ID: 963316853

View in Genome Browser
Species Human (GRCh38)
Location 3:143768281-143768303
Sequence TGCAGTGCCCCCTTAACAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963316853 Original CRISPR TGCAGTGCCCCCTTAACAAG TGG (reversed) Intronic
900356708 1:2268428-2268450 TACCGTGCCCCCTTAACAAGAGG - Intronic
900766302 1:4508096-4508118 TGCAGTGCCCCTATAACCAAAGG + Intergenic
905598913 1:39233618-39233640 TGCAGTACCCACTAAACAAGTGG - Intronic
907916339 1:58873317-58873339 TGCAGTAGCCTCTTAACAATTGG + Intergenic
909732730 1:78914853-78914875 TGCAGCTCCCCCATAACAACTGG - Intronic
911443660 1:97963144-97963166 AGCAGTGCCCATTTAACCAGTGG - Intergenic
913552167 1:119926192-119926214 TGGAGTGCCCCCTTGAAAATAGG - Intronic
913696661 1:121332948-121332970 TGCTCTGCCCCCTTAAGAAAGGG + Intronic
914140899 1:144947112-144947134 TGCTCTGCCCCCTTAAGAAAGGG - Intronic
914221212 1:145683597-145683619 AGCAGTTCCCCCTTAACCATGGG + Intronic
914473782 1:148006470-148006492 AGCAGTTCCCCCTTAACCATGGG + Intergenic
915875024 1:159603372-159603394 TGCAGTAAACCCTTAATAAGTGG - Intergenic
916173031 1:162015552-162015574 TGCAATGCCCCTTTAAGAAAAGG - Intronic
919074225 1:192794364-192794386 TGCAGAGTCCAATTAACAAGAGG - Intergenic
920483991 1:206351302-206351324 TGCTCTGCCCCCTTAAGAAAGGG + Intronic
922976012 1:229783960-229783982 TGGAGCTCCTCCTTAACAAGGGG + Intergenic
1062980091 10:1714827-1714849 TTCAGTGAAGCCTTAACAAGGGG + Intronic
1063453449 10:6166686-6166708 CCCATTGCCCCTTTAACAAGGGG + Intronic
1070798843 10:79233135-79233157 TGCTGCTCCCCCTCAACAAGGGG - Intronic
1076275333 10:129193621-129193643 TTCTGTGCTCCCGTAACAAGTGG - Intergenic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1083809046 11:65092589-65092611 TGCATTACCACCTTACCAAGCGG - Intronic
1085250464 11:75140395-75140417 TGAAGTTCCCCCTAAACCAGAGG + Intronic
1089800513 11:121023644-121023666 TTCTGTGCCCCCTTCACAAGTGG - Intergenic
1095139629 12:38645622-38645644 TGCAGCCCCCCCTTGACTAGAGG - Intergenic
1098192540 12:67965695-67965717 AGCAGAGCCCCCTTTACAAAGGG + Intergenic
1099080922 12:78179444-78179466 TGCAGTGCAGCCTTTAAAAGAGG + Intronic
1102640034 12:114359001-114359023 TGCAGGGCACCCTTAGCAAGAGG + Intronic
1107747751 13:43529731-43529753 AGTAGTGCCCCCTTAACCAAGGG - Intronic
1118362483 14:65068137-65068159 TGCAGTCCACGCTTAAGAAGTGG + Intronic
1123996613 15:25722345-25722367 TGCACTGCCCCCTGAACTTGGGG - Intronic
1127640038 15:60907810-60907832 TGCATAGCCCTCTTGACAAGCGG - Intronic
1130059917 15:80562030-80562052 AGCAGTGCCCCCTTATCCAAGGG - Intronic
1130313099 15:82771755-82771777 AGCAGGGCCTCCTTGACAAGGGG + Intronic
1131313837 15:91314990-91315012 TGCAGTGCCCCTTTGACTATGGG - Intergenic
1131360060 15:91782696-91782718 TGCTGGGCCCCCTTACTAAGAGG - Intergenic
1131879470 15:96847194-96847216 TGCAGTGTTCACTTAAAAAGGGG - Intergenic
1134033276 16:11009690-11009712 TGCACTGCCCCCTTAAGTTGTGG - Intronic
1136051176 16:27651294-27651316 TGGAGTGCCCCCTCAAGATGGGG - Intronic
1136869952 16:33797848-33797870 CGCAGAGCCCCCTTCACATGTGG + Intergenic
1137889922 16:52148504-52148526 TGAAGGGTCCCCTTAACCAGTGG - Intergenic
1203102219 16_KI270728v1_random:1318206-1318228 CGCAGAGCCCCCTTCACATGTGG - Intergenic
1143479837 17:7221849-7221871 GGCAGTTCCCCCTTAACACCTGG - Intronic
1144113967 17:12067515-12067537 TGCAGTGCCCGCTGTACCAGTGG - Intronic
1147466848 17:40617000-40617022 TGCATGGCCCCCTGAACCAGGGG - Intergenic
1148541443 17:48483761-48483783 TGCAGAGCCCCCAGAAAAAGAGG + Intergenic
1150323547 17:64237121-64237143 AGAAGGGCCCCCTGAACAAGTGG + Intronic
1168254278 19:55157374-55157396 TGGAGTCCCCTCTGAACAAGAGG + Intronic
1168357370 19:55710392-55710414 TGCTGTGCCCCCTTCACTTGGGG + Intronic
930210206 2:48628910-48628932 TGCAGAGTCCAGTTAACAAGAGG + Intronic
931138661 2:59433053-59433075 ATTAGTGCCCTCTTAACAAGAGG - Intergenic
932214378 2:69957526-69957548 TGTAGGGCCCCCTTAACTAGAGG + Intergenic
933467623 2:82675583-82675605 TTCAGTGTAGCCTTAACAAGTGG + Intergenic
936933466 2:117814547-117814569 TGCAGCGCCCCCTGGAGAAGTGG - Intergenic
937276181 2:120685564-120685586 TGCAGTGCCAGCCTGACAAGGGG + Intergenic
937884960 2:126893389-126893411 TGCAGCGCCCCCTCAGCTAGGGG + Intergenic
940126911 2:150336430-150336452 TGCATTACTCCCCTAACAAGAGG - Intergenic
1169772076 20:9212018-9212040 TGCAGTGCCCCATCAAGAGGTGG + Intronic
1177402989 21:20630641-20630663 TGCAGAGCCAGCTGAACAAGAGG + Intergenic
1183618929 22:38961612-38961634 TGCAGTGCCTCCTTATATAGGGG - Exonic
950333959 3:12179050-12179072 TGCATTCCTCCCTTAACAAGTGG + Intronic
951961552 3:28329766-28329788 TGCGGTTCCCCCCAAACAAGTGG + Intronic
957166359 3:76678690-76678712 TGCAGTGCTCCATTAAAAAAGGG + Intronic
963316853 3:143768281-143768303 TGCAGTGCCCCCTTAACAAGTGG - Intronic
963779517 3:149473316-149473338 TGTCATGCCCCCTTCACAAGTGG - Intergenic
969102935 4:4783613-4783635 AGCAGTGCCCCCTTATCCATAGG - Intergenic
969389501 4:6880369-6880391 TGCAGTGCCCCCCTCACCATCGG + Intronic
970238288 4:13981188-13981210 TGCAGTGCCTCCTGAACAGAAGG + Intergenic
975245176 4:72112226-72112248 TGCAGTGACACTTTAAGAAGTGG + Intronic
975328819 4:73090873-73090895 TTCAGTGCCCCCTTACCATTTGG - Exonic
975649181 4:76574930-76574952 TGAAGTGCACCCTTAAAAAACGG + Intronic
980136709 4:128865153-128865175 TACAGTGTCCCCTGAACAAAAGG + Intronic
989519665 5:42386404-42386426 TGCAGGGCCTCCTGAACAAAAGG + Intergenic
991708192 5:69380532-69380554 TGCACTGCCCCTTTCAAAAGTGG + Intronic
997821899 5:137073912-137073934 GGCAGTCACCCCTTAACAAAGGG + Intronic
1005667865 6:28076517-28076539 GGCAGTGCCCCCATACCAATGGG + Intergenic
1008908243 6:56704699-56704721 ACCAGTGCCACCTTAACAAGAGG + Intronic
1012315099 6:97775431-97775453 TGCAGTGTACCCTCACCAAGGGG + Intergenic
1013349732 6:109294287-109294309 CGCATTGCCCTCTAAACAAGAGG - Intergenic
1036581938 8:10082791-10082813 CACAGTGCCCCCTTCACACGAGG - Intronic
1036898825 8:12656805-12656827 TCCAGTGGCCCCTTGAAAAGAGG - Intergenic
1039432249 8:37534017-37534039 TCCAGTGACCCCAAAACAAGTGG - Intergenic
1041134531 8:54743182-54743204 TGGAGTGCAACCTTAACAACTGG - Intergenic
1045033577 8:98160526-98160548 AGCATTGCTCCCTCAACAAGAGG - Intergenic
1053168066 9:35858675-35858697 TGCTTTTCCCCCTTAACAATAGG + Intergenic
1056837962 9:89972850-89972872 TGCAGAGCCTCCAGAACAAGTGG - Intergenic
1060233063 9:121839820-121839842 AGCAGTGCCCACTCACCAAGTGG + Intronic
1189556018 X:42146209-42146231 GGCACTGCCATCTTAACAAGTGG - Intergenic
1193770137 X:85578465-85578487 TGCAATACCCCCTTAACAGATGG + Intergenic
1193995488 X:88361983-88362005 TTCAGTTCCCCCTTAGTAAGCGG - Intergenic
1195796418 X:108653279-108653301 AGTAGTCCCCCCTTACCAAGGGG + Intronic