 TAGCCCATTCAGTATGATATTGG + Intergenic
1047942810 8:129842375-129842397 CTGGCTATTCAGTTAGAAAGGGG - Intronic
1048616129 8:136077204-136077226 CAGGCTTTTCAGTTTGAAGGTGG + Intergenic
1048696778 8:137037070-137037092 TTGCCCATTCAGTATGATAGTGG + Intergenic
1048796738 8:138157332-138157354 TTGCCCATTCAGTATGATAGTGG - Intronic
1049485194 8:142853964-142853986 TTGCCCATTCAGTATGATAGTGG - Intronic
1050138667 9:2495041-2495063 AAGTCCATTCAGTTAGTAAGTGG - Intergenic
1050561960 9:6843264-6843286 CAGCCCATTCCACTTCAAAGAGG - Intronic
1050562339 9:6847166-6847188 AAGCTCATTCAGTTTAAAAATGG + Intronic
1050735871 9:8762614-8762636 CAGGCCATTAATTTTAAAAGAGG - Intronic
1051996728 9:23226103-23226125 CAGCCTATTCAGTATGATATTGG - Intergenic
1052078407 9:24173699-24173721 CTGCCCATTCAGTATGATATTGG + Intergenic
1052124729 9:24761170-24761192 CTGCCCATTCAGTATGATATTGG + Intergenic
1053341422 9:37337464-37337486 CTGCCCATGCAGTGAGAAAGGGG - Intronic
1053487914 9:38474417-38474439 CAGCCCATGCTGTCTGACAGTGG - Intergenic
1053704327 9:40734695-40734717 TTGCCCATTCAGTATGAAACTGG + Intergenic
1054414411 9:64858305-64858327 TTGCCCATTCAGTATGAAACTGG + Intergenic
1055251270 9:74309283-74309305 CAGGAAATTCAGTTTCAAAGAGG - Intergenic
1056320215 9:85428769-85428791 CAACCCATGCAGTTTGAGACTGG + Intergenic
1056891965 9:90502693-90502715 CAGTCCATTCAGCTGGAGAGAGG + Intergenic
1057120650 9:92570183-92570205 CTGCCCATTCAGTATGATATTGG + Intronic
1061889701 9:133611799-133611821 GAGCCCATTTTATTTGAAAGAGG + Intergenic
1203539872 Un_KI270743v1:78273-78295 CTGCCCATTCAGTATGATATTGG + Intergenic
1186301257 X:8202139-8202161 AAGCCCATTAACTTTGAATGTGG - Intergenic
1186526310 X:10251823-10251845 CTGCCCATTCAGTATGATATTGG + Intergenic
1186532012 X:10306424-10306446 CTGCCCATTCAGTATGATATTGG + Intergenic
1187212064 X:17241555-17241577 AAGCTCATTCAGTTGGTAAGTGG + Intergenic
1187645595 X:21343597-21343619 TTGCCCATTCAGTTTGATATTGG - Intergenic
1188609099 X:32073588-32073610 TAACCCATTCATTTTGCAAGTGG - Intronic
1188751090 X:33906410-33906432 GAGACCATTCAGTTTAATAGTGG - Intergenic
1189545007 X:42033645-42033667 CAGCTCACTTAGTTTGGAAGTGG + Intergenic
1191203246 X:57807138-57807160 CTGCCCATTCAGTATGATATTGG + Intergenic
1192287346 X:69752182-69752204 TTGCCCATTCAGTTTGATATTGG + Intronic
1192290084 X:69785398-69785420 TTGCCCATTCAGTTTGATATTGG + Intronic
1192993300 X:76485647-76485669 CTGCCCATTCAGTGTGATATTGG + Intergenic
1193038809 X:76982635-76982657 CTGCCCATTCAGTATGATATTGG - Intergenic
1193045581 X:77050126-77050148 CTGCCCATTCAGTATGATATTGG - Intergenic
1194170278 X:90572502-90572524 CTGCCCATTCAGTATGATATTGG - Intergenic
1194411235 X:93561110-93561132 CATCCAATCCAGTTTGGAAGTGG + Intergenic
1195432869 X:104808934-104808956 CAGCACATTAAGTCTGAAAAGGG + Intronic
1196075807 X:111574658-111574680 CTGCCCATTCAGTATGATATTGG + Intergenic
1196269433 X:113694028-113694050 TTGCCCATTCAGTATGATAGTGG + Intergenic
1196472890 X:116049012-116049034 CTGCCCATTCAGTATGATATTGG + Intergenic
1197076502 X:122359862-122359884 TAGCCCATTCAGTGTGATACTGG + Intergenic
1197319481 X:125009918-125009940 TTGCCCATTCAGTATGAAATTGG - Intergenic
1197847413 X:130817802-130817824 CTGCCCATTCAGTATGATATTGG - Intronic
1199612965 X:149633282-149633304 CAGCCCATACTGTTAGAAAGAGG + Intergenic
1199627619 X:149755308-149755330 CAGCCCATACTGTTAGAAAGAGG + Intergenic
1199863841 X:151825545-151825567 CATCCCATTCACCTGGAAAGAGG + Intergenic
1200516524 Y:4150268-4150290 CTGCCCATTCAGTATGATATTGG - Intergenic
1201795603 Y:17893577-17893599 CTGCCCATTCAGTATAACAGTGG - Intergenic
1201805953 Y:18012408-18012430 CTGCCCATTCAGTATAACAGTGG + Intergenic
1202084856 Y:21125630-21125652 CTGCCCATTCAGTTTGATATTGG + Intergenic