ID: 963312606

View in Genome Browser
Species Human (GRCh38)
Location 3:143725026-143725048
Sequence TAGGGGCCCAGGCAGTGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 440}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963312606 Original CRISPR TAGGGGCCCAGGCAGTGGGG GGG (reversed) Intronic
900181310 1:1312183-1312205 CAGGGCCCAAGGGAGTGGGGGGG + Intronic
900392808 1:2441064-2441086 CAGGTGCCCAGGAAGTGGAGGGG + Intronic
901055512 1:6447200-6447222 GAGGGGCGCACACAGTGGGGAGG - Intronic
901420878 1:9150359-9150381 GATGGGCCCAGGCAGGGAGGCGG + Intergenic
901480185 1:9519793-9519815 TGAGGGCCCAGGCAGAGGAGTGG + Intergenic
901878301 1:12179537-12179559 CAGGGGCCAAAGCTGTGGGGAGG - Intronic
901886575 1:12227837-12227859 GGGAGGCCAAGGCAGTGGGGGGG - Intergenic
902406648 1:16187786-16187808 TAGGGGCAGGGGCAGTGGGCTGG - Intergenic
903224030 1:21884983-21885005 TCTGGGCCCAGGTGGTGGGGTGG - Intronic
904034074 1:27549826-27549848 CAGTGGCCCAGGCTTTGGGGAGG - Exonic
904313142 1:29642196-29642218 CAGGTGCCCAGGCAGAGGAGAGG + Intergenic
904616377 1:31752413-31752435 TGGGGGCCCAGGCAGTGAGGAGG - Intronic
904822151 1:33252655-33252677 TAGGGTCCCAGGCTCTGGAGAGG - Intergenic
905344009 1:37299218-37299240 TAGGTGCCCAAGCTGTGTGGCGG - Intergenic
905803577 1:40861161-40861183 ACAGGGCCCAGGCAGCGGGGTGG + Exonic
906199028 1:43947491-43947513 TGGGTGCCCAGGGAGTGGTGGGG - Exonic
907284605 1:53371622-53371644 CTGGTGCCCAGGCTGTGGGGGGG - Intergenic
907337936 1:53712652-53712674 TAAGGTCACAGGCAGTGGGGTGG + Intronic
907372510 1:54012370-54012392 GAGGGGCTGGGGCAGTGGGGAGG + Intronic
907526620 1:55057523-55057545 CGGTGGCCGAGGCAGTGGGGTGG - Intronic
908179957 1:61593785-61593807 TCAGGGCCCAGGCTGTGGGAGGG - Intergenic
911409311 1:97482768-97482790 TAGGGGCAAAGGCAGAGGTGGGG - Intronic
912819335 1:112854595-112854617 TAGGAGCCCATGGAGTGGGTGGG + Intergenic
912935627 1:114001782-114001804 TGGGGGCCCAGGAAGGGTGGGGG + Intergenic
915065489 1:153221050-153221072 CAGTGGCCCAGGCAGTGGCTGGG - Intergenic
915477690 1:156162668-156162690 TTGGGGCTCAGGCCCTGGGGTGG - Intronic
915561410 1:156690312-156690334 AAGGGGCTCAGGGACTGGGGTGG - Intergenic
915690986 1:157690475-157690497 CCGGGGCCCAGGCTGTGGTGGGG - Exonic
917796094 1:178533887-178533909 TAAGTTCCCAGGCAGTGGGCTGG + Intronic
917962450 1:180155396-180155418 TGGGGGCCCAGGCCGCGGAGAGG - Intronic
919763414 1:201112158-201112180 TCAGGGCCCGGGCCGTGGGGGGG - Intronic
919991075 1:202709175-202709197 GAGGGGCCACTGCAGTGGGGAGG - Intronic
920270917 1:204763170-204763192 TTGAGGCACAGGCAGTGGTGGGG + Intergenic
920862710 1:209723710-209723732 GAGGGGGTCAGGGAGTGGGGAGG - Intronic
922616007 1:226961565-226961587 AAGGGGGCCTGGCAGTGGGAGGG + Intronic
1063366644 10:5494779-5494801 TAAGAGCTCAGGCAATGGGGTGG - Intergenic
1063430644 10:5985254-5985276 GATGGGGCCAGGCAGAGGGGAGG + Intergenic
1063430655 10:5985283-5985305 GACGGGGCCAGGCAGAGGGGAGG + Intergenic
1064034082 10:11901400-11901422 CAGGGGGGCATGCAGTGGGGAGG + Intergenic
1066660917 10:37737607-37737629 CAGGAGCCCATGCAGCGGGGAGG - Intergenic
1067031974 10:42884373-42884395 TATGGGCCATGGCAGTGGTGTGG + Intergenic
1067035356 10:42911598-42911620 GAGGGGCCCAGGCAGGAGGCTGG + Intergenic
1067290344 10:44935244-44935266 CAGGGGCCCAGCCAGTGTGGGGG - Exonic
1067837529 10:49650899-49650921 CAGGGGCCAAGGCAGTGAGCTGG + Intronic
1068166010 10:53333546-53333568 CAGGTGCAGAGGCAGTGGGGAGG - Intergenic
1068775501 10:60863999-60864021 TAAGTGCTCAGGCAGTGGAGGGG - Intergenic
1069548021 10:69342582-69342604 TAGGTGCCTTGGCAGTGGGGAGG + Intronic
1069562237 10:69439015-69439037 TAGGCACCCAGACACTGGGGTGG + Intergenic
1069574465 10:69516929-69516951 TGGGGGCCCAGACAGTGCAGGGG - Intergenic
1069635079 10:69920092-69920114 CAGAGGCCCTGGCAGTGGGAGGG - Intronic
1069905831 10:71731519-71731541 TTGGGGCGTAGGGAGTGGGGAGG + Intronic
1070128591 10:73641222-73641244 GAGGGGCCCAGGAGGTTGGGGGG - Intronic
1070764463 10:79048515-79048537 CTGGGGCCCTGGCACTGGGGTGG + Intergenic
1071055342 10:81503132-81503154 CAGGAGCCCAGGCGGCGGGGAGG - Intergenic
1071567818 10:86680723-86680745 GAAGGGCCTAGGCAGTGGTGAGG - Intronic
1072344357 10:94488822-94488844 TAGGGCACCAGGCAGTGGTGAGG - Intronic
1072878905 10:99204111-99204133 TAGGGGACCTGGCACTGGTGTGG - Intronic
1074073328 10:110096359-110096381 CTGGGGCCTAGGCAGTGGGGAGG - Intronic
1074079010 10:110152713-110152735 CAGGGGCCCAGGCAGAGAGCAGG - Intergenic
1074317494 10:112372705-112372727 TAGGGGCCAAGGCACTGCAGGGG + Intergenic
1075129664 10:119726630-119726652 TTGGGGCCCAGGCCGAGGGGAGG + Intronic
1075402513 10:122171331-122171353 TGGGGGCCGAGGTAGGGGGGTGG + Intronic
1075443634 10:122498882-122498904 CAGGGGACCAGGGACTGGGGAGG - Intronic
1076098405 10:127753315-127753337 TAGGAGGTGAGGCAGTGGGGTGG + Intergenic
1076213786 10:128675739-128675761 CAGGGCTCCAAGCAGTGGGGAGG - Intergenic
1076643367 10:131934218-131934240 CAGGGGCCCAGGCATGGGGGTGG + Intronic
1076856363 10:133117271-133117293 CTCGGGCCCAGGCAGTGGGCAGG - Intronic
1077026696 11:442794-442816 TGGGGGCCCAGGCCGTGGGCTGG + Intergenic
1077048938 11:558132-558154 CAGGGGCACAGGGAGTGGGCAGG - Intronic
1077228165 11:1447327-1447349 GGAGGGGCCAGGCAGTGGGGTGG - Intronic
1077308136 11:1876949-1876971 CAAGGGGCCAGGCGGTGGGGGGG - Intronic
1079118149 11:17653744-17653766 GAGGGGTGCTGGCAGTGGGGAGG - Intergenic
1080681203 11:34477805-34477827 TTGGTGCCCAGGGAGTGGGAGGG + Intergenic
1080701555 11:34648899-34648921 TAGGTGACCAGGCAGTAGGATGG + Intronic
1081115404 11:39193048-39193070 TGGGAGCCCAGGCAGAGGAGGGG + Intergenic
1081637036 11:44727773-44727795 TGGGGTCCCTGGCAGCGGGGCGG + Intronic
1081802416 11:45869263-45869285 CAGAGGGCCAGGCAGTGGGAAGG - Intronic
1082263164 11:50093046-50093068 TGGGGGCCAAGGCAGGTGGGGGG + Intergenic
1083412565 11:62504569-62504591 TCGGTGGCCAGGCGGTGGGGAGG - Intronic
1083478207 11:62927237-62927259 TAGGGGCCGCGGCAGGGGCGCGG - Intergenic
1084069980 11:66727945-66727967 TGGGGGCCAAGGCCGAGGGGGGG - Intronic
1084154452 11:67305723-67305745 GAGGGACCCAGGCAGAGGGGAGG + Intronic
1084372254 11:68751549-68751571 GAGGCGCCCGGGCAGTGGGCGGG + Exonic
1084401863 11:68948846-68948868 TGGGAGCCCAAGAAGTGGGGTGG - Intergenic
1084813609 11:71631678-71631700 CAGGAGCCCATGGAGTGGGGAGG + Intergenic
1084962969 11:72726877-72726899 CATGGGCACAGGCCGTGGGGTGG + Exonic
1085079306 11:73620953-73620975 AAGTGGCCCAGGCAGGGGCGTGG + Intergenic
1085284233 11:75349835-75349857 TGGAGGCCCAGGCTTTGGGGGGG - Intronic
1085524559 11:77156801-77156823 GGTGGGACCAGGCAGTGGGGCGG + Intronic
1086575238 11:88332077-88332099 TAGGGTTCCAGTCAGTGGAGAGG + Intronic
1086850075 11:91798713-91798735 AGGGGGCAGAGGCAGTGGGGAGG - Intergenic
1087354577 11:97076879-97076901 TAGGAGCCCATGGAGTGGGTGGG - Intergenic
1088433475 11:109783956-109783978 CAAGGGCCCAGGAGGTGGGGAGG - Intergenic
1088751333 11:112844623-112844645 TTGGGGGACAGGCTGTGGGGAGG - Intergenic
1089167825 11:116490766-116490788 TTTGAGCCCAGGCAGTTGGGCGG - Intergenic
1089454930 11:118620665-118620687 CAGGGGCCCAGGAAGTGGGCTGG + Intronic
1089497597 11:118915680-118915702 AAGGGGACCTGGCAGAGGGGAGG - Intronic
1090363495 11:126188731-126188753 TAGGGGCCCGGGCTGTGTGTTGG - Intergenic
1090652415 11:128819239-128819261 AGGGTGCCCATGCAGTGGGGTGG - Intergenic
1091372692 11:135073989-135074011 TGGGGGCCCAGGCTGGGAGGGGG - Intergenic
1091479844 12:816389-816411 TATAGTCCCAGGTAGTGGGGAGG - Intronic
1091550005 12:1530151-1530173 TAGGGGCCGAGGGAGCCGGGCGG + Intronic
1091792722 12:3280944-3280966 AAGGGGCCCAGCCCGAGGGGTGG + Intronic
1091948326 12:4569169-4569191 TAGTGGCACGGGTAGTGGGGTGG - Intronic
1092261098 12:6953739-6953761 TAGGACCCCAGGTAGCGGGGAGG - Intronic
1092263176 12:6963124-6963146 AAGGGGTTAAGGCAGTGGGGGGG + Intergenic
1094318294 12:29156087-29156109 TAGGGGTGCAGGGTGTGGGGAGG + Intronic
1094762268 12:33547722-33547744 TTGGGGCCCAGGCACAGGGCAGG - Intergenic
1095304174 12:40620891-40620913 CAGGAGCCCACGGAGTGGGGAGG - Intergenic
1096396017 12:51267470-51267492 TAGGGGGACACGGAGTGGGGGGG - Intronic
1096622821 12:52874921-52874943 CAGGGGCCCTGGCACTGTGGAGG - Intergenic
1097497808 12:60364229-60364251 TAGGGAGCCAGGCACTGGGGAGG + Intergenic
1097810524 12:64013874-64013896 TAAAGGCCAGGGCAGTGGGGAGG + Intronic
1098160501 12:67644666-67644688 TGGGGTGCCAGGCAGAGGGGTGG - Intergenic
1099452698 12:82826821-82826843 TAGGGCTCCAGGCATTGGGCTGG - Intronic
1102527096 12:113519981-113520003 AAGGGGCTCAGGCAGGGGTGGGG + Intergenic
1102594042 12:113978753-113978775 TGGGGACCCAGGCAGTGTGCTGG + Intergenic
1102787265 12:115614851-115614873 AAGGGGGACAGGCAGAGGGGAGG - Intergenic
1103060918 12:117857918-117857940 CAGGGACCCAGGGAGTGGGCGGG - Intronic
1103080508 12:118020165-118020187 TAGGGGCCTTGGCAGGGGTGGGG + Intronic
1103114975 12:118320171-118320193 TAAGGGCCTAGGCAGAGAGGGGG + Intronic
1104753003 12:131251806-131251828 TAGGGGCCCAAGCCCTGGGCGGG + Intergenic
1105580717 13:21693291-21693313 TTGGGGCCCAAGGAGTGGGGAGG + Intronic
1105844297 13:24281334-24281356 GATGGGCCCAGGCAGGGGAGTGG + Intronic
1106099616 13:26682870-26682892 TGGGGGGCCATGCATTGGGGAGG - Exonic
1107986396 13:45780227-45780249 AGGGGGCCCAGGAAGTGGGTGGG - Exonic
1108704674 13:52974425-52974447 CAGGGCCCCAGGCAGGGGGAAGG + Intergenic
1112567356 13:100562907-100562929 TGGGGGCCCAGGCAGGGGAACGG - Intronic
1113382027 13:109813085-109813107 GAGGGTCCCTGGGAGTGGGGTGG + Intergenic
1113422565 13:110181847-110181869 GCGGGGCCCAGACAGTGGGCAGG - Intronic
1113469419 13:110533922-110533944 AAGGGCCCCACGCAGTGGGCAGG + Intronic
1115797019 14:36949557-36949579 CATGGGGCCAGGCAGCGGGGAGG - Intronic
1116624048 14:47242722-47242744 CAGGGGCCCATGGAGTGGGTGGG - Intronic
1116782447 14:49251048-49251070 TGGCTGCCCAGGCAGTGGGCAGG - Intergenic
1117548608 14:56812234-56812256 TAGGGGCCCGGGCGGGGGGGAGG + Intergenic
1118014740 14:61648296-61648318 CAGGGGCTCAGGGAGAGGGGAGG + Intronic
1118195847 14:63625276-63625298 TAGGGGCTGAGGTTGTGGGGAGG + Intronic
1119472344 14:74907915-74907937 TCGGGGCCAAGGCAGCGGCGTGG + Intronic
1119485079 14:74981687-74981709 TAGGGGTCCAGGCTTTGGGCCGG - Intergenic
1122306757 14:100771314-100771336 CAGGGGCCCAGGCTGGGGGCTGG + Intergenic
1122425517 14:101603140-101603162 GAAGGGTCCAGGCAGTGGGAAGG + Intergenic
1122825485 14:104368545-104368567 CAGGTGCCCAGGCGGTGGGAGGG - Intergenic
1122826556 14:104373624-104373646 TGAGGGCCACGGCAGTGGGGTGG + Intergenic
1122924945 14:104895163-104895185 TAGGGGGCGAGGCAGGGGTGGGG - Exonic
1122984016 14:105203892-105203914 CAGGGGCCTGGGCAGTGGGGGGG + Intergenic
1202868063 14_GL000225v1_random:135845-135867 TAGGGGCCCTTCCAGTGAGGTGG + Intergenic
1123906392 15:24925698-24925720 TATGGTCCCAGCCACTGGGGAGG - Intronic
1128706126 15:69838489-69838511 GAGGGGTGCAGGCAGTGGGAGGG - Intergenic
1129069995 15:72942694-72942716 GAGGGGCACAGGCAGGGGGCAGG + Intergenic
1129222366 15:74138761-74138783 TTGTGTCCCAGGCAGTGGGGTGG - Intergenic
1129373979 15:75116078-75116100 CAGGAGCCCACGGAGTGGGGTGG + Intronic
1129883819 15:79025218-79025240 TATGGGCCCAGGTGGTGGGCAGG - Intronic
1130553782 15:84908874-84908896 TGGGGGCCCAGGTGGAGGGGAGG + Intronic
1130655979 15:85792484-85792506 TAGGGGCTCAGACAATGGGCTGG + Intronic
1131022669 15:89112485-89112507 TAGAGGACCAGGCTGTGGTGAGG - Intronic
1131255308 15:90858221-90858243 GAGAGGTCCAGGCAGAGGGGTGG + Intergenic
1131832102 15:96360649-96360671 TGGAGGCCCAGGCTGGGGGGAGG - Intergenic
1132157392 15:99505262-99505284 TAGGTGCCCTGGCACTGGGTAGG + Intergenic
1132607368 16:799222-799244 GACTGGCCCAGGCAGTGGTGTGG - Intronic
1132760869 16:1508087-1508109 GAGGGGCCCAGGGAGGCGGGTGG - Intronic
1132886310 16:2183741-2183763 TGAGGTCCTAGGCAGTGGGGAGG + Exonic
1133429768 16:5726392-5726414 TAGGGCCCCAGGGAGGGAGGAGG - Intergenic
1133776801 16:8902999-8903021 TAGGGGTGCAGGGAGTGGAGTGG + Intronic
1134441528 16:14302118-14302140 CAGCGGCCCAGGCGGCGGGGCGG - Intergenic
1135942758 16:26836547-26836569 TGGGAGCCCAGGCAGAGGAGGGG + Intergenic
1136902535 16:34053662-34053684 TAAGGGCCCAGGCCTTGGTGGGG - Intergenic
1137775788 16:51053362-51053384 TAGAGGCCCAGCCTGTGGGATGG + Intergenic
1138412447 16:56851072-56851094 GAGGGCCCCAGGCAAAGGGGAGG - Intergenic
1138510191 16:57504198-57504220 TGTGGGTCCTGGCAGTGGGGGGG - Intergenic
1138580929 16:57940041-57940063 TAGCGGCCCAGGCCGTGGGTGGG - Intronic
1138645356 16:58420649-58420671 TAGGGGTCCAGGCTCTGGGCTGG + Intergenic
1139585964 16:67903813-67903835 TAGTGCCCCAAGCAGTGGAGTGG - Intronic
1139590078 16:67928521-67928543 TGGGGGCCAAGGCAGAGGGAAGG + Exonic
1139953620 16:70683408-70683430 TAGGGGCCCCTGCAGAGGGCAGG - Intronic
1140478397 16:75250288-75250310 TCGGGGCCCAGGTACGGGGGTGG - Intronic
1141690764 16:85594972-85594994 CAGGGGAACAGGCAGAGGGGCGG + Intergenic
1141992128 16:87616595-87616617 TAGATTCCCAGGCAGTGGTGAGG + Intronic
1142174998 16:88641040-88641062 CAGGGGGCCAGGCAGGGGAGGGG - Intergenic
1142742997 17:1941591-1941613 TCGGGGGCCAGGCGGTGGGGGGG + Intronic
1143096571 17:4481407-4481429 CAGGGGCCCAGGGAGGGAGGAGG + Intronic
1143141619 17:4744600-4744622 GAGGGGCCCCAGGAGTGGGGTGG - Intronic
1143319865 17:6061276-6061298 TAGGGGATCTGGCACTGGGGTGG + Intronic
1143773477 17:9182801-9182823 GAGGGTCCCAGGAAGTTGGGAGG + Intronic
1143904310 17:10197609-10197631 CAGGGGAGCAGGCAGTGGCGGGG + Intronic
1143991619 17:10968409-10968431 TCAGGGCCCTGGCAGTGGGAGGG + Intergenic
1144434999 17:15232129-15232151 TAGGTGGCCGGGCGGTGGGGGGG - Intronic
1144573672 17:16416017-16416039 GAGGGTCCCAGGAGGTGGGGTGG + Intronic
1144578314 17:16443695-16443717 TGAGGGCCCAGGCAGTGGGGAGG - Exonic
1144692944 17:17280870-17280892 AAGGGGCCCAGGCCGGGGGGAGG + Intronic
1145317054 17:21741231-21741253 TAGGGGTCCAGGGTGGGGGGAGG + Intergenic
1145998795 17:29119273-29119295 CAGGAGCCCAGTCAGTGGGCTGG + Intronic
1146453256 17:32991168-32991190 TAGGTGCCCAGGCACAGTGGTGG - Intronic
1147376793 17:40027300-40027322 CGGGGGCGCAGGCAGTGAGGTGG + Intronic
1147590831 17:41682461-41682483 CAGGGGCCCAGGAAGCGTGGAGG - Intergenic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1148085847 17:44993425-44993447 TAAGGGTCCAGGCAGAGGGAAGG - Intergenic
1148339591 17:46865416-46865438 TGGGGGACGAGGCTGTGGGGTGG + Intronic
1148784216 17:50137590-50137612 TAGGGGCCCAGACAGTGTCCTGG - Intronic
1148953552 17:51335328-51335350 CAGGGGCCAAGGGAGTGAGGTGG + Intergenic
1148972918 17:51500072-51500094 GAGGGGCCCAGGGTGTGGGGTGG - Intergenic
1149208502 17:54277027-54277049 TGGGGGCGGAGGCGGTGGGGGGG + Intergenic
1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG + Intronic
1151653922 17:75486616-75486638 TGGGTGCCCAGGCAGAGGGCTGG + Intronic
1151743690 17:76000705-76000727 CAGGGGCCCAGGGGCTGGGGTGG + Intronic
1152095737 17:78270579-78270601 CTGGGGCTCAGGCGGTGGGGTGG - Intergenic
1152145193 17:78564188-78564210 TAGGGGATCCGGCAGTGGGGAGG - Intronic
1152283078 17:79396730-79396752 TCGGGCCCCAGGCTGTGGGCAGG + Intronic
1152737546 17:82004810-82004832 GCCGGGCCCAGGCAGTGAGGCGG + Intronic
1154231398 18:12559163-12559185 TAGGAGCCCACGGGGTGGGGTGG + Intronic
1154279713 18:12991549-12991571 TGGGGGCGCAGGCTGTGGGGCGG + Intronic
1155167120 18:23240414-23240436 CTGGGGCCGAGTCAGTGGGGAGG - Intronic
1155343775 18:24838654-24838676 TAGCAGGCCAGGCAGTGAGGAGG + Intergenic
1158743087 18:60165836-60165858 TAGGGGGCCAGTGAGTTGGGAGG - Intergenic
1160032190 18:75271728-75271750 GAGGGGACCAGGAAGCGGGGAGG - Intronic
1160140118 18:76313652-76313674 TGTGGTCCCAGGCACTGGGGAGG + Intergenic
1160340789 18:78087132-78087154 TGGGGGCCTGGGCAGTGTGGCGG + Intergenic
1160363246 18:78302390-78302412 GAGGGGCCCAGGTACTGGGATGG + Intergenic
1160376299 18:78415077-78415099 GAGGGGGCCAGCCAGTGGGCGGG + Intergenic
1160631049 18:80246859-80246881 TGGGGGCCCGGGCCGTGGGATGG - Intronic
1160665289 19:325316-325338 CAGCGGCCCAGGCTGTGGGGAGG + Intronic
1160786116 19:900841-900863 GAGGGGCCCTGGCCGTGGGGAGG - Exonic
1160788297 19:912043-912065 TCGGGGCCCGGGGAGTGGGGGGG + Intronic
1160838805 19:1137152-1137174 TAGGGGCACAGGCTGGGGAGAGG + Intronic
1160979355 19:1809822-1809844 GTGGGACCCAGGCACTGGGGAGG + Intronic
1161064357 19:2230321-2230343 AAGGGGCTCAGGCCGCGGGGAGG - Exonic
1161354281 19:3810444-3810466 GAGGGGCCCAGGCAGAGGGGCGG - Intronic
1161436940 19:4269081-4269103 AAGGGGCCCAGGCGGTTGGCAGG - Exonic
1161520005 19:4718578-4718600 TAAAGGCCCAGGCAGTGCTGGGG - Intronic
1161585153 19:5101867-5101889 TAGGAGCCCAGGCAGGAGGCTGG - Intronic
1161591003 19:5129036-5129058 TGGGGGCCAGGGCAGTGGCGGGG + Intronic
1161699143 19:5785437-5785459 TCGCGGCCCAGGTAGTAGGGCGG + Exonic
1161978966 19:7620773-7620795 AAGGGGTCCAGGCAGGTGGGAGG - Intronic
1161979405 19:7622734-7622756 AACAGGCCCAGGCTGTGGGGTGG - Intronic
1161982866 19:7638934-7638956 AAGGGGCCAAGGCAGTGGGAGGG - Intronic
1162059477 19:8086002-8086024 TGGGGGGACAGGCAGTGGGAGGG + Intronic
1162059516 19:8086114-8086136 GGGGGGAACAGGCAGTGGGGGGG + Intronic
1162063723 19:8111893-8111915 TGGGGGGCAAGGCAGTGGGAGGG - Intronic
1162088001 19:8260055-8260077 AAGGGGCCCAGGGAGGAGGGAGG + Intronic
1162159173 19:8698763-8698785 TTGAGGCCCGGCCAGTGGGGAGG + Exonic
1162411564 19:10509253-10509275 TATGGTCCCAGACACTGGGGAGG - Intergenic
1162806735 19:13141015-13141037 TGGGGGCCCAGGGAGGGGTGGGG - Exonic
1163369422 19:16893677-16893699 TGGGGGCCCTGGGAGTGGGCTGG + Intronic
1164574169 19:29396101-29396123 CAGGGGCACAGGGGGTGGGGAGG - Intergenic
1164630327 19:29757786-29757808 AGGGGGCCCAGGCTGTGCGGGGG - Intergenic
1165313374 19:35041299-35041321 TTGGGGCCCAGGAATTGGGCAGG + Intronic
1165319255 19:35075632-35075654 TAGGGGCCCGGGATGTGGTGTGG + Intergenic
1166117827 19:40666867-40666889 TGGGGGCCCAGGAGGCGGGGAGG - Exonic
1166137497 19:40786310-40786332 TGGGGACCCAGGCAGAGGGTTGG + Intronic
1166343273 19:42151050-42151072 CAGGGGGCCAGGTAGGGGGGAGG - Intronic
1166524891 19:43504670-43504692 AGGGGGCCGAGGCTGTGGGGAGG - Exonic
1166855664 19:45781680-45781702 CAGGTGCCCAGGCACTGGGAGGG - Intronic
1167002131 19:46751939-46751961 TGGGGGCCGGCGCAGTGGGGTGG + Intronic
1167096543 19:47377630-47377652 GAGTGTTCCAGGCAGTGGGGTGG + Intronic
1167538233 19:50069027-50069049 TAGGGGTGCAGGCAGGGGAGTGG - Intergenic
1167631745 19:50629966-50629988 TGGGGGCCCAGGCTCTGGAGAGG - Exonic
1167643830 19:50695396-50695418 GAGGGGGCCGGGCAGGGGGGAGG + Intronic
1167661734 19:50799428-50799450 GAGGGGCCCTGGCTCTGGGGAGG - Intronic
1167749484 19:51371230-51371252 CAGGGGCTCAGTCTGTGGGGTGG - Intergenic
1167959576 19:53095170-53095192 GCGGGGCCTGGGCAGTGGGGAGG - Intronic
1168151735 19:54452754-54452776 TGAGTGCCCAGCCAGTGGGGCGG + Intronic
925263538 2:2548128-2548150 TGGGGGCCCTGGCAGTGGGCAGG - Intergenic
925601081 2:5609344-5609366 GAGGGGCTCAGGCAGTGGCCGGG - Intergenic
927198613 2:20564994-20565016 TGGGGGCTCAGGAAGTGGAGAGG + Intronic
927679412 2:25130119-25130141 CTGGGGCCAAGGCAGTGGGTGGG - Intronic
927846106 2:26473649-26473671 TAGGGAACCGGGCAGTGGGATGG + Intronic
927847564 2:26479416-26479438 TGGGGGCCCAGGGAGGTGGGAGG + Intronic
928872158 2:35992632-35992654 TAAGGGCCAAAGAAGTGGGGTGG + Intergenic
931396682 2:61893873-61893895 TAGGGGTCCAGGATGTGGTGGGG + Intronic
931974631 2:67629705-67629727 TAGGTGCCCAGGAAGAGGAGGGG + Intergenic
933942908 2:87259995-87260017 TAGGGGCACAGGCAAGGGAGCGG + Intergenic
934574879 2:95393641-95393663 CTGGAGCTCAGGCAGTGGGGAGG + Intergenic
936337306 2:111601567-111601589 TAGGGGCACAGGCAAGGGAGCGG - Intergenic
938064472 2:128273587-128273609 AAGGGGACAAGGCAGAGGGGAGG - Intronic
938115724 2:128601977-128601999 TAGGGGGCAAGGGAGTGTGGAGG + Intergenic
938185099 2:129224625-129224647 TCAGGGCCCTGGCTGTGGGGAGG + Intergenic
942448917 2:176097338-176097360 AAGTGGCCCAGGCACTGGGAGGG + Intergenic
944435477 2:199684561-199684583 TATGGACTCAGGCAATGGGGTGG + Intergenic
947523444 2:230865156-230865178 CTGGGGCTCAGGCGGTGGGGCGG + Intronic
947752814 2:232541571-232541593 GAGGGGCCTGGGCAGTGGTGGGG + Intronic
948004446 2:234595730-234595752 TAGGGGGCCAGGGAGTTGGGGGG + Intergenic
948257033 2:236576091-236576113 TAGAGACGCAGGCAGTGGGCAGG + Intronic
949060506 2:241953816-241953838 GAGGTGCCCAGGCTGTGGGGAGG + Intergenic
949060518 2:241953844-241953866 GAGGTGCCCAGGCCGGGGGGAGG + Intergenic
1168769897 20:408277-408299 TGGCGGCCCCGGAAGTGGGGCGG - Exonic
1168836052 20:878132-878154 TCGGGGCCCAGGCCGTTGTGGGG - Intronic
1169067385 20:2701715-2701737 AAGGCTCTCAGGCAGTGGGGAGG - Intronic
1169217044 20:3800111-3800133 AGGGGGCCCAGGTATTGGGGAGG - Intronic
1169275301 20:4229778-4229800 CAGGGGCACAAGCAGTGAGGGGG - Intronic
1171035448 20:21709447-21709469 GAGGAGCGCAGGGAGTGGGGCGG + Intronic
1171395303 20:24829252-24829274 GAGGGGCACACGCTGTGGGGTGG + Intergenic
1171812130 20:29753429-29753451 TAGGGCCCCAGCCAGGGCGGAGG + Intergenic
1172287781 20:33753280-33753302 GGGGGGCCCAGGCTCTGGGGTGG - Exonic
1172766246 20:37352578-37352600 GAGGGGCCCATTCAGTGAGGCGG - Intronic
1173581449 20:44149570-44149592 CAGGGTCACAGGCAGTGGGATGG - Intronic
1173644092 20:44622804-44622826 AAGCGGGCCAGGGAGTGGGGAGG - Intronic
1174110241 20:48193717-48193739 TGGGGGCCCAGGGCATGGGGAGG - Intergenic
1174354101 20:49987092-49987114 AAGGGGCCCAGGCCCTGGGCTGG + Intronic
1174574565 20:51527284-51527306 AAGGGGGCCTGGCAGTGGGTAGG - Intronic
1175619441 20:60431054-60431076 TAGAAGGCCATGCAGTGGGGAGG + Intergenic
1175764349 20:61582391-61582413 CAGGGCCCCAGGCAGGGGGATGG - Intronic
1175888702 20:62306572-62306594 CAGAGGCGCAGGCAGTGCGGTGG + Intronic
1176376711 21:6090378-6090400 GAGGGGCCGAGGCCGTGGGAGGG + Intergenic
1177715255 21:24832125-24832147 GAGTGGCCCAGCTAGTGGGGAGG + Intergenic
1178093159 21:29185721-29185743 AAGTGGCTGAGGCAGTGGGGTGG + Intergenic
1178405426 21:32319327-32319349 TGGGGGACAAGGCAGTGGAGTGG - Exonic
1179434347 21:41350042-41350064 TGTGGGTCCAGGCAGTGGTGGGG - Intronic
1179746764 21:43447866-43447888 GAGGGGCCGAGGCCGTGGGAGGG - Intergenic
1179793771 21:43770567-43770589 CAGGCGCCCAGGCTGTAGGGCGG + Intergenic
1180259930 21:46662060-46662082 TGGGGGCGCGGGCAGTGGGGTGG + Intronic
1181038822 22:20182381-20182403 TAGGGCCCCAGGGGGTGGGACGG + Intergenic
1181052499 22:20244473-20244495 GAGGCCCCCAGGCTGTGGGGAGG - Intronic
1181164117 22:20974310-20974332 TCGGGGCTCAGGCAGAAGGGAGG + Intronic
1181299092 22:21867086-21867108 AAGGGGCTCAGGGAGTGGCGCGG - Intronic
1181513290 22:23398352-23398374 TAGGGACCCAGGGACTTGGGAGG - Intergenic
1183412902 22:37665902-37665924 TACGGGATCAGGGAGTGGGGAGG - Exonic
1183485432 22:38085650-38085672 TGGGGGCCCAAACAGTGAGGAGG - Intronic
1183520602 22:38294314-38294336 CAGGGACTCAGGCAGTGGGCTGG - Intronic
1183705508 22:39472914-39472936 GAGGGGCCCAGGCAGGGGTCGGG + Intronic
1183945623 22:41324233-41324255 CTGGGGCCCAGACAGTGGGGAGG + Intronic
1184008948 22:41732242-41732264 TAGGGATCGAGGCAGTGGTGAGG + Exonic
1184173124 22:42771148-42771170 TGAGGGCTCAGGCAGTGGTGCGG - Intergenic
1184732172 22:46377020-46377042 CTGCGGCCCAGACAGTGGGGAGG + Intronic
1184864080 22:47192849-47192871 GAGGAGCCCAGGCAGAGGTGGGG - Intergenic
1184898694 22:47429683-47429705 GAGGGGTCCAGGCAGAGGGAGGG + Intergenic
1184959222 22:47917095-47917117 TGGGTGCTCAGGCTGTGGGGGGG - Intergenic
949881358 3:8663546-8663568 TGGGGGCCACAGCAGTGGGGCGG + Intronic
950864476 3:16178387-16178409 GAAGGTCCCAGGCAGTCGGGAGG + Intronic
951541149 3:23783263-23783285 CAGGGGAGCAGGCACTGGGGTGG + Intergenic
952666046 3:35905533-35905555 TAGGGGCCCATTCAGTTGGTTGG + Intergenic
953930225 3:47002300-47002322 TTGGGGCCCAGGAAGAGGAGTGG + Intronic
953930507 3:47003551-47003573 AGGGGGCCCAGGGAGTGGGCAGG + Intronic
954712020 3:52509898-52509920 CAACCGCCCAGGCAGTGGGGGGG + Exonic
954715981 3:52527221-52527243 TAGGGCCCCAGGCTGTGCAGAGG - Intronic
955144624 3:56303831-56303853 AAGGGGGACAGGCAGTGGGTGGG + Intronic
956136729 3:66106897-66106919 CAGCGGCCCAGACAGTGGAGGGG + Intergenic
956771069 3:72526327-72526349 GAAGGGCCCAGGCAGAAGGGAGG + Intergenic
957025621 3:75178388-75178410 TCTTGGCTCAGGCAGTGGGGAGG - Intergenic
958513571 3:95081710-95081732 TAGGGGGCCAGGGAGAGAGGAGG - Intergenic
960339191 3:116454959-116454981 GAGTGCCCCAGGCAGTGGGAGGG - Intronic
962127688 3:132639380-132639402 TAGGGGAACAGGGAGTGGGTTGG + Intronic
962937555 3:140094745-140094767 TGGGGGCACAGACACTGGGGAGG - Intronic
963312606 3:143725026-143725048 TAGGGGCCCAGGCAGTGGGGGGG - Intronic
964381125 3:156099703-156099725 CAGGAGCCCACGGAGTGGGGGGG - Intronic
965531028 3:169769642-169769664 TGGGGGCGCAGGCAGGGGGTCGG + Exonic
965753194 3:171998952-171998974 CAGGAGCCCATGGAGTGGGGGGG + Intergenic
966657092 3:182371525-182371547 TAAGGTCCACGGCAGTGGGGTGG + Intergenic
966942841 3:184757793-184757815 CAGGAGCCCAGGGAGTGGGAGGG + Intergenic
968449280 4:667552-667574 CAGGGTGCCAGGCAGAGGGGTGG - Intronic
968471800 4:785983-786005 GAGGGGGCCAGGCCGGGGGGCGG + Exonic
968758364 4:2428247-2428269 GGTGGGCCCAGGCAGTGGGGTGG - Intronic
968957484 4:3726713-3726735 TAGGGCTCAGGGCAGTGGGGCGG - Intergenic
969058155 4:4414814-4414836 CAGAGCCCCAGGCAGTGGGGAGG + Intronic
969123856 4:4931386-4931408 GAGGTGCACAGGCAGTGAGGGGG + Intergenic
969307304 4:6333210-6333232 CAGGCTCCCAGGGAGTGGGGAGG + Intronic
969847513 4:9930883-9930905 AAGGGACCCAGGCACTGGAGAGG + Intronic
970015253 4:11505783-11505805 CAGAGGCCCCTGCAGTGGGGAGG + Intergenic
971177417 4:24293417-24293439 GAGGAGCACAGGCAGTGGTGAGG - Intergenic
972607423 4:40626690-40626712 TATGGGGAGAGGCAGTGGGGAGG - Intronic
972763745 4:42132291-42132313 TGGGGGCCAAGGGAGTGGTGTGG - Intronic
973730752 4:53820202-53820224 TATGGGCCCAGCTACTGGGGAGG - Intronic
973739184 4:53902570-53902592 TATGTGCCCAGGCAGTGTGGTGG - Intronic
974994162 4:69131935-69131957 TAGGGCAGCAGGGAGTGGGGTGG - Intronic
975562969 4:75724734-75724756 TTGGGGCCCAGGCCCTGCGGAGG + Exonic
976002481 4:80388130-80388152 GGGGGGCCCAGGCTGTGGGGTGG + Intronic
976199126 4:82561870-82561892 GACGGGCCCAGGCAGGGGAGGGG + Intronic
976642585 4:87354520-87354542 TATGGTCCCAGGGACTGGGGAGG + Intronic
977571184 4:98631512-98631534 TGGAGGCCCAGGCAGTCTGGAGG - Intronic
979106073 4:116688130-116688152 TAGTGACACAGCCAGTGGGGAGG - Intergenic
979773962 4:124563859-124563881 TAGGGGGCCAGGGAGTAGGGAGG - Intergenic
983252581 4:165361520-165361542 TAGTGGCCAAGGCAGTGGTGAGG + Intronic
986547661 5:8916519-8916541 TAGGATCCCAGGCATTGTGGAGG + Intergenic
986547679 5:8916809-8916831 TAGGGTCCCAGGCATTGCAGAGG + Intergenic
987146327 5:14994297-14994319 TGGGAGCCCAGGCAGAGGAGGGG + Intergenic
989421054 5:41240452-41240474 TATGGGCCATGGCAGTAGGGTGG + Intronic
990768124 5:59210429-59210451 TAGAGGCCCAAGAAGTGGTGAGG + Intronic
997372260 5:133369610-133369632 TAGGTGCCTGGGCAGTGGGAGGG - Intronic
997413504 5:133707885-133707907 TTGAGGCCCGGGCACTGGGGAGG + Intergenic
997890729 5:137673861-137673883 GAGGGGCCCAGGCAGGGCTGGGG + Intronic
998461821 5:142315148-142315170 TAGGGGCCCTGGGGGTGGGGTGG + Exonic
1000742482 5:164987050-164987072 TAGGGGCACAGGAAGGGGTGTGG - Intergenic
1001000248 5:167999275-167999297 TCTGGGCCCAGGGAGTTGGGTGG - Intronic
1001035238 5:168292301-168292323 TGGGGGCCCAGGCGGGGGTGTGG - Intronic
1001403223 5:171458687-171458709 TGGGGGCAGAGGCAGTGGGGAGG + Intergenic
1001521250 5:172395120-172395142 GAGGTGTCCAGGCAGAGGGGAGG - Intronic
1002180169 5:177427079-177427101 TCGGGGCCCAGGAAGGGGCGGGG + Intronic
1002985979 6:2191070-2191092 CAGGGACCCAGCCAGTGGTGCGG + Intronic
1003125061 6:3349315-3349337 TAGGTCCCCAGGAAGTGGGGAGG - Intronic
1003479643 6:6519275-6519297 TGGGGGACCAGGCATTGGGTAGG - Intergenic
1003877420 6:10450889-10450911 TAGGGACCCAGGTCCTGGGGAGG - Intergenic
1005812828 6:29529808-29529830 TGGGGGCCCATGCCATGGGGAGG + Intergenic
1006191877 6:32214310-32214332 TAGGGGTCCAGGCAGCAGGGAGG - Intronic
1006682124 6:35805052-35805074 TAGGGAGCCAGGCAGGGGCGGGG + Intergenic
1007076256 6:39068493-39068515 TCAGGGCCCAGGCAGAGTGGAGG - Intronic
1007472269 6:42098707-42098729 AGGGGGCCCAAGCAGTGAGGCGG + Intergenic
1008167860 6:48162602-48162624 AAGGGGACCAGGCATTGAGGAGG + Intergenic
1009779425 6:68250763-68250785 TGGGGACTCAGGCAGAGGGGTGG - Intergenic
1011127122 6:84019556-84019578 GAGGGGGCGAGGCGGTGGGGAGG + Intergenic
1011329324 6:86186423-86186445 TGAGGGTGCAGGCAGTGGGGAGG - Intergenic
1011827579 6:91328443-91328465 AATGGGCCCCGGCAGTGGGTGGG + Intergenic
1012760465 6:103294484-103294506 TAGGAGCCCACGGAGTGGGTGGG + Intergenic
1013913735 6:115310051-115310073 TAGAGGATCAGGCAGTGGGCAGG + Intergenic
1014227214 6:118862027-118862049 AAGGAGCCAAGGCAGTGGGGTGG + Intronic
1014233880 6:118934559-118934581 GAGGGGCGGAGGGAGTGGGGCGG - Intronic
1017166303 6:151411357-151411379 TAGGGTGCCAGGGACTGGGGTGG + Intronic
1019216807 6:170449062-170449084 TATGGGCCCAGGGAGGTGGGGGG - Intergenic
1019329646 7:456067-456089 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019329810 7:456495-456517 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019330087 7:457195-457217 TGGGGGTCCTGGCATTGGGGTGG - Intergenic
1019330185 7:457425-457447 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019330240 7:457555-457577 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019330257 7:457597-457619 TAGGGGTCCCGGCGTTGGGGTGG - Intergenic
1019330300 7:457698-457720 TGGGGGTCCCGGCATTGGGGTGG - Intergenic
1019491375 7:1315044-1315066 TGGGGGCAGAGGCAGAGGGGAGG + Intergenic
1020479947 7:8646956-8646978 CAGGGGAACAGGCACTGGGGAGG + Intronic
1022249709 7:28595035-28595057 TGGGGGCTCAGGGAGTGGGAGGG - Intronic
1022788527 7:33663490-33663512 TAGGGGCTCAGGCTTTGGGTTGG + Intergenic
1023127973 7:36974018-36974040 CAGGAGCCCACGGAGTGGGGGGG - Intronic
1023622388 7:42086817-42086839 CAGAGGGCAAGGCAGTGGGGAGG - Intronic
1023845543 7:44118053-44118075 TCGTGTCCCAGGCAGTGGAGTGG - Exonic
1023856651 7:44188317-44188339 TGGGGGCCCAGGCAGAGTGGGGG - Intronic
1023869507 7:44255506-44255528 TAGGGTCACAGGAAGTGGTGTGG - Intronic
1024673780 7:51620092-51620114 TGGGGGAGCAGGAAGTGGGGCGG - Intergenic
1024770376 7:52714805-52714827 TAGGAGCTCAGGAAGTGGGGAGG + Intergenic
1025840770 7:65143718-65143740 TAAGGGCCCAGGCCTTGGTGCGG - Intergenic
1026463674 7:70635608-70635630 TAGGTGGCCTGGCAGTGGGAAGG + Intronic
1027744564 7:82057266-82057288 TAGGGGCAAAGCCAGGGGGGTGG - Intronic
1028520183 7:91721247-91721269 TAGTGGGCCAGGCAGGTGGGTGG - Intronic
1029446069 7:100613367-100613389 TAGGGGCACAGGCAGAGGATAGG - Intronic
1029956176 7:104642690-104642712 TGGGGGCCCAGGCTATGGGAAGG - Intronic
1030215697 7:107042442-107042464 CAGGAGCCCACGGAGTGGGGGGG + Intergenic
1032841938 7:135721355-135721377 CAGGGACCCAGGCAGGGGGTGGG + Intronic
1034166300 7:149027939-149027961 AACGCGCCCAGGCAGTGGGAAGG - Intronic
1034457268 7:151177589-151177611 GAGGGGGCCAGGGAGTGGGGTGG + Intronic
1035306479 7:157936380-157936402 GAGGGACACAGGCAGAGGGGAGG - Intronic
1035728039 8:1836606-1836628 TGGGGGAGCAGGCTGTGGGGGGG + Intronic
1035913369 8:3593510-3593532 TAAGGGCCCGGGCTGTGGAGAGG - Intronic
1036378193 8:8218762-8218784 TGGGAGCCCAGGCAGAGGAGGGG - Intergenic
1036921044 8:12855677-12855699 GAAAGGCCAAGGCAGTGGGGGGG - Intergenic
1038543127 8:28405350-28405372 CATGGGTCCAGGCAGTGGAGTGG + Intronic
1038718038 8:30009371-30009393 TAGGGTGGCAGGCTGTGGGGTGG - Intergenic
1039416780 8:37401957-37401979 ACAGAGCCCAGGCAGTGGGGAGG - Intergenic
1041257590 8:55992498-55992520 AAGGAGCCCAGGCAGGGAGGAGG - Intronic
1041552625 8:59118899-59118921 TAGGGGTCCAGGCAGGGAGAAGG + Exonic
1041660427 8:60396165-60396187 TAGGAGTGCAGGCAGTGGGCTGG + Intergenic
1041905037 8:63023288-63023310 TTGGGGCTAAGGGAGTGGGGTGG - Intronic
1045222619 8:100213443-100213465 GAGGGGCCCAGGAAGCGGCGGGG - Intronic
1047022083 8:120785698-120785720 TGGGGTCTCAGGCAGTGGGCGGG - Intronic
1048061076 8:130919798-130919820 TAAGGGCACAGGAAGTGGGCTGG - Intronic
1048590346 8:135815509-135815531 TGGAGGCCCAGGCTGTGGGGTGG - Intergenic
1049016593 8:139924437-139924459 CATGGGCCCAGGGAGTTGGGGGG - Intronic
1049217896 8:141416058-141416080 GAGGGCCCCAGGCAAGGGGGTGG + Intronic
1049288587 8:141789959-141789981 CAGGGGCCCAGCCAGCGGGGCGG - Intergenic
1049414346 8:142488510-142488532 GAGGGGCCCAGGGAGTGGAGGGG + Intronic
1049453656 8:142676135-142676157 TTGGGCCCATGGCAGTGGGGTGG + Intronic
1051669204 9:19493518-19493540 CAGGTGGCCAGGCTGTGGGGTGG - Intergenic
1052840864 9:33289880-33289902 TGGGGGCCCAGGGAGGGGTGGGG - Intergenic
1053267355 9:36724912-36724934 TAGGGGCCCAAGAGCTGGGGTGG + Intergenic
1053519678 9:38764899-38764921 TAGGGGCAAGGGCAGTGAGGTGG - Intergenic
1054871858 9:70054445-70054467 TGGGGCCCCATGCAGTAGGGTGG + Intronic
1055029816 9:71762379-71762401 TAGAGGCCGAGGCAGTTGGATGG + Intronic
1055603781 9:77947319-77947341 CAGGGGCACAGGCTGTGGGGAGG + Intronic
1058235762 9:102487430-102487452 TAGGAGCCCAGGCAGAGGAGGGG + Intergenic
1058618427 9:106860466-106860488 TAGGGAACCAGGCGGTGGGGAGG - Intergenic
1058709646 9:107668086-107668108 TAAGGGCTGAGGCAGAGGGGTGG + Intergenic
1060042344 9:120310270-120310292 TGGGGTCCTAGGGAGTGGGGAGG - Intergenic
1060518083 9:124278402-124278424 TAGTGTCCCAGGCATTGAGGAGG + Intronic
1060923231 9:127437341-127437363 GAGATGCCCAGGCAGCGGGGGGG - Intronic
1060932240 9:127496426-127496448 CAGGGGCTCAGGCAGTGCTGTGG - Intronic
1061503942 9:131020108-131020130 CAGTGGCCTAGGGAGTGGGGCGG + Intronic
1061620136 9:131806639-131806661 AAGGGGAAAAGGCAGTGGGGTGG + Intergenic
1061638215 9:131929045-131929067 TAGGGCACCAGGCAGTCGTGAGG + Intronic
1061764528 9:132873411-132873433 CAGGGTCCCTGACAGTGGGGAGG + Intronic
1061905266 9:133693459-133693481 CAGGGGCACAGTCAGCGGGGAGG - Intronic
1061961941 9:133992913-133992935 TAGCGGGGCAGGAAGTGGGGGGG - Intergenic
1062019015 9:134307467-134307489 AAGGGGCACAGGCAGTGGAGAGG + Intergenic
1062056722 9:134472733-134472755 GAGGGGCCCTGGGAGTGGGGTGG - Intergenic
1062147245 9:134996502-134996524 GAGGGGCCCAGGCAGTCAGTGGG + Intergenic
1062189366 9:135239794-135239816 AAGGGGCCCAGGCATTGAGGGGG - Intergenic
1062249987 9:135589056-135589078 CAGGGGCCCAGGCAGGGCCGTGG - Intergenic
1062263401 9:135675059-135675081 TCGGGGCCCCGGGAGTGAGGTGG - Intergenic
1062378281 9:136274799-136274821 TCTGGGCACAGGCAGTGGGGTGG - Intergenic
1062448737 9:136606729-136606751 GGGAGGCCCAGGCAGTGGGAAGG + Intergenic
1062707162 9:137952144-137952166 GTAGGGTCCAGGCAGTGGGGAGG - Intronic
1185567736 X:1108603-1108625 TTGGGGCCCAGGGAGGGGGAAGG + Intergenic
1185744771 X:2563922-2563944 TGGGGGCCCAAGCATTGGTGGGG - Intergenic
1185776005 X:2803546-2803568 TAGGGGCTTGGGAAGTGGGGAGG + Intronic
1185786821 X:2897975-2897997 GAGGGGGCCAGCCAGAGGGGTGG - Intergenic
1186321072 X:8426178-8426200 TTGGGACCCAGGCAGTGGAGGGG + Intergenic
1187041357 X:15599403-15599425 TAGGGACCCTGGCAGCAGGGGGG + Intronic
1188371025 X:29369586-29369608 GAGGAGACCAGGCAGTGTGGGGG + Intronic
1189279861 X:39813459-39813481 TAGGGGCTCAGGGAGTGGCTAGG - Intergenic
1192153106 X:68724165-68724187 TAGGGGCAGAGGCAGGGGAGGGG - Intronic
1192220070 X:69191844-69191866 TACAGGCCTAGGCAGTGGGCAGG - Intergenic
1192556305 X:72092339-72092361 GAGGAGCACAGGCAGTGAGGTGG - Intergenic
1195129091 X:101837334-101837356 AAGGAGCCCAGCCAGTGGGAGGG + Intronic
1197210186 X:123821851-123821873 TAGTGGCCCACGTAGTGGTGTGG + Intergenic
1199629834 X:149769864-149769886 GGGGGGACCAGGGAGTGGGGGGG + Intergenic
1200045756 X:153400534-153400556 TCGGGCCCCTGGCTGTGGGGAGG - Intergenic
1201293992 Y:12448155-12448177 TAGGGGCTTGGGAAGTGGGGAGG - Intergenic