ID: 963318525

View in Genome Browser
Species Human (GRCh38)
Location 3:143786792-143786814
Sequence ATGAATGCACAGAGGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 598}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963318521_963318525 0 Left 963318521 3:143786769-143786791 CCCACTCAGAATCCAGAGAGTAA 0: 1
1: 0
2: 2
3: 19
4: 189
Right 963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG 0: 1
1: 0
2: 1
3: 57
4: 598
963318520_963318525 21 Left 963318520 3:143786748-143786770 CCAGTGACAGCTATAACTGTGCC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG 0: 1
1: 0
2: 1
3: 57
4: 598
963318522_963318525 -1 Left 963318522 3:143786770-143786792 CCACTCAGAATCCAGAGAGTAAA 0: 1
1: 0
2: 3
3: 20
4: 251
Right 963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG 0: 1
1: 0
2: 1
3: 57
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963318525 Original CRISPR ATGAATGCACAGAGGAAGCA TGG Intronic
900293684 1:1937484-1937506 ATGAAGGCACAGAGGAATTCAGG + Intronic
900822122 1:4897821-4897843 TGGAAAGCAAAGAGGAAGCAAGG - Intergenic
901129946 1:6955935-6955957 AAGCATGCACTGAGGAGGCAAGG + Intronic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901834045 1:11912214-11912236 ATGAATGCACAGAGGTGGGTGGG - Intergenic
901917419 1:12510567-12510589 GTGCATGCAGAGAGGAAGGAAGG + Exonic
901922187 1:12545264-12545286 ATGAATGAAGGGAGGAAGGAAGG - Intergenic
902082807 1:13832835-13832857 TTGTATGCAGAGAGCAAGCATGG + Intergenic
902137520 1:14322953-14322975 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902717686 1:18283628-18283650 ATGAAGGCGGAGAGGAAGCCTGG - Intronic
903934550 1:26886204-26886226 ATGAGTGCACAAAGGAAAAAAGG - Intronic
904022959 1:27482264-27482286 ATGAATGCCCAGAGGAATTAAGG + Intronic
904792127 1:33030581-33030603 ATGAATCCTCAGCGGAAGAAGGG - Intronic
904885777 1:33737239-33737261 CTGATTGCACTGAGGAAGAATGG + Intronic
906153885 1:43602967-43602989 ATGCATGCACAGACAGAGCAAGG - Intronic
906286378 1:44590453-44590475 ATGAGAGCTCTGAGGAAGCATGG - Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
906845410 1:49186173-49186195 ATGTATGCATAGGGGAGGCAGGG - Intronic
906846249 1:49196020-49196042 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
907383987 1:54113929-54113951 ATGACTGCCCAGGGGCAGCAGGG + Intergenic
907384288 1:54115966-54115988 ATGACTGCCCAGGGGCAGCAGGG + Intergenic
908071384 1:60464172-60464194 ATGAACTCACAGAGGATCCAAGG - Intergenic
908100838 1:60789377-60789399 ATGCAAGTACAGAGGATGCAAGG - Intergenic
908209536 1:61886220-61886242 AGGCATGAACAGAGGAAGAAAGG + Intronic
908269594 1:62410229-62410251 ATCACTGCACAGAGGAACCTGGG + Intergenic
908308477 1:62850521-62850543 ATGAGTTCAAAGAGGCAGCAGGG - Intronic
908857944 1:68450281-68450303 ATGAAGGCACAGAGGTATTAGGG - Intergenic
910140119 1:84018036-84018058 ATGAATGAACAATGGAAGCATGG + Intergenic
910418151 1:87024152-87024174 ATTAATGGAAGGAGGAAGCATGG + Intronic
910441755 1:87260223-87260245 TTGAAAGCTCAGAGGAAGCCAGG + Intergenic
910537560 1:88316156-88316178 ATGATTGTACAGAGTGAGCAAGG + Intergenic
910746532 1:90580792-90580814 GTGAAAGCAAAGAGGGAGCAAGG - Intergenic
910767972 1:90801498-90801520 AGGAATGAATAGGGGAAGCATGG - Intergenic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
911829016 1:102526510-102526532 ATGCATGTCCAGAGGAAGAATGG + Intergenic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
913398423 1:118398693-118398715 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
913964410 1:143363506-143363528 ATGGATGAACACAGGAAGAAAGG + Intergenic
914058779 1:144189112-144189134 ATGGATGAACACAGGAAGAAAGG + Intergenic
914120370 1:144777259-144777281 ATGGATGAACACAGGAAGAAAGG - Intergenic
915917162 1:159947191-159947213 ATGAATGCAGCATGGAAGCAAGG + Intergenic
916197785 1:162240916-162240938 ATGAGTGCACACTGGAAGCAGGG + Intronic
916304201 1:163310870-163310892 CGGAATGCAAAGGGGAAGCAAGG + Intronic
916681006 1:167105105-167105127 AGGAAGGCAAAGAGGAAGAAAGG - Intronic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
917502898 1:175601922-175601944 ATAAATGCACACAGTAAGGAAGG + Intronic
917505275 1:175621720-175621742 ATAAAGGCAGAGAGGAAGGAGGG - Intronic
917952268 1:180051458-180051480 TTGACTGCAAAGAGGATGCACGG + Intronic
918197995 1:182240667-182240689 ATGAAAGCAAATAGGAAGAATGG - Intergenic
918210965 1:182350310-182350332 CTGAATGCAGAGAGGTTGCATGG + Intergenic
918343911 1:183590113-183590135 ACAAATGCACAGAGGAGGCCCGG + Intronic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
919067010 1:192705034-192705056 ATGAATGAATACAGAAAGCATGG - Intergenic
919144657 1:193618466-193618488 ATGAATGCATAAAGAAAACATGG - Intergenic
919159450 1:193809094-193809116 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
919195136 1:194274777-194274799 ACGCATGCAAAGGGGAAGCAAGG + Intergenic
920364254 1:205439841-205439863 ATGAAGGGAGAGAGGAAGGAAGG + Intronic
920615774 1:207491354-207491376 AGGAAGGCAAAGGGGAAGCAAGG + Intergenic
921563971 1:216693807-216693829 ATTAATTCATAGAGGAAGGATGG - Intronic
921681802 1:218042229-218042251 ATGACTGCATAGTGGAAGCAGGG - Intergenic
921711170 1:218374798-218374820 TTGAACTCACAGAGGGAGCAGGG - Intronic
922569840 1:226627946-226627968 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
922745730 1:228042528-228042550 ATGAATGTACAGATGATGAAGGG + Intronic
922790877 1:228310262-228310284 ATGAATGGACAGATGATGGATGG - Intronic
923458130 1:234183842-234183864 ATGAATGGAGAGAGGAAGACAGG - Intronic
924135479 1:240961904-240961926 AAGAAGGCAGAGAGGAAGGAAGG + Intronic
924141548 1:241028969-241028991 ATGAATGGTGAGAGGAAGAAAGG + Intronic
1063137386 10:3229377-3229399 ATCCAGGCACAGAGAAAGCAAGG - Intergenic
1063779425 10:9304205-9304227 AGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1064779839 10:18822927-18822949 ATGAAAGGCCAGAGGAAGGAGGG + Intergenic
1065634822 10:27720788-27720810 ATAAATGGAGAGAGGAAGGAAGG + Intronic
1066435432 10:35393049-35393071 ACCAATGCGCAGAGGGAGCAGGG - Intronic
1067714932 10:48683590-48683612 GTGAATGCCCAGAGGAAGCGCGG - Intergenic
1067800858 10:49358649-49358671 ATGAATGGATAAAGGAAACATGG + Intergenic
1069290198 10:66769573-66769595 AGGAAGGCACACAAGAAGCATGG - Intronic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1069858643 10:71456357-71456379 ATAATGGCAGAGAGGAAGCAAGG - Intronic
1071716785 10:88104955-88104977 ATGAATTCAGAAAGGAGGCAAGG + Intergenic
1072919436 10:99563556-99563578 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1073301584 10:102474167-102474189 ATGAATGAACTAAGAAAGCATGG - Intronic
1074399930 10:113133637-113133659 ATGACTGAACAGAGCAAGCAGGG - Intronic
1074503573 10:114046118-114046140 ATGAAAGCAAAGAGAAAGGATGG + Exonic
1075315876 10:121453063-121453085 ATGAAGGCTCAGAAGAAGCAGGG + Intergenic
1075531225 10:123231727-123231749 AGGAAGGCAAAGGGGAAGCAAGG - Intergenic
1075855548 10:125626460-125626482 ATGAATGCACAGACAAAGAAAGG - Intronic
1075977829 10:126711809-126711831 ATGAATACATACAGTAAGCAAGG + Intergenic
1076050442 10:127329265-127329287 ATGGATGGGCAGGGGAAGCAGGG - Intronic
1076363206 10:129904529-129904551 ATAGATGAACAGAGGATGCATGG + Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077312124 11:1893557-1893579 ATGAATGGACAGAGGGAGAGAGG + Intergenic
1078542165 11:12221489-12221511 ATGAATCCTCATAGGTAGCAGGG + Intronic
1078674195 11:13394403-13394425 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1078896262 11:15599971-15599993 ATGAATGAAGAGAGAGAGCAAGG + Intergenic
1079188592 11:18258814-18258836 ATGAAAGAAAAGAGAAAGCAAGG - Intergenic
1079506883 11:21162995-21163017 ATGATTGCACTGAGAAAGGAGGG + Intronic
1079806322 11:24934429-24934451 ATAAATGAACAGAGTAAGAACGG - Intronic
1079881728 11:25936344-25936366 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1080285488 11:30606534-30606556 ATGAACGCAAAGAGGAGGCAGGG - Intergenic
1080740491 11:35059434-35059456 ATGAATGCCCAGAGAGAGGATGG - Intergenic
1080753679 11:35174890-35174912 ATGAAAGCTCTGAGAAAGCAAGG - Intronic
1081446364 11:43134895-43134917 ATGATTGCTCAGAGTAGGCATGG - Intergenic
1081576733 11:44323346-44323368 ATGAATGAAGAAAGGAAGGAAGG + Intergenic
1081998811 11:47381035-47381057 ATGAATGAACACATCAAGCAGGG - Intergenic
1084461892 11:69300847-69300869 ATGAATGCACGGATGATGGATGG + Intronic
1084921108 11:72470671-72470693 ATGAATGATCAGAGTAAGCAGGG + Intergenic
1085253807 11:75160683-75160705 ATAAACACTCAGAGGAAGCAAGG - Intronic
1085369118 11:75981801-75981823 ATGGCAGCACAGAGGAAGCAGGG - Intronic
1085696066 11:78705699-78705721 ATGAATGAACGAAGGAAGGAAGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086876551 11:92103368-92103390 TAAAATGCACAGAGGATGCAGGG - Intergenic
1087699914 11:101424089-101424111 AGAAATTCACAGTGGAAGCATGG - Intergenic
1088022271 11:105134010-105134032 ATAAATGAACACAGGATGCAAGG - Intergenic
1088415223 11:109581234-109581256 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1090087107 11:123660105-123660127 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1090448778 11:126787877-126787899 ATGAATGCCAAGAAGAAGCAGGG - Intronic
1090756117 11:129793272-129793294 ATGCAAGCACAAAGGTAGCAAGG + Intergenic
1091100297 11:132866095-132866117 ATGATTGCACATAAAAAGCAAGG + Intronic
1091152823 11:133344523-133344545 TGTAATGCACAGGGGAAGCAAGG - Intronic
1091566179 12:1649856-1649878 ATGATTAAAGAGAGGAAGCAGGG - Intergenic
1091836635 12:3590860-3590882 AGGCAGGCACCGAGGAAGCAAGG + Intronic
1091918858 12:4288570-4288592 ATGAATGCACAGAGGATTCAAGG - Intronic
1092277847 12:7075716-7075738 ATTCAGGCACACAGGAAGCAGGG - Intergenic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092596214 12:10007740-10007762 ATGTATGCACAGAGTAGGTAGGG + Intronic
1092611003 12:10173324-10173346 AAGAATACACAAAGGAAGAATGG + Intronic
1092992544 12:13917029-13917051 AGGAAAGCACAAAGGAAGAAAGG + Intronic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1093874960 12:24339471-24339493 ATGAGGTCACAGAGGAAGCCAGG + Intergenic
1094083643 12:26565428-26565450 ATGAATGAAAATAGGAAGGAAGG + Intronic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1094138577 12:27155885-27155907 ATGATTGCACAGACTTAGCAAGG + Intergenic
1094390691 12:29947052-29947074 ATGAATGAAATGAGGAAGGAAGG + Intergenic
1095349607 12:41192674-41192696 ATGAATGAACAGTTGAAACAAGG + Intronic
1095350579 12:41205868-41205890 ATGAAGGAACAGGGGAAGAAGGG - Intronic
1095887880 12:47207600-47207622 ATAAAAGCAAAGAGGAAGGAAGG - Intronic
1097131350 12:56812992-56813014 ATGAAGGGACAAAGGAAGGAAGG - Intergenic
1097486345 12:60207111-60207133 AATAATGCATAGAGGAAGCAAGG + Intergenic
1098466371 12:70791050-70791072 ATAAAAGCAGAGTGGAAGCAGGG - Intronic
1099314067 12:81063101-81063123 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100506947 12:95230762-95230784 ATGAATGCAGAGCAGAAGCAAGG - Intronic
1100715584 12:97302004-97302026 CTGAAAGCCCAGAGGAGGCAGGG - Intergenic
1100843776 12:98639260-98639282 ATGATTGCATAAGGGAAGCAGGG + Intronic
1100871909 12:98918366-98918388 ATGAATACACAGAAGATACAAGG + Intronic
1100892170 12:99137745-99137767 ATGGAAGCACAGAAAAAGCATGG - Intronic
1101081463 12:101189675-101189697 ATGAACGCACAGAGGTAGGAAGG - Intronic
1101474929 12:105036724-105036746 ATGTATGCACAGGAAAAGCATGG - Intronic
1101496189 12:105256584-105256606 TGGAAAGCAAAGAGGAAGCAAGG + Intronic
1101676253 12:106919484-106919506 ATGAATGCAGGAAGGAAGGAAGG + Intergenic
1101829069 12:108243056-108243078 GTGAATGCAAAGGGGAAGAATGG - Intronic
1102658442 12:114503567-114503589 AAGAAGGCAAAGGGGAAGCAAGG - Intergenic
1103409057 12:120697846-120697868 ATGAAAGGACAGGGGAAGGAGGG - Exonic
1104128599 12:125871414-125871436 AGAAGTGCACAGAGGCAGCAAGG + Intergenic
1104693580 12:130846382-130846404 ATGAATGAACAGGGCAAGGAAGG + Intergenic
1105348635 13:19596848-19596870 ATGCTTGCACAGGGGAAGCATGG + Intergenic
1105529081 13:21201940-21201962 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
1106393511 13:29358586-29358608 GTGAAGGAAGAGAGGAAGCAGGG + Intronic
1106420315 13:29580369-29580391 AGAAAAGCAGAGAGGAAGCACGG - Intronic
1106668219 13:31875640-31875662 AGGAATGCACAGGAAAAGCAGGG - Intergenic
1106910341 13:34456422-34456444 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1107343418 13:39434087-39434109 TTGCATGCTCAGAGGCAGCATGG + Intronic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1109193734 13:59355204-59355226 AAGAAGGCAAAGAGGAAACAAGG - Intergenic
1109393453 13:61723387-61723409 ATGAAAGGAGAGAGGAAGAAAGG + Intergenic
1109997614 13:70149925-70149947 ATGAAGGCAGAGAGGAAGTGAGG + Intergenic
1110104827 13:71659156-71659178 ATGAATACTGAGAGGAAACAAGG + Intronic
1111330755 13:86760373-86760395 TTGAATGGACTGAGGAAGGAGGG + Intergenic
1111377268 13:87396930-87396952 ATGACTGCAGAGAGCAACCAAGG + Intergenic
1111418612 13:87979562-87979584 ATGAATGCACAAAGAAAATATGG + Intergenic
1111503348 13:89154931-89154953 ATACATGCAGAGAGAAAGCATGG + Intergenic
1111795577 13:92915107-92915129 GTTAATGCATAGAGGGAGCAGGG - Intergenic
1111796900 13:92933053-92933075 ATGAATGCTCAGAGGAATTGTGG - Intergenic
1112106638 13:96247511-96247533 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1112116762 13:96364363-96364385 ATGAATGGATAGAGAAAGTATGG + Intronic
1112199476 13:97261087-97261109 AAGAATGCACACAGGTATCAAGG - Intronic
1112392954 13:99002004-99002026 ATGCAAGCGCAGAGGAAGGACGG - Intronic
1112615299 13:100998369-100998391 ATGATTGCACCGAGGGAACATGG - Intergenic
1112742392 13:102489833-102489855 AGGAAGGCAAAGAGGAAGCTAGG - Intergenic
1113576627 13:111399659-111399681 GTGCCTGCACAGAGGAAGCAGGG - Intergenic
1113755895 13:112810580-112810602 AAGAAGGGAGAGAGGAAGCAGGG - Intronic
1114493615 14:23118399-23118421 ATGAATTCACAGAGAAGGAAAGG + Intronic
1114521320 14:23338992-23339014 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1115882827 14:37939375-37939397 ATGAATGAAGAGTGGAAGCTTGG - Intronic
1116153714 14:41175652-41175674 ATGCACGAAAAGAGGAAGCAAGG + Intergenic
1116770188 14:49118480-49118502 ATGAAGGCAGAGAGGAAAGAGGG - Intergenic
1116820296 14:49620884-49620906 ATGAGAGCGCAGAGGACGCAGGG + Exonic
1117125738 14:52623170-52623192 ATGAATGTACAGATGTGGCAGGG - Intronic
1117503530 14:56377562-56377584 ATTTATTCTCAGAGGAAGCATGG - Intergenic
1118329840 14:64806643-64806665 ATGAGTGCACAGAAGAATCAAGG - Intronic
1118951223 14:70438226-70438248 ATCAATGGCCATAGGAAGCAAGG - Intergenic
1119187212 14:72651339-72651361 ATGAATGCACATCAGAAGCCAGG + Intronic
1119577614 14:75741353-75741375 CTGAATGCACTAAGGAAGTAAGG - Intronic
1119938928 14:78619699-78619721 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1120424254 14:84327705-84327727 ATGAATGCAGGGAGGAAATAGGG + Intergenic
1120642299 14:87029817-87029839 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1120906677 14:89626750-89626772 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1120983996 14:90316677-90316699 AAGAAAACAAAGAGGAAGCATGG - Exonic
1122031245 14:98914222-98914244 AGGAAAGGACTGAGGAAGCAGGG + Intergenic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1125215772 15:37272585-37272607 AGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126286106 15:47012911-47012933 ATGAAGAGACAAAGGAAGCAGGG - Intergenic
1126570406 15:50144450-50144472 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1126612811 15:50546951-50546973 ATGAGTGCCCAGAGCAGGCAGGG - Intergenic
1127324630 15:57883327-57883349 ATGACTGCAAAGAAGGAGCATGG - Intergenic
1127370226 15:58332172-58332194 AGGAATGCAAATAGGAAGCGAGG - Intronic
1127803144 15:62494770-62494792 ATGAATGCATGGTGGGAGCAGGG - Intronic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1128537068 15:68499708-68499730 ATGAGTTCAGAGACGAAGCAGGG + Intergenic
1128698391 15:69786263-69786285 ATGAATTCAGAGAGGCAGCCAGG - Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1130192154 15:81747664-81747686 CAGAATGCCAAGAGGAAGCAGGG - Intergenic
1130448634 15:84028950-84028972 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1130687154 15:86048711-86048733 AGCATTGCAAAGAGGAAGCATGG - Intergenic
1132278580 15:100592280-100592302 AAGAAAGCACAAACGAAGCAAGG - Intronic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1133005885 16:2881809-2881831 ATAAATGCACAAAGGTAGCTGGG + Intergenic
1133401504 16:5490620-5490642 AGGAGTGCCCAGAGGAACCAAGG - Intergenic
1133517546 16:6524367-6524389 ATGAATGCACACAGCAAGTGTGG - Intronic
1133650780 16:7812485-7812507 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1133919759 16:10141519-10141541 ATGAATACAGAGAAGAATCAAGG + Intronic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134429454 16:14188453-14188475 ATTAAGGCACATAGAAAGCAAGG + Intronic
1135143598 16:19942287-19942309 ATAAATTCCCAGAAGAAGCAGGG + Intergenic
1135652325 16:24217075-24217097 ATGAATGGAAAGAGAAAGAAAGG + Exonic
1137039989 16:35601712-35601734 ATGTATGGACAGAAAAAGCAAGG + Intergenic
1137550114 16:49431769-49431791 AAGAATTCCCAGAGGTAGCAGGG + Intergenic
1137674610 16:50298111-50298133 ATCAATGCAGAGAGGAAAGAGGG - Intronic
1137811183 16:51354318-51354340 ATGAATGGATAGAGGATGGATGG - Intergenic
1137840056 16:51632474-51632496 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1137965141 16:52924487-52924509 ATGAATTGATAGAGGAAGCATGG - Intergenic
1138006185 16:53340055-53340077 GTGAGTGCACAGAGGAAGAAAGG - Intergenic
1138579259 16:57929394-57929416 AGGAAAGCAAAGGGGAAGCAAGG + Intronic
1139813914 16:69651173-69651195 ATGAAGGCAAAGAAGAAGAAAGG - Intronic
1140145548 16:72303596-72303618 ATGAATTCAGAGAGGTAGCCAGG + Intergenic
1140527806 16:75638031-75638053 CTGAATGTTCAAAGGAAGCACGG - Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141978871 16:87537044-87537066 AGGAAGGCGAAGAGGAAGCAAGG - Intergenic
1142646508 17:1317128-1317150 ATGAAAACACATAGGAAGCCGGG + Intergenic
1142883621 17:2899100-2899122 ACGGATGCACCTAGGAAGCACGG - Intronic
1143029953 17:3962457-3962479 ATCAATGCCCAGAGGATCCAGGG + Intronic
1143888920 17:10087521-10087543 ATGAATGAAGAAAGGAAGGAAGG + Intronic
1144677212 17:17169353-17169375 ATGGATGCAGACAGGAAGCAGGG - Intronic
1145399794 17:22522015-22522037 GTGATTGCACAGTGTAAGCAAGG - Intergenic
1146041767 17:29461829-29461851 ATGAAAGCACAGAGGAGTCAAGG + Intronic
1146681131 17:34809154-34809176 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1146815754 17:35940891-35940913 ATGAATGGATAGACGAAGTATGG - Intronic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1147247802 17:39133505-39133527 TTGAATGAACAAAGGAAGTAGGG - Intronic
1147309120 17:39583844-39583866 ATTAATACCCAGAGGAAGCTAGG + Intergenic
1147856595 17:43485062-43485084 ATGAAGGTACAGAGGATGGATGG + Intronic
1147982827 17:44285291-44285313 ATGAAGGCAAAAAGCAAGCAAGG + Intergenic
1148666037 17:49375687-49375709 ATGCCAGCAGAGAGGAAGCAGGG + Intronic
1148698218 17:49573759-49573781 ATGGATGCACTGAGGAAGCTGGG - Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149342995 17:55705921-55705943 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1150011476 17:61508594-61508616 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1150135063 17:62690918-62690940 AAGAAGGCACTGAGGGAGCAGGG - Intronic
1150843919 17:68635402-68635424 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1151462562 17:74263273-74263295 ATGAATGAAAAGGGGAAGAAAGG - Intergenic
1151664629 17:75538497-75538519 ATGAATGAACAGAGGAGGCGAGG - Intronic
1152425901 17:80218526-80218548 ATGGATGGACAGAGGAGGCTGGG + Intronic
1152473806 17:80504454-80504476 ATGGATGCACAGAGGGAAAAAGG + Intergenic
1153138779 18:1948003-1948025 CAGAATGCAAAGGGGAAGCAAGG + Intergenic
1153666577 18:7371876-7371898 AAGAATGCAGGGAGGAAGGAAGG + Intergenic
1153844108 18:9033121-9033143 ATGCAAGAACAGTGGAAGCATGG + Intergenic
1155535124 18:26809075-26809097 ATGTATGCACAGAGGCTGAAGGG + Intergenic
1156345231 18:36251256-36251278 AGGAATGCAAAGAAGAAACATGG + Exonic
1156517371 18:37692061-37692083 ATGGATTCAGAGGGGAAGCAGGG + Intergenic
1156802170 18:41129313-41129335 ATGAATGGACAGACAAAGGATGG + Intergenic
1156962036 18:43043977-43043999 AGACATGCCCAGAGGAAGCATGG + Intronic
1157789625 18:50520136-50520158 AGAAACGCACAAAGGAAGCAAGG + Intergenic
1157946329 18:51984723-51984745 CTGAAGGCAAAGGGGAAGCAGGG + Intergenic
1158134864 18:54197126-54197148 ATGAATGAATAAAGGAAGAAAGG - Intronic
1158192512 18:54846269-54846291 ATGAAAGCACATAGAAAACAAGG + Intronic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158880847 18:61778529-61778551 ATCAAAGCACAGAAGAAACAGGG + Intergenic
1159265630 18:66074762-66074784 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1159848396 18:73494955-73494977 AAGAATGTACAGAAGAAGCTAGG + Intergenic
1160712700 19:559882-559904 ATGAATGGACAGACACAGCATGG - Intergenic
1161336195 19:3714943-3714965 CTGAATGCACAGAAGAATTAAGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164086011 19:21903162-21903184 AGGAAGGCAAAGAGAAAGCAAGG + Intergenic
1164212696 19:23114144-23114166 ATTTATGGACAGAAGAAGCAAGG - Intronic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1164845551 19:31429605-31429627 ATGAATGCACAGTGGACTCCAGG - Intergenic
1166206344 19:41272084-41272106 ATGAAGACAGAGATGAAGCAAGG + Exonic
1166410429 19:42552876-42552898 ATGCATTCACAGAGGAACCCAGG + Intronic
1166426239 19:42680898-42680920 AGGAAGGCAAAGAGGGAGCAAGG - Intronic
1166497871 19:43317228-43317250 ATGAATGCACACACGAACAAAGG + Intergenic
1166968687 19:46547420-46547442 CTGAAGGCAAAGGGGAAGCAAGG - Intronic
1167214953 19:48158349-48158371 ACGACAGCACAGAGGAAGCCTGG + Intronic
1167464876 19:49645439-49645461 AAGAATGCAGAGAGGGGGCAGGG - Intronic
1167498741 19:49834038-49834060 ATGAAAGCACACAGGATGCGTGG - Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
1168414308 19:56159028-56159050 ATGAATGTACAGATGATGGATGG - Intronic
1168414333 19:56159147-56159169 ATGAATGTACAGATGATGGATGG - Intronic
1168414362 19:56159300-56159322 ATGAATGTACAGATGATGGATGG - Intronic
1202698182 1_KI270712v1_random:140997-141019 ATGGATGAACATAGGAAGAAAGG + Intergenic
925205751 2:2004114-2004136 AAGAAGGCACACAGGAAGGAAGG - Intronic
925660242 2:6194592-6194614 CAGAATGCAAAGGGGAAGCAAGG - Intergenic
926115500 2:10210484-10210506 AAGAATGCACAGAGGGCGCTGGG + Exonic
926428009 2:12757347-12757369 ATAAATACACAAAGGAAGGAAGG - Intergenic
927675771 2:25104928-25104950 TTAAATGCACACAAGAAGCAGGG - Intronic
928083872 2:28333516-28333538 ATGAATTCAGAGCAGAAGCAGGG - Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
930034283 2:47075869-47075891 AGCAATGCCCAGAGGCAGCAGGG - Exonic
930892866 2:56411491-56411513 ATAAATGCCTAGAGGGAGCAGGG + Intergenic
932323210 2:70837124-70837146 ATGGATGGATAGAGGATGCATGG + Intergenic
932434427 2:71694874-71694896 AAGAATGCCCAGAGGAGGCCAGG + Intergenic
932784288 2:74586443-74586465 ATGAAAGCACTAAGGAAGGAAGG - Intronic
932843862 2:75114654-75114676 AAGAAAGCACAGAGAAAGAAAGG - Intronic
932965556 2:76470979-76471001 AAGAAGGCACTGAGGAAGCAAGG + Intergenic
934279437 2:91598780-91598802 ATGGATGAACACAGGAAGAAAGG + Intergenic
936050656 2:109221154-109221176 AGTCATGCACAGAGGAACCATGG + Intronic
936481961 2:112892536-112892558 ATGGAGGCATAGAGGAGGCATGG + Intergenic
936886788 2:117319906-117319928 AGGAAGGCAGAGAGGAAGGAAGG + Intergenic
937804161 2:126118036-126118058 ATGAATTCACAGAGGTGGAAAGG + Intergenic
937977492 2:127590453-127590475 AAGAACGCACAGAAGATGCATGG - Intronic
938410389 2:131059036-131059058 AGAAATGCAAAAAGGAAGCATGG + Intronic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
941004897 2:160237983-160238005 ATGAATGAAGAGTGGAAGCAGGG + Intronic
942273776 2:174303066-174303088 ATGAATGGATAAAGAAAGCATGG - Intergenic
943003417 2:182358986-182359008 AAGAAAGGACAGAGGAAGGAAGG - Intronic
943082452 2:183271496-183271518 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
943406209 2:187491021-187491043 ATTAAAGCACACAGGAAGGAAGG - Intronic
943406556 2:187494415-187494437 ATGCCTTCACACAGGAAGCAGGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945680121 2:212903712-212903734 ATGAATGCACAGTAGAGGCAGGG + Intergenic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
946102052 2:217333915-217333937 AGGAATGAAGAGAAGAAGCAAGG + Intronic
946202160 2:218076707-218076729 AGGGATGCACAGAGGAGGGAGGG - Intronic
946782427 2:223205378-223205400 ATGCAAGCACACAGGAGGCAGGG - Intergenic
947125576 2:226865150-226865172 TTGCATGCATAAAGGAAGCAAGG + Intronic
947556093 2:231094506-231094528 ATAAATAAACAGAGTAAGCAGGG + Intronic
948447273 2:238042758-238042780 ATGGGTGCAAAGAGGAAGCAAGG - Exonic
948603341 2:239119855-239119877 GCGACTGCACAGAGGCAGCAGGG + Intronic
1170445763 20:16425935-16425957 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1171749783 20:29037901-29037923 GTGAATGCAAACAAGAAGCAAGG + Intergenic
1171901801 20:30865390-30865412 ATGAAGGAAGAGAGGAAGGAAGG + Intergenic
1172473111 20:35215594-35215616 ATGAATGAACAAAGGCACCAAGG + Intergenic
1173174892 20:40756973-40756995 ATGAATTCACAGAAGAGGTAAGG - Intergenic
1173966891 20:47119307-47119329 ACGAATTCACAGAGGAAGTGTGG - Intronic
1174127395 20:48317053-48317075 CTGAAGCCACGGAGGAAGCATGG + Intergenic
1174552830 20:51373959-51373981 GTGAGTGCACCGGGGAAGCAGGG + Intergenic
1174729667 20:52903405-52903427 GGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1174772780 20:53316831-53316853 ATGAATGCACCAAAAAAGCAGGG - Intronic
1175566902 20:59987377-59987399 AGGAAAGCAGAGAGGAAGGAGGG - Intronic
1175570390 20:60014675-60014697 ATGAATGCATGAAGAAAGCATGG - Intronic
1175749482 20:61485408-61485430 TTGGATCCACAGAGGAAGGAGGG - Intronic
1175839597 20:62018676-62018698 AGGAATGCAGAGAGGAGCCAAGG + Intronic
1176130046 20:63492942-63492964 ATGGATGGACAGAGGATGGATGG + Intronic
1176315452 21:5238100-5238122 GTGAATGCAAACAAGAAGCAAGG - Intergenic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1177085108 21:16694122-16694144 AGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1177931871 21:27295469-27295491 AGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1178024164 21:28446147-28446169 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1179076150 21:38123585-38123607 ATGGAGGCACAGAGGAAGTTGGG + Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180238992 21:46486209-46486231 ATGATTGCACATAAGAGGCAAGG + Intronic
1180393242 22:12304055-12304077 GTGAATGCAAACAAGAAGCAAGG - Intergenic
1180406509 22:12560713-12560735 GTGAATGCAAACAAGAAGCAAGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181273783 22:21676025-21676047 ATGCATGCACCCAGTAAGCAAGG - Intronic
1181545365 22:23599361-23599383 CTGAATGGGCAGAGGATGCAGGG - Intergenic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1184077565 22:42192369-42192391 ATGAATGCAAGTAGGAAGAAAGG - Intronic
1184298502 22:43541284-43541306 TTGAATCCTCAGAAGAAGCAGGG + Intronic
1184373496 22:44097478-44097500 ATGAATGCTGACAGGCAGCAAGG + Intronic
949102510 3:163076-163098 TTGAAGGCAGAGAGGAAGCAGGG - Intergenic
949138298 3:599529-599551 ATGAATTCACAGAGCAAATAGGG + Intergenic
949231420 3:1755307-1755329 ATGAATCCACTGCAGAAGCATGG + Intergenic
949585237 3:5430833-5430855 AAGAAGGCAAAGGGGAAGCAAGG + Intergenic
949642776 3:6057772-6057794 ATGGATGCAGGGAGGAAGCAAGG - Intergenic
949677073 3:6467557-6467579 AAGAAGGGACAGAGGAAGAAAGG + Intergenic
949712898 3:6892234-6892256 ATGAATGATATGAGGAAGCAAGG + Intronic
949877295 3:8634617-8634639 ATGACTCCCCGGAGGAAGCAGGG + Intronic
950009604 3:9713446-9713468 ATGAATGGACAGCAGAAGAATGG + Intronic
950031489 3:9856817-9856839 ATGGCAGGACAGAGGAAGCAGGG - Intergenic
950187179 3:10952381-10952403 ATGAACCCTCAGAGGAAGGAGGG + Intergenic
950576376 3:13834507-13834529 ATGAAGTCAAAGAGGCAGCAGGG - Intronic
951443361 3:22748058-22748080 GTGAATGAACAGAGGATGAAAGG - Intergenic
952070180 3:29625109-29625131 GTGAAGGCAAAAAGGAAGCAAGG - Intronic
952941627 3:38449551-38449573 ATGAAAACACAGAGTAAGCTGGG - Intergenic
953093107 3:39749255-39749277 ATCTATGAACAGTGGAAGCATGG - Intergenic
953570361 3:44066609-44066631 ATCAGAGCACAGAGTAAGCAGGG - Intergenic
954433386 3:50483264-50483286 TTGCATGCACACAGGAACCAAGG + Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955003760 3:54950799-54950821 AGGGACGCACAGAGGAAGCATGG + Intronic
955554115 3:60117815-60117837 AAGGTTGTACAGAGGAAGCAGGG - Intronic
955614704 3:60794342-60794364 ATAAATGCAAAGAGGAAGGAAGG + Intronic
956297896 3:67734909-67734931 TGGAAGGCAGAGAGGAAGCAAGG + Intergenic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
956731315 3:72199130-72199152 ATGCTTTCACAGAGGAAACATGG + Intergenic
957544864 3:81624121-81624143 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
957783301 3:84848329-84848351 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
958017594 3:87959356-87959378 ATGAATACATGTAGGAAGCAAGG - Intergenic
958263126 3:91405643-91405665 AAGAATGCACAGAGCAAAGATGG + Intergenic
959569033 3:107862132-107862154 AGGAAGACAAAGAGGAAGCAAGG - Intergenic
960474541 3:118107941-118107963 AAGAATGCACAGAGAAAAGAGGG - Intergenic
962229418 3:133648467-133648489 ATGAGTGGAGAGAGGGAGCAGGG + Intronic
962468909 3:135687670-135687692 AGGAATGCCCAGAAGAAGAAGGG + Intergenic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
965079684 3:164020582-164020604 TTGAATGGACTGAGGAAGGAGGG + Intergenic
965396142 3:168162344-168162366 ATGAGTGCATAGAGGTAGGAAGG + Intergenic
965536722 3:169831127-169831149 ATGAATGTACAGACAAAGAATGG - Intronic
965839089 3:172882684-172882706 ATGAATGCTCAGAGGACAGAGGG - Intergenic
965950617 3:174303795-174303817 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
966336764 3:178876730-178876752 ATGAATGGAGGGAGGAAGAAAGG + Intergenic
966630135 3:182063506-182063528 AAGAAGGAACAGAGGAAGGAGGG + Intergenic
968885399 4:3328006-3328028 ATGAATGGATAAAGGAAACATGG + Intronic
969031317 4:4217138-4217160 ATGGATGAACACAGGAAGAAAGG - Intronic
969155008 4:5202533-5202555 ATCAATGCAGAGAAGAAACATGG - Intronic
969489456 4:7490857-7490879 CAGAGGGCACAGAGGAAGCAGGG - Intronic
969691804 4:8707991-8708013 ATGAATGAACTTAGGAGGCAGGG + Intergenic
969862195 4:10046362-10046384 AGGAAGGCAAAGGGGAAGCAAGG + Intronic
970293279 4:14600451-14600473 ATGAAGGCACAGAGCAATTAAGG + Intergenic
970561104 4:17283141-17283163 TCGAATGCACAAAGGAAGAAGGG - Intergenic
970712442 4:18879034-18879056 CAGAATGCAAAGGGGAAGCAAGG + Intergenic
971192372 4:24439833-24439855 ATGAATGCACAGTAAAATCATGG - Intergenic
972693206 4:41419782-41419804 AGGAAGGCAGAGAGGAAGAAAGG - Intronic
973089368 4:46113285-46113307 GTGAAGGCAAAGGGGAAGCAAGG + Intronic
974453647 4:62098000-62098022 ATGAATTCAGAGAGGAAGCTGGG - Intergenic
974475561 4:62374768-62374790 ATGGAAGGACAGAGGAAGAAAGG - Intergenic
974967425 4:68778857-68778879 ATGAATGGACAAAGAAAACATGG - Intergenic
974995399 4:69151524-69151546 ATGAAAGGACAGAGAAAACATGG + Intronic
975095944 4:70456502-70456524 CTGAAGGCAAAGGGGAAGCAAGG + Intronic
976039806 4:80869880-80869902 ATGAGTGACCATAGGAAGCAGGG - Intronic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
977016238 4:91695887-91695909 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
977393018 4:96437392-96437414 TAGAAGGCAAAGAGGAAGCAAGG + Intergenic
977642809 4:99376274-99376296 ATGAATGAATAGATAAAGCAGGG - Intergenic
977646160 4:99415178-99415200 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
980551060 4:134335798-134335820 TGGAATGCAAAGGGGAAGCAAGG - Intergenic
980754123 4:137135402-137135424 ATAAATTCACATAGTAAGCATGG - Intergenic
981191865 4:141873443-141873465 AGGAAGGCAAAGAGAAAGCAAGG + Intergenic
981429275 4:144641587-144641609 GTGATTCCACAGAGGAAGGACGG - Intergenic
981591039 4:146361160-146361182 ATGAAAACTCTGAGGAAGCAGGG + Intronic
981949183 4:150385583-150385605 ATGAACAGACAGAGGAAGAAGGG + Intronic
982103446 4:151990910-151990932 TTGAATGCACAGAGACAGCAGGG - Intergenic
982108630 4:152033179-152033201 CTAAATGCAATGAGGAAGCATGG + Intergenic
982402349 4:154982438-154982460 GGGAATGGTCAGAGGAAGCAGGG - Intergenic
982541777 4:156681754-156681776 ATGAATGCTAATAGGAAGCTGGG + Intergenic
983487587 4:168350436-168350458 AAGAAGGCAAAGAGGAATCAAGG - Intergenic
983667917 4:170202948-170202970 CGGAGTGCAAAGAGGAAGCAAGG - Intergenic
984355814 4:178655592-178655614 TAGAATGCAAAGGGGAAGCAAGG - Intergenic
984978504 4:185254084-185254106 ATGGTGGCACAGAGGAAGCAAGG + Intronic
985263198 4:188134252-188134274 ATGAAAGCACAGAAGAAGTATGG - Intergenic
985431674 4:189887457-189887479 GTGAATGCAAACAAGAAGCAAGG + Intergenic
986569245 5:9148395-9148417 ATGAGTGCACAGAGGCCACAGGG + Intronic
986768533 5:10950127-10950149 TGGAATGGACAGAGGAAGGAGGG + Intergenic
987199606 5:15562693-15562715 ATGAATGGAGAGAGGAAGGGAGG - Intronic
987255160 5:16143119-16143141 ATGAAGGAACAGAGAAAGGAGGG - Intronic
988230169 5:28466425-28466447 TAGAAGGCAAAGAGGAAGCAAGG - Intergenic
988282056 5:29162236-29162258 ATGAATGTCCAGAAGAAGCTAGG + Intergenic
988628414 5:32901726-32901748 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
989264909 5:39462284-39462306 ATGTATGCACACATGAAACATGG - Intronic
990168102 5:53017707-53017729 ATGAATGCACACAGGAATACTGG - Intronic
990623636 5:57587522-57587544 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
990674247 5:58165731-58165753 TTGAATGCACAGAGGCAGTGGGG + Intergenic
991559141 5:67930663-67930685 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
992184000 5:74225932-74225954 AAGAAGGCACAGAGGAAGGGAGG - Intergenic
992849461 5:80791819-80791841 ATAAATGCACAGAAGAAGGTTGG + Intronic
992972014 5:82071160-82071182 ATGAATCCAGAGAGGAGGCATGG + Intronic
993039196 5:82793054-82793076 CAGAACGCAAAGAGGAAGCAAGG - Intergenic
993075408 5:83224206-83224228 ATCAAAGCACAAAGGAAGAAGGG - Intronic
993843244 5:92907202-92907224 TATATTGCACAGAGGAAGCAAGG + Intergenic
994651241 5:102531807-102531829 GTGCAGGCACACAGGAAGCATGG + Intergenic
994742707 5:103641844-103641866 AGGGATGCAGAGAGGAAGCCTGG + Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
994992182 5:107010948-107010970 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
995020760 5:107364937-107364959 CTTAATTCACAAAGGAAGCATGG - Intergenic
995353907 5:111215130-111215152 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
996616247 5:125444628-125444650 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
996690549 5:126335570-126335592 ATGAATGAACAGTGAAATCAGGG - Intergenic
996756921 5:126945351-126945373 ATGATAGCACAGAGGAACCTGGG + Intronic
996933353 5:128917928-128917950 ACAGATGCACAGAAGAAGCAAGG - Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997833042 5:137168963-137168985 ATGAATGAACAAAGAAAACATGG + Intronic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
997931049 5:138071593-138071615 ATGAATGCACTGCAGAGGCAGGG - Intergenic
998108502 5:139483532-139483554 ATCAAGGCACAGAGCAAGCTGGG - Intergenic
998577229 5:143329172-143329194 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
998746855 5:145270968-145270990 AGGAAGGCAAAGGGGAAGCAAGG + Intergenic
999418039 5:151416992-151417014 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1000281201 5:159783878-159783900 GAGCATGCACACAGGAAGCATGG + Intergenic
1000360789 5:160445158-160445180 ATGAATGCATAGAGAAAATATGG + Intergenic
1000674368 5:164103214-164103236 ATGAATGTGCAGAGTAAGAAAGG - Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1002399333 5:178982758-178982780 ATGAATGAACAAAGTAAGAAGGG + Intronic
1003140293 6:3465747-3465769 ATGAACGAACAAAGGAAGGATGG + Intergenic
1003402880 6:5805433-5805455 CAGAAGGCAAAGAGGAAGCAGGG - Intergenic
1003823560 6:9927374-9927396 ATGAATGCACAGGAAAAGGAAGG - Intronic
1003980741 6:11387669-11387691 AGGAATGCAGTGAGGAAGGAAGG - Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1007009481 6:38401292-38401314 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1007562335 6:42820305-42820327 ATGAATTCACAAAGGATACAGGG + Intronic
1007598112 6:43064305-43064327 AAGAATTCATAGAGGAAGCAGGG + Intronic
1008810863 6:55497112-55497134 ATGAATGCATAAAGGCAGCATGG + Intronic
1008992282 6:57617245-57617267 AAGAATGCACAGAGCAAAGATGG - Intronic
1009180905 6:60516357-60516379 AAGAATGCACAGAGCAAAGATGG - Intergenic
1009661599 6:66619654-66619676 CGGAATGCAAAGAGAAAGCAAGG + Intergenic
1009880388 6:69559946-69559968 AGGAATGAAAAGAGGAAGAAAGG - Intergenic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1010883677 6:81211076-81211098 TTGAACGCACAGAGAAAGGAGGG + Intergenic
1011855724 6:91688411-91688433 AGGAAGGCAGAGAGGAAGGAAGG - Intergenic
1011921982 6:92589302-92589324 ATCAAAGCACAGAGGAACTAAGG - Intergenic
1011956048 6:93026612-93026634 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1012072269 6:94637937-94637959 AGGAAGGGAGAGAGGAAGCAAGG + Intergenic
1013904557 6:115199557-115199579 CTGAAGGCAAAGGGGAAGCAAGG + Intergenic
1013990819 6:116252566-116252588 ATGAAGGCCCAGAGGAAGAATGG + Exonic
1014002943 6:116385183-116385205 ATGAAGGCAGAGAGGCAGTATGG + Intronic
1015419319 6:132987832-132987854 AGGAAAGAAGAGAGGAAGCAGGG + Intergenic
1016293212 6:142546201-142546223 ATGAAAGCAAAGTGGAAGCAGGG + Intergenic
1016501019 6:144720778-144720800 ATAAATACACAGAGGAGGGAGGG - Intronic
1016632698 6:146250498-146250520 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1017951702 6:159140963-159140985 TTGACTGCACAGGGGATGCAAGG - Intergenic
1018322631 6:162628193-162628215 ATGAAGACGCAGAGGAAACAAGG + Intronic
1018489032 6:164272768-164272790 CTCAAGGCCCAGAGGAAGCAAGG - Intergenic
1019628643 7:2034748-2034770 ATGAATGAACAGGGGAGGAAAGG + Intronic
1019860382 7:3653252-3653274 GGGAAAGCACAGAGGAAGGAGGG - Intronic
1019981080 7:4622710-4622732 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1020305518 7:6831020-6831042 ATGAATGAATGGAGGAGGCAGGG + Intergenic
1020382894 7:7566202-7566224 ATGAATGAGCAGAGGAAGTGGGG - Intergenic
1020607898 7:10360812-10360834 CTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1021089440 7:16465648-16465670 ATGAATGGCAGGAGGAAGCATGG + Exonic
1021399119 7:20188946-20188968 ATGAATTCACACAAGAAACAAGG - Intronic
1021739029 7:23666930-23666952 ATGCAGTCAGAGAGGAAGCAGGG - Intergenic
1023564371 7:41508810-41508832 ATGGCTGCATAAAGGAAGCAGGG + Intergenic
1024011766 7:45272891-45272913 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1024110891 7:46145439-46145461 ATGAATGTAAAGAGCATGCAGGG + Intergenic
1024266401 7:47610161-47610183 ATGATTGCAAAGAGCAAGAATGG + Intergenic
1024300993 7:47887594-47887616 AGGAATGAGCAGAGGAACCAGGG - Intronic
1024881204 7:54087457-54087479 ATGAATGGAAAAAGGAAACATGG - Intergenic
1024920799 7:54552533-54552555 ATGAATGAATAAATGAAGCATGG - Intronic
1026079724 7:67206991-67207013 ATAAATGCACAGAAGAAAGAAGG - Intronic
1026648656 7:72195215-72195237 AAGAATGCACAGAGGAGCAAGGG - Intronic
1026805713 7:73428908-73428930 ATGAAGGCACAGGTGCAGCATGG + Intergenic
1027659071 7:80967229-80967251 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1028580806 7:92408176-92408198 AAGACTGAATAGAGGAAGCAGGG - Intergenic
1028632320 7:92948383-92948405 TTGAATGCAAAGAGTTAGCATGG + Intergenic
1029321765 7:99768547-99768569 TTGCATGCATAGAGGAAGGATGG - Intronic
1029494677 7:100890424-100890446 ATGAGTGCAGGGAGGACGCACGG + Exonic
1030611365 7:111693142-111693164 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1030908203 7:115212668-115212690 ATAAATGCACAGTGGGAGAATGG + Intergenic
1031044886 7:116876599-116876621 ATCAAGGCACACAGGAAGCAAGG - Intronic
1031288806 7:119907091-119907113 ATGAAAGTACAGAGTAAGCCGGG - Intergenic
1031642020 7:124176197-124176219 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1031785358 7:126024219-126024241 CGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1033529671 7:142249082-142249104 ATAAATGCAGAAGGGAAGCAGGG - Intergenic
1033870889 7:145752175-145752197 ATGTATGCACCCATGAAGCAGGG + Intergenic
1033901754 7:146150992-146151014 CTGAAGGCGAAGAGGAAGCAAGG + Intronic
1033949068 7:146761107-146761129 ATGAATGCACAGTGGATGTATGG - Intronic
1034294681 7:149961847-149961869 AAGTATACACAGAGGAAGTATGG + Intergenic
1034294691 7:149961928-149961950 AAGTATACACAGAGGAAGTATGG + Intergenic
1034500115 7:151444931-151444953 GTGACAGCACAGAAGAAGCAAGG + Intergenic
1034811374 7:154135024-154135046 AAGTATACACAGAGGAAGTATGG - Intronic
1035432265 7:158830740-158830762 ACAAATGCCCAGAAGAAGCAGGG + Intergenic
1036676200 8:10835760-10835782 AAGAATGGAAAGAGGAAGAAAGG + Intronic
1038689243 8:29746290-29746312 AGGAATGGAAAGAGGAAACAGGG - Intergenic
1040060593 8:43100129-43100151 ATGAGTGCAAATAGGGAGCAGGG + Intronic
1040522040 8:48186065-48186087 ATGAATATACAGAGCAAGAAGGG - Intergenic
1041573860 8:59370314-59370336 AGGAAGGCAGAGAGAAAGCATGG - Intergenic
1041690708 8:60684265-60684287 TGACATGCACAGAGGAAGCAAGG - Intronic
1042847850 8:73186032-73186054 ATAGATTCACAGAGGAATCATGG + Intergenic
1043825773 8:84926956-84926978 AGGAAGGCAAAGGGGAAGCAAGG + Intergenic
1044153219 8:88808892-88808914 ATGAATGCATAGAGAAATAATGG + Intergenic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1044964603 8:97562871-97562893 CTGAATGCATAAAGGAACCAGGG + Intergenic
1045375082 8:101564431-101564453 ATGTGTGCACAGTGGTAGCAGGG + Intronic
1045711558 8:104990481-104990503 ATGAAGGCATAGATGAAGAAAGG - Intronic
1045774392 8:105785116-105785138 ATGAATGCAGAGAGCATCCATGG + Intronic
1045842742 8:106598504-106598526 TTGCTTCCACAGAGGAAGCAGGG - Intronic
1046561435 8:115842744-115842766 AGGAAGGAACAGAGGAAGGAAGG + Intergenic
1046577670 8:116051326-116051348 GGGAATGCACAAAGGAAGGAGGG - Intergenic
1046844728 8:118903157-118903179 AAGAATCCACAGAGGAAGTCAGG - Intergenic
1047284715 8:123477807-123477829 ATGAAAGCACAGAGAAGGTAAGG + Intergenic
1048376637 8:133828349-133828371 CGGAAGGCACAGGGGAAGCAAGG + Intergenic
1048827379 8:138441775-138441797 ATGAGTGGACCTAGGAAGCAAGG + Intronic
1049350597 8:142162469-142162491 ATGGATGGACAGAGGATGGATGG + Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1049722133 8:144123169-144123191 ATTAATGCACAAAGAAAACATGG + Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1051116177 9:13697386-13697408 GTGAATGCCCATAGGAAGGAAGG - Intergenic
1051372525 9:16370672-16370694 ATGAATGCACAGTTGAATCATGG - Intergenic
1051430091 9:16972811-16972833 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1051767299 9:20539481-20539503 CTGAAGGCAAAGGGGAAGCAAGG + Intronic
1052231600 9:26161033-26161055 ATGAAGGCAGAGAGGTAGCAGGG + Intergenic
1052348672 9:27435932-27435954 AGGAAGTCACAGAGGGAGCAGGG - Intronic
1052539308 9:29787488-29787510 ATGAATGGATAAAGAAAGCATGG + Intergenic
1053188407 9:36037849-36037871 ATGAGTGCACAGAGGGAGAGAGG + Intronic
1053594884 9:39549684-39549706 ATTAGTACACAGAGGAAGCAGGG - Intergenic
1053824807 9:42011246-42011268 ATAAATGCATAGAGTAAGCCAGG + Intronic
1053852665 9:42304718-42304740 ATTAGTACACAGAGGAAGCAGGG - Intergenic
1054571370 9:66815283-66815305 ATTAGTACACAGAGGAAGCAGGG + Intergenic
1054605765 9:67176117-67176139 ATAAATGCATAGAGTAAGCCAGG - Intergenic
1055970080 9:81903060-81903082 ATCAATCCACAGTGGATGCAGGG - Intergenic
1056297722 9:85209237-85209259 AAGAAAGAACAGAGGAACCATGG + Intergenic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1057013556 9:91630475-91630497 CTGAATGCCCAGTGGAGGCAGGG + Intronic
1057764069 9:97900449-97900471 AAGAATGCACAGGGGAATAAGGG - Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059663596 9:116425361-116425383 ATGGTTGCAGTGAGGAAGCATGG - Exonic
1060517028 9:124272270-124272292 ATGAATGAACAAAGAAAACAAGG - Intronic
1061215939 9:129222161-129222183 GTGAGGGCACAGAGTAAGCAAGG - Intergenic
1061417486 9:130454968-130454990 ATGAATGGACGGAGGATGGATGG - Intronic
1062016308 9:134292964-134292986 ATGAATGAACGAAGGAAGGAAGG + Intergenic
1062172238 9:135141335-135141357 ATGAATGGACAGATGATGGATGG + Intergenic
1062240388 9:135534489-135534511 GGGAAGGAACAGAGGAAGCAGGG - Intergenic
1203619028 Un_KI270749v1:100820-100842 ATGAATTCACAGAGCAAATAGGG - Intergenic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1185638903 X:1575471-1575493 ATGAATGAACAGATGATGGATGG + Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185978843 X:4752917-4752939 ATGCATGCACTCAGCAAGCAGGG + Intergenic
1186948825 X:14599193-14599215 CTGAATGCACAGTGGAGGAACGG + Intronic
1187012758 X:15296984-15297006 ATGAATGCATAAAGAAAACATGG + Intronic
1187082267 X:16003249-16003271 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1187323995 X:18269409-18269431 TGGAAGGCAAAGAGGAAGCAAGG - Intronic
1187510725 X:19915844-19915866 ATGCATGCACACAGGTAGTATGG - Exonic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1188018897 X:25135413-25135435 TGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1188283603 X:28300899-28300921 AAGAAGGCCAAGAGGAAGCAAGG - Intergenic
1188610186 X:32086175-32086197 ATGATTGCAAAGAGGAACCAGGG + Intronic
1189192198 X:39120075-39120097 ATGAATGGATAAAGCAAGCATGG + Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1192274165 X:69613203-69613225 ATGAAAGCACAAAGGAAGTCTGG + Intergenic
1193194400 X:78613492-78613514 ATGATTGTGCAGGGGAAGCAGGG - Intergenic
1193655384 X:84190585-84190607 ATCAAGGCAAAGGGGAAGCAAGG - Intergenic
1194862037 X:99011413-99011435 TTGTAAGCACTGAGGAAGCAGGG - Intergenic
1195213976 X:102678585-102678607 ATGAAAGCAGAAAGAAAGCAGGG - Intergenic
1195231160 X:102849694-102849716 ATGATTACACTGAGTAAGCAAGG - Intergenic
1195864065 X:109410485-109410507 ATGAATGCAAAGAGAAAGTGTGG - Intronic
1197329273 X:125133515-125133537 AAGCATGCACAGAGGAATAATGG + Intergenic
1198370010 X:135981231-135981253 TGGAAGGCAAAGAGGAAGCAAGG + Intergenic
1198747004 X:139901185-139901207 AAGAATGCCCAAATGAAGCATGG + Intronic
1198865748 X:141121095-141121117 AGGAAGGCAAAGAGGAAGCAAGG - Intergenic
1199159222 X:144587602-144587624 AAGAATCCACACAGGGAGCAGGG + Intergenic
1199306063 X:146268895-146268917 GTGAAGGCAAAGGGGAAGCAAGG - Intergenic
1199337855 X:146641249-146641271 AGGAAGGCAAAGGGGAAGCAGGG - Intergenic
1199523091 X:148759608-148759630 CTGAATGCACAGTGCAAGCATGG + Intronic
1200322621 X:155205720-155205742 ATGGAAGCAGAGAGGAAGCATGG - Intronic
1201015735 Y:9599620-9599642 AGGAAGGCAAAGAGGAAGCCAGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201420048 Y:13788334-13788356 AACACTGCACAGGGGAAGCAGGG + Intergenic
1201798663 Y:17928718-17928740 AGGAAGGAATAGAGGAAGCAAGG + Intergenic
1201802890 Y:17977239-17977261 AGGAAGGAATAGAGGAAGCAAGG - Intergenic