ID: 963318851

View in Genome Browser
Species Human (GRCh38)
Location 3:143790344-143790366
Sequence CTTTTCTTACTGAAGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963318851 Original CRISPR CTTTTCTTACTGAAGGTGGT TGG (reversed) Intronic
900403183 1:2481184-2481206 CTGTTCTCACTGTAGGTGGCTGG + Intronic
900584755 1:3427468-3427490 CTTCACCTACTGGAGGTGGTGGG - Intronic
901336543 1:8454238-8454260 CTTTTGTTACTGAAAGTTCTGGG - Intronic
901514419 1:9735374-9735396 CTTTCCTTACAGAAGGGGTTAGG + Intronic
901826429 1:11864733-11864755 CAGTTCTTTCTGGAGGTGGTAGG - Intergenic
902475698 1:16685308-16685330 ATTTTCTTACTGGAAGTGGTAGG + Intergenic
902803036 1:18842186-18842208 CTTGTCTTACCTAAGGGGGTGGG + Intronic
903401926 1:23059922-23059944 CTATTCTTACTAAAAGTAGTAGG + Intronic
904695617 1:32329250-32329272 CTCTCCTTACTAAAGCTGGTGGG + Intronic
907307072 1:53519350-53519372 CTTTTCTTCCTGAGGCTGTTTGG + Intronic
907679909 1:56553417-56553439 CTTTTCCTTGGGAAGGTGGTTGG - Intronic
908551959 1:65217289-65217311 CTTTCCTTACTGCAGGAAGTTGG - Intronic
909295603 1:73944275-73944297 GTTATCTTAATGAATGTGGTTGG - Intergenic
909868789 1:80711331-80711353 CTTTTTTTTCTGAAAGTGTTAGG - Intergenic
912392839 1:109316628-109316650 CTTTTCTTATTGAGGGTTGGGGG - Intronic
912934714 1:113993256-113993278 CTTGTCTCACAGACGGTGGTGGG - Intergenic
916011896 1:160713852-160713874 CTTTTCTTGCTGAAGGAGCAGGG - Intergenic
916224262 1:162474136-162474158 TTTTTCCTACTGCATGTGGTAGG - Intergenic
918649333 1:186941189-186941211 CATTTCTGACTGTAGCTGGTGGG + Intronic
920888805 1:209961660-209961682 ATTATCTTACTGAAGAAGGTAGG + Intronic
921116336 1:212095087-212095109 CTTTTCTGACTGACTGTGGCTGG + Intronic
922430841 1:225551318-225551340 CTTTTTTTAATGAAAATGGTGGG - Intronic
923402930 1:233632725-233632747 CTTTTCTTCCTGAGGATCGTGGG + Intronic
923792535 1:237124517-237124539 CATTTCTTTCTGAAGGTTCTAGG + Intronic
1063432981 10:6007259-6007281 ATTTTATTACTGATGGTGGAAGG + Intergenic
1067194404 10:44103092-44103114 CATTTCTTACTTAAAGTGGTTGG + Intergenic
1071058233 10:81536068-81536090 CTCTTCTTCCTGAGTGTGGTTGG + Intergenic
1073624815 10:105086097-105086119 TTTCTCTTACTGAAGCTGTTAGG - Intronic
1073915338 10:108396755-108396777 TTTTTCTCACTTGAGGTGGTAGG + Intergenic
1074387761 10:113030576-113030598 CTTTTCTGCCTGAAGGTAGATGG + Intronic
1074923026 10:118037086-118037108 TTTTTTTTACAGAAGGTTGTTGG - Intronic
1076480717 10:130783667-130783689 CTTTTCATGCTAAAGGGGGTGGG - Intergenic
1077363221 11:2150254-2150276 CTAATCACACTGAAGGTGGTTGG - Intronic
1077974365 11:7232308-7232330 CTGTTCTAACTGGATGTGGTGGG + Intergenic
1078013420 11:7591925-7591947 CTTTTCTCATGGAGGGTGGTGGG + Intronic
1079790709 11:24735443-24735465 CTTTTATTCTTTAAGGTGGTTGG + Intronic
1080507559 11:32931835-32931857 TTTCTATTGCTGAAGGTGGTGGG - Exonic
1083139833 11:60712852-60712874 CATTTCATAGTGAAGGTGGATGG - Intronic
1087141704 11:94770434-94770456 CTTTTCCTTATGATGGTGGTGGG + Intronic
1095987649 12:48010342-48010364 CTTTTTTTAAAGCAGGTGGTGGG + Intergenic
1096345441 12:50842368-50842390 TTCTTATTACTGAAGGTGTTGGG + Intergenic
1096780306 12:53987826-53987848 ATTTTCTTACTGGAGTTGTTAGG - Intronic
1099967147 12:89460038-89460060 CTTTTCTTACTGAACTGGCTAGG - Intronic
1100538497 12:95534982-95535004 CTTTTCTTAATGACAGGGGTTGG + Intronic
1100810066 12:98328705-98328727 CTGATGTTACTTAAGGTGGTTGG - Intergenic
1101409216 12:104455486-104455508 CCTTTCTTAGTGATGATGGTGGG + Intronic
1101650256 12:106671242-106671264 CTTTACCTACTGAGGGTGGGTGG + Intronic
1103110965 12:118277899-118277921 CTTGTCTTACCCAAGGTGGTTGG + Intronic
1104038378 12:125114157-125114179 CTCTTCTGCCTGAAGCTGGTGGG + Intronic
1105249350 13:18683602-18683624 CATTTCTTTCTCAAGGTCGTGGG + Intergenic
1105649522 13:22359987-22360009 CTTTTCTTACTGTATGTTGTTGG + Intergenic
1107096670 13:36545050-36545072 CTTCTCTTACTGAAGGTGGGTGG - Intergenic
1107458168 13:40574813-40574835 CTTTTCTTTTTGGGGGTGGTAGG - Intronic
1108042496 13:46352243-46352265 GTTTTCTTTCTGAAGCTGGGTGG - Intronic
1108353001 13:49604337-49604359 CTTTTGTTACAGTAGGTAGTAGG + Intergenic
1109217127 13:59602887-59602909 ATTTTCTAAGTGAAGGAGGTGGG - Intergenic
1109794140 13:67287741-67287763 CTTTGCTGAATGATGGTGGTGGG + Intergenic
1109891078 13:68615951-68615973 CTTGTCTTATTGCAGTTGGTAGG - Intergenic
1112615120 13:100996860-100996882 CCTTTCTTACTAAAGATGTTTGG - Intergenic
1113699025 13:112369561-112369583 AGTTTCTTACTGAATGTGGATGG - Intergenic
1115814501 14:37148489-37148511 CTTATTTTACTGATGGTGGAGGG - Intronic
1118659346 14:67990355-67990377 CTTTTCTTACAGAATTTTGTTGG - Intronic
1119951383 14:78749340-78749362 CTTTTCTTAATAATAGTGGTAGG - Intronic
1126676577 15:51163944-51163966 CTTTGCTTACTGAGTGTGGAGGG + Intergenic
1129383852 15:75184850-75184872 CCTTTCTTACTGGGTGTGGTGGG - Intergenic
1130235687 15:82131465-82131487 ATTTTTTTTCTGGAGGTGGTGGG + Intronic
1130843722 15:87725176-87725198 CTTTTATTTCAGAAGGTGTTAGG - Intergenic
1134454701 16:14386513-14386535 CTTTTCTGACTGGGCGTGGTGGG - Intergenic
1135248397 16:20878148-20878170 CTTTCCTCTCTGAAGGTAGTGGG - Intronic
1135426177 16:22338671-22338693 CTTTTCTTTCTGATGTGGGTGGG - Intergenic
1136779433 16:32887119-32887141 CTTTTCTTCCTAAAGCTGGAGGG - Intergenic
1136891184 16:33974399-33974421 CTTTTCTTCCTAAAGCTGGAGGG + Intergenic
1137250211 16:46735884-46735906 CTTTGGGTACTGAAGGTGGCAGG - Intronic
1137960615 16:52878278-52878300 CATTTCTTACTCAAGGTGTTGGG + Intergenic
1141652287 16:85399456-85399478 GTTCTCTTCCTGAAGCTGGTGGG - Intergenic
1203081849 16_KI270728v1_random:1149207-1149229 CTTTTCTTCCTAAAGCTGGAGGG - Intergenic
1148038387 17:44686392-44686414 CTTTTCTTGCTGGTGGGGGTTGG - Intronic
1149171772 17:53820734-53820756 ATTTTCTTACTGAAAATGGCAGG - Intergenic
1153022319 18:641044-641066 TTTTTCTTAATATAGGTGGTAGG + Intronic
1154345154 18:13537225-13537247 CATTGCTTACAGAAGGGGGTAGG + Intronic
1155812997 18:30261742-30261764 CACTCCTTACAGAAGGTGGTGGG - Intergenic
1157733351 18:50023910-50023932 TTTTTCTTTCTGAAGTTGGAAGG - Intronic
1159414701 18:68129338-68129360 CTTGTCTTACTGCAGTTGCTAGG + Intergenic
1160411225 18:78676800-78676822 CTCTTCTTACTGAAGAAGGTAGG - Intergenic
1164639735 19:29815456-29815478 CTCTTCTAACTGAAAGTGCTTGG + Intronic
1165762676 19:38330992-38331014 CTTTTCTTCCTGGAGGTATTTGG - Intergenic
1167664793 19:50817842-50817864 CTTTTCTTACTGGGGGTCATAGG + Intergenic
1168477007 19:56683657-56683679 CATTTCTAAGTGAAGGAGGTGGG - Intergenic
928835458 2:35538976-35538998 CCTTTCTTACTTAAGGTTTTTGG + Intergenic
930237223 2:48900032-48900054 CTCTTCTCACTGAAGGGAGTTGG + Intergenic
930912659 2:56648137-56648159 CTTTTGTTATTGAAGCTAGTAGG + Intergenic
931949276 2:67343628-67343650 CTTTTTTTTTTGATGGTGGTGGG - Intergenic
933490162 2:82975859-82975881 CTTTACTTACTGGAGGTTGAAGG + Intergenic
933704588 2:85280295-85280317 CTTTTTTTATTGGGGGTGGTGGG - Intronic
934980041 2:98832112-98832134 CTTTTTTTAATGAGGGTGATAGG - Intronic
936560056 2:113529947-113529969 CTTTTTTTAGTGAAGTTTGTAGG + Intergenic
941547804 2:166875592-166875614 CTTCTCTTGCTGAAGCAGGTTGG - Intergenic
941903094 2:170696407-170696429 CTTAGCTTATTGAAGGAGGTGGG + Intergenic
943471750 2:188303240-188303262 CTTTTTGCCCTGAAGGTGGTAGG + Intronic
1173421715 20:42907043-42907065 ATTTTCTGACTGTAGGTAGTAGG - Intronic
1175424956 20:58857650-58857672 CTATTCTTCCTGGAGGTGGGGGG + Intronic
1175720581 20:61284373-61284395 CGTTTTCTACTGAGGGTGGTGGG + Intronic
1177428083 21:20952080-20952102 CTTTTCTAACTTAATGTGTTTGG - Intergenic
1179243468 21:39611372-39611394 GTTTTTTTAATAAAGGTGGTGGG - Intronic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1182227545 22:28810924-28810946 CTTTTTTTCCAGAAAGTGGTGGG - Intergenic
1183110225 22:35643192-35643214 ATTTTCTTACTGGATCTGGTGGG + Intergenic
1185232210 22:49689764-49689786 CTTCTCACACTGAAGGTGGAGGG - Intergenic
951858069 3:27220268-27220290 CATTTCTTTCTGAAGGTTCTGGG + Intronic
951946090 3:28137997-28138019 TTTTGCAAACTGAAGGTGGTTGG + Intergenic
952086054 3:29822836-29822858 CTTTTCTGGTGGAAGGTGGTAGG + Intronic
955556360 3:60141764-60141786 GTTTTCTTGCTGAAGTTTGTTGG - Intronic
956548791 3:70437048-70437070 CTTTTCTTCCTGAGCATGGTTGG - Intergenic
956890882 3:73613191-73613213 ATTTTTATTCTGAAGGTGGTGGG + Intronic
957421625 3:79979111-79979133 CTTTCATTACTGAAGGGTGTGGG + Intergenic
959556540 3:107725991-107726013 CTGTTCATACTGATGGTGGGAGG - Intronic
960212408 3:114985979-114986001 CTTTGTTTACAGAAGGGGGTGGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963318851 3:143790344-143790366 CTTTTCTTACTGAAGGTGGTTGG - Intronic
967427288 3:189341489-189341511 CTTTTCTGAATGAAGGTGTGGGG + Intergenic
967541489 3:190673145-190673167 CTTTTCTTAGTAGAGGTGGTAGG - Intergenic
968145879 3:196298644-196298666 CTTTTCTTACTGTTCTTGGTGGG - Intronic
968171959 3:196517931-196517953 CTTTTCTAACAGAAAGTGGCTGG + Intergenic
968312544 3:197695971-197695993 CATTTCCCACAGAAGGTGGTCGG - Exonic
969397443 4:6931599-6931621 CTGTTCTTTCTGAACGTGGCTGG - Intronic
975916334 4:79330073-79330095 ATTTTCTTGCTGAAGATGTTTGG + Intergenic
976623594 4:87154368-87154390 CTTTCCTTACTGAATGTTCTTGG - Intergenic
978706113 4:111713635-111713657 GATTTCTTACTGTGGGTGGTGGG - Intergenic
980733851 4:136856472-136856494 CTTTTCTTACTGAAATTTGTAGG + Intergenic
983383505 4:167027131-167027153 CTTTTCTGTCTGAAGGAGTTGGG - Intronic
983536957 4:168868120-168868142 CTTTTCGTACTGAAGATGGAAGG - Intronic
986969742 5:13318519-13318541 TTTTTCTTATTGAATGTAGTGGG + Intergenic
989719080 5:44503775-44503797 CTGTTCTTACTTAAGGCGGCAGG - Intergenic
990828758 5:59932621-59932643 CTTTGGTTACTGATGATGGTGGG - Intronic
991598756 5:68331610-68331632 CATTTCTTTCTGGAGGTGCTAGG - Intergenic
995131335 5:108633471-108633493 TTTTTCTAACTGCAGCTGGTAGG - Intergenic
995520094 5:112995294-112995316 CTTTTCTTTCTGTAGATGGTAGG + Intronic
997306671 5:132842147-132842169 CCTTTATTAGTGATGGTGGTAGG + Intergenic
1001359955 5:171073250-171073272 CATATCTTAATGAAAGTGGTAGG + Intronic
1001545853 5:172570142-172570164 CTGTTCTGAGGGAAGGTGGTGGG + Intergenic
1001639662 5:173235631-173235653 GCTTTATTACTGAAGGTGGTGGG + Intergenic
1002490921 5:179576885-179576907 TTTTTCTTCTAGAAGGTGGTAGG + Intronic
1002767201 6:252451-252473 TTTTTGTTGCTGATGGTGGTTGG - Intergenic
1002964941 6:1955122-1955144 CTTTTCATACTGAAGGTGTGTGG - Intronic
1003174153 6:3742869-3742891 CTTTTCTTCCTAAAGGAGTTAGG + Intronic
1007839537 6:44704485-44704507 CTTTTCTTCCTTCCGGTGGTGGG - Intergenic
1007914152 6:45545252-45545274 CTCTTCTTACTGAGAGTGGAAGG - Exonic
1008676261 6:53822518-53822540 CATGTCTTACTAAAGGTTGTTGG + Intronic
1008757704 6:54817373-54817395 AGTTTCTATCTGAAGGTGGTAGG - Intergenic
1011257711 6:85440663-85440685 CTTTTCTTACTGCATGAGCTAGG + Intergenic
1016206603 6:141474519-141474541 CTTTTTTTTCTGAAGGGAGTTGG + Intergenic
1016508860 6:144817097-144817119 TTTTCCTTACTGAACTTGGTTGG + Intronic
1017707244 6:157134688-157134710 CCATCCTTACTGAACGTGGTGGG + Intronic
1019782025 7:2946271-2946293 CTTCTATGACTGAAGGAGGTTGG + Intronic
1022223796 7:28341995-28342017 CTCTTCTTAGTAAATGTGGTTGG + Intronic
1022804762 7:33810528-33810550 CTTTTCTTAGTTTATGTGGTAGG - Intergenic
1024290580 7:47800872-47800894 ATTTTCTTTCTGCAGCTGGTGGG - Exonic
1024563625 7:50664330-50664352 ATTTTCTTCCTGCAGGTGCTGGG - Intronic
1029493558 7:100885155-100885177 TTTTTATTACTGATTGTGGTGGG - Intronic
1032737245 7:134703645-134703667 CTTTTCAGACAGAAGGTGTTCGG + Intergenic
1033861498 7:145633622-145633644 TTTTTGTTTCTGAAGATGGTAGG - Intergenic
1037056421 8:14447266-14447288 CTTTTCTTGCTAAAGTTGCTGGG + Intronic
1037405682 8:18540180-18540202 CTATTCTGATAGAAGGTGGTAGG + Intronic
1038349793 8:26765437-26765459 CATTGCTTTCTGAAGATGGTTGG + Intronic
1038971065 8:32636187-32636209 CCTTTCTTACTGGATGTGTTCGG + Intronic
1039299609 8:36195197-36195219 CTTTTCTTTCAGAAGTTGGGTGG + Intergenic
1043262079 8:78214355-78214377 ATTTTCCTCCTGAAGGTGTTAGG + Intergenic
1043769811 8:84184132-84184154 CTTTTCTTACAGCTGGTGATTGG + Intronic
1044758250 8:95489568-95489590 TTATTCTTACTGAAGTTGGTGGG + Intergenic
1044813630 8:96088796-96088818 GTTTTCTCAGTAAAGGTGGTAGG + Intergenic
1045048551 8:98302102-98302124 ACTTTCTAACTGAAGCTGGTTGG - Intergenic
1046880354 8:119300469-119300491 CTTTTCTTTCTCAAAGTAGTGGG - Intergenic
1049183106 8:141233508-141233530 CTATTTTTGCTGCAGGTGGTGGG - Intronic
1050614945 9:7392201-7392223 CTTTTCTCCCTGAATCTGGTGGG + Intergenic
1051318726 9:15875455-15875477 CTTTTTTTAATGAAGGTTTTGGG - Intronic
1051563388 9:18468789-18468811 CTTCTCATACTGTAGGTGCTTGG - Intergenic
1052285111 9:26776146-26776168 CATTTCTTCCTCAAGGTTGTAGG - Intergenic
1052641339 9:31168601-31168623 CTTTTCTTACTGAATTTGTATGG + Intergenic
1053227044 9:36368534-36368556 CTTTTCTTGCTCAAGGGGATGGG + Intronic
1053734036 9:41086480-41086502 CTTTTTTTAGTGAAGTTTGTAGG - Intergenic
1054452352 9:65409969-65409991 TTTCTCTTACAGAAAGTGGTCGG - Intergenic
1054694369 9:68345073-68345095 CTTTTTTTAGTGAAGTTTGTAGG + Intronic
1055146047 9:72936255-72936277 CTTTTCTTAGTGAAGTTTGTGGG - Intronic
1058436213 9:104966091-104966113 CTTGTCTTACTGCGGGTGGAGGG + Intergenic
1185766483 X:2729774-2729796 CTTTTTTTATTGCAGGAGGTGGG + Intronic
1186480432 X:9892698-9892720 CTGTTCTTACAGAAGATGGGTGG + Intronic
1187534553 X:20127998-20128020 ATTTTCTTACTGGAAGTGGTAGG + Exonic
1188105187 X:26140687-26140709 CTTAGCTTACTGAAGAAGGTAGG + Exonic
1188464541 X:30464868-30464890 CTTTTTTTTTTGAAGGAGGTAGG - Intergenic
1191599702 X:62989829-62989851 CCTTTCTTACTTAAGAGGGTTGG + Intergenic
1192002699 X:67172261-67172283 CTTTTTTTGTTGATGGTGGTAGG + Intergenic
1193334164 X:80267926-80267948 CTTTTCTAACTGAAGTTGGAAGG + Intergenic
1193430550 X:81398231-81398253 TTTTTCTTGATGTAGGTGGTAGG + Intergenic
1198602547 X:138299895-138299917 TTTTAATTACTGAAGGTGGAAGG + Intergenic
1199205594 X:145145219-145145241 TTTTTCTTTCTGAAGGTTGCTGG - Intergenic
1200100321 X:153686879-153686901 CTTTTCTTCCTAAAGCTGGACGG + Intronic
1201304588 Y:12539788-12539810 CTGTTCTTATAGAAGATGGTGGG + Intergenic