ID: 963323886

View in Genome Browser
Species Human (GRCh38)
Location 3:143839948-143839970
Sequence TCTCCTATGGTGAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963323886_963323895 26 Left 963323886 3:143839948-143839970 CCTCCCCCTTTCACCATAGGAGA 0: 1
1: 0
2: 1
3: 12
4: 155
Right 963323895 3:143839997-143840019 AAAACAGAGGAAATGAAACTAGG 0: 1
1: 0
2: 10
3: 85
4: 812
963323886_963323894 13 Left 963323886 3:143839948-143839970 CCTCCCCCTTTCACCATAGGAGA 0: 1
1: 0
2: 1
3: 12
4: 155
Right 963323894 3:143839984-143840006 AAAGAAATAAGAGAAAACAGAGG 0: 1
1: 2
2: 24
3: 354
4: 3307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963323886 Original CRISPR TCTCCTATGGTGAAAGGGGG AGG (reversed) Intronic
901078341 1:6569601-6569623 GCTCCTATGGTGAATGGAGTGGG + Intronic
901468533 1:9439562-9439584 TCTCCTATTGGGAAAGCGTGGGG - Intergenic
902029509 1:13411415-13411437 TCTCCTTTTTTGAAGGGGGGTGG - Intronic
902173131 1:14629173-14629195 TCTCATACGGTGGCAGGGGGAGG + Intronic
902746822 1:18480192-18480214 TCTCCTACGGTGAAAGATTGAGG - Intergenic
903550631 1:24155536-24155558 GCTGCTCTGGTGAAAGTGGGAGG + Exonic
904020386 1:27459777-27459799 TCCACTAGGGTGATAGGGGGTGG - Intronic
905091388 1:35433862-35433884 TCTCCTCTGGGGACAGGGAGCGG + Exonic
907131904 1:52104636-52104658 TCACCTATAGTGAATTGGGGTGG - Intergenic
912432399 1:109635622-109635644 TCTCCCATGTTGCCAGGGGGTGG - Intergenic
912559351 1:110538897-110538919 AGTCCTATGGTGGAAAGGGGAGG + Intergenic
913515583 1:119602860-119602882 TCTCCTATGGTGAAAAGGTAGGG + Intergenic
918422339 1:184376801-184376823 TCTCCCATGGTGACAGGGCCTGG + Intergenic
920053058 1:203175039-203175061 TCTCCTTTGGTGAGAAGGGAAGG - Intronic
920437029 1:205953669-205953691 TATCCTCTGGTGAAGGGGGTGGG + Intergenic
920724999 1:208426745-208426767 CCTCCAATGGCGAAAGGGGTGGG + Intergenic
922712815 1:227845868-227845890 TCCCCCAGGGTGCAAGGGGGTGG - Intronic
923118538 1:230968171-230968193 TTTCCTATGGTGGTGGGGGGGGG + Intronic
923548110 1:234939512-234939534 TCCCCAAGGGTGAAAGGTGGGGG + Intergenic
1062909887 10:1205624-1205646 CCTCCCATGGTGGAAGGGGCTGG - Intronic
1063991517 10:11569867-11569889 TCTCTTAGGGTGATAGGGGGAGG - Intronic
1068539319 10:58273389-58273411 TCTTCTATGAGGAGAGGGGGAGG - Intronic
1068721721 10:60253149-60253171 TACTCTATTGTGAAAGGGGGAGG + Intronic
1068781329 10:60921936-60921958 TCCCATTTGGTGAAAGGGTGTGG - Intronic
1071071152 10:81696031-81696053 TCTCACATGGTGAAAGGGGTAGG + Intergenic
1071564904 10:86666777-86666799 TCGCCTCTGGGGAAAGGGAGGGG - Intronic
1072883665 10:99253457-99253479 TTTCATATGGTGAAAGGTAGGGG - Intergenic
1076110284 10:127854933-127854955 TCTCCTCAGGTGTACGGGGGAGG + Intergenic
1078695763 11:13629588-13629610 TTACTTATGGTGAAAGGGGAAGG - Intergenic
1079034301 11:17008980-17009002 TCTCCTATGTTGATTAGGGGTGG - Intronic
1079105800 11:17571568-17571590 TTGCCCATGGAGAAAGGGGGAGG + Intronic
1081288403 11:41301720-41301742 TCTCCTCTGATGAAATTGGGGGG - Intronic
1084857768 11:71999910-71999932 TCTTCTCTGGTGAAAGGTGGGGG - Exonic
1088288007 11:108207376-108207398 TCTCCTAGGTGGAAAGGGGCAGG - Intronic
1092192763 12:6532960-6532982 TCCCTAATGGTGAAAGGGGTGGG - Intergenic
1093160831 12:15744292-15744314 TCTCATAGGGTGAAAGAGGAAGG - Intronic
1096623344 12:52878154-52878176 ACTCCTAAGCTGAAAGGCGGAGG - Intergenic
1099890647 12:88585201-88585223 TCTCCGATAGTGGAAGGAGGTGG - Intergenic
1100486801 12:95037105-95037127 TCTCCTGTGGTAAACGGTGGTGG + Intronic
1102379001 12:112447294-112447316 TTTCCTCTGGGGAAAGAGGGAGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1107730811 13:43346423-43346445 TCTCCTCTGGTTAAAGTGTGAGG - Intronic
1107995949 13:45861138-45861160 TCTCCTGTTTTGAAAGGGGTAGG + Intergenic
1113278774 13:108765671-108765693 TTTGCCATGGTGAAAAGGGGAGG - Intronic
1113574278 13:111382988-111383010 TCTCCTATGGGGGCAGTGGGAGG - Intergenic
1114757042 14:25270929-25270951 TCTCACATGGTGAAAGGTGGAGG + Intergenic
1115014824 14:28597754-28597776 TCTAATATAGTGAGAGGGGGAGG - Intergenic
1115045734 14:28990786-28990808 GCTCCTGTGAGGAAAGGGGGAGG - Intergenic
1117795103 14:59385321-59385343 TCTCCAATGATGAAAGTGAGGGG + Intergenic
1128253096 15:66177503-66177525 TCTCCTCTGGTTCCAGGGGGTGG + Intronic
1129771298 15:78204998-78205020 TTTCCTAGGGAGAAAGCGGGTGG + Intronic
1131792440 15:95979876-95979898 TCTGGTGTGGTGAAAGAGGGAGG + Intergenic
1131832979 15:96366054-96366076 TCTCCTCTGGTGGATGTGGGAGG + Intergenic
1138183863 16:54961839-54961861 TCTCCTAGAGTGCAAGAGGGTGG - Intergenic
1138694352 16:58797866-58797888 CCTCATATGGTGGAAGGGGCAGG + Intergenic
1139397455 16:66651610-66651632 TTTCCCATGGTGAAAGGGGTGGG - Intronic
1141001386 16:80311616-80311638 GGTCATATGGTGAGAGGGGGAGG - Intergenic
1144590339 17:16518384-16518406 TCTCCTTTGGGGAAGGGGGCAGG + Intergenic
1145957711 17:28866018-28866040 TCTCCGATGCTGAGAGGTGGAGG - Intergenic
1148852864 17:50563081-50563103 TCTGCTTTGGGGAAGGGGGGTGG + Intronic
1148859129 17:50594974-50594996 TTTCCTACAGGGAAAGGGGGAGG - Exonic
1149060469 17:52415373-52415395 TCTCCTATGGAAAAAGGGCAAGG - Intergenic
1149150827 17:53561947-53561969 TGTCACATGGTGAAAGGGAGAGG - Intergenic
1149429381 17:56585162-56585184 TATCCTTTGGTAAAATGGGGAGG - Intergenic
1150443112 17:65207781-65207803 TCTCCTTGGGTGAAAGGTGTTGG - Intronic
1153470327 18:5437278-5437300 CCTCATGTGGTGAAAGGGTGAGG - Intronic
1155510977 18:26576616-26576638 TTTCCTCTGGAGGAAGGGGGTGG - Intronic
1157096494 18:44689883-44689905 TCCCCTAAGCTGAAATGGGGAGG + Intronic
1159092908 18:63869784-63869806 GATCCTATGGTTAAAGGAGGAGG + Intergenic
1160178131 18:76612575-76612597 GGTCCGATGGAGAAAGGGGGTGG + Intergenic
1166051235 19:40261583-40261605 CGTCCCATGGTGAAAGGGGAAGG - Intronic
1166816084 19:45547065-45547087 TTTCCTATGGGGAAGGAGGGAGG + Intronic
926425701 2:12736849-12736871 TCTCCCATGCTGAAAAGAGGAGG + Intronic
926841468 2:17085415-17085437 TCTTCTTAGGTGAAAGTGGGTGG - Intergenic
928757523 2:34545183-34545205 TGTCCCTTGGTGAAGGGGGGGGG + Intergenic
932467039 2:71930543-71930565 TCTCCCATGCTGAAAGGGGAGGG - Intergenic
932639767 2:73432600-73432622 CCTCCCATGGTGGAAGGGGCAGG + Intronic
936349907 2:111704628-111704650 TCTGGTTTGGTGAAAGGGGATGG + Intergenic
941900440 2:170672774-170672796 TCCCATATGATGAAAGGGAGAGG - Intergenic
945079187 2:206071798-206071820 GTTCCTATGGTGGAAGGTGGGGG - Intronic
946132375 2:217616750-217616772 TATCCCATGGTGGAAGGTGGAGG + Intronic
946817731 2:223596124-223596146 TTTCCTATTGTAAAAGGGAGGGG + Intergenic
948146988 2:235715453-235715475 CCTCCTCAGGTGAAAGGGGAGGG + Intronic
1170524738 20:17226765-17226787 TCTCCGGTGCTGAAAGGGGCGGG + Intronic
1170966197 20:21073871-21073893 TCTCTTATGATGACAGGGGCTGG + Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1174570455 20:51497625-51497647 TCTGCTTTGGTGGAAGGCGGTGG - Intronic
1174602889 20:51739145-51739167 GCACCCATGGGGAAAGGGGGAGG - Intronic
1175602557 20:60286860-60286882 TCTGCCATGCAGAAAGGGGGTGG - Intergenic
1183481120 22:38066106-38066128 TGTCCTATGGCTAAAGGGGCTGG - Intronic
1184724009 22:46332497-46332519 CATCCTATGGAGAAAGGGGCTGG - Intronic
1184865401 22:47199361-47199383 TTTCCTCTGGTGCAAGGGTGGGG - Intergenic
1184956373 22:47889467-47889489 CCTCATGTGGTGGAAGGGGGAGG + Intergenic
950124415 3:10502726-10502748 TCTCCTATGGGTGAAGGCGGAGG - Intronic
951066763 3:18276027-18276049 TCTCATATGCTGGAAGGGGCAGG - Intronic
954403137 3:50329851-50329873 CCTCCTGTGGGGAAAGGGGTTGG - Exonic
955016373 3:55074095-55074117 TCTCCTATGGGGAAAGGCAGGGG - Exonic
955275612 3:57544261-57544283 TCTCCTCAGGTGAAAGGCAGGGG + Exonic
957772688 3:84715028-84715050 TTTTATATGGTGAAAGGGAGGGG - Intergenic
962366972 3:134793338-134793360 TGTGATATAGTGAAAGGGGGAGG + Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
963323886 3:143839948-143839970 TCTCCTATGGTGAAAGGGGGAGG - Intronic
964340861 3:155707072-155707094 TCTCATATGGTGGAAGGGTAGGG - Intronic
969292280 4:6247755-6247777 TTTCCTATGGTGACAGGAAGGGG - Intergenic
969706635 4:8795955-8795977 TATCCTTTGTTGAAAGAGGGAGG + Intergenic
969837901 4:9858403-9858425 GCTGCTATGGTGGAAAGGGGTGG + Intronic
970105159 4:12574390-12574412 TCACTTATGGTGGAAGGGGAAGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
975805082 4:78103692-78103714 CCTCACATGGTGAAAGGGGTTGG - Intronic
980132658 4:128831103-128831125 TTTCCTAATGTGAAAGGGAGGGG + Intronic
985132666 4:186755164-186755186 GCTCGTATGGAGAAAGTGGGAGG + Intergenic
989350941 5:40486094-40486116 TCTCCAATGGGGAATGGGGGTGG - Intergenic
993165749 5:84352884-84352906 TCTCCTATGGTGAGAAGTGAGGG - Intronic
993771481 5:91933300-91933322 CCTCCTATGGTGGAAGGGCAAGG + Intergenic
995843161 5:116464620-116464642 TCTGTTATTTTGAAAGGGGGAGG + Intronic
997119176 5:131156640-131156662 TCCCACATGGTGAAAGGGGCAGG + Intergenic
997749724 5:136332375-136332397 TTTCCTATGGCGAGATGGGGAGG + Intronic
999508958 5:152227658-152227680 TCTCCTTTGGTGGAAGCGGATGG + Intergenic
1000346669 5:160320334-160320356 TCTCCTTCTGTGAAAGGAGGGGG + Intronic
1000674416 5:164103789-164103811 TCTCCAATGTTGAATGGAGGTGG - Intergenic
1002158719 5:177302738-177302760 TCTGCTATGGTAAGGGGGGGGGG - Exonic
1002927422 6:1612519-1612541 TATCCTATGTTGAAGGGAGGGGG + Exonic
1004476852 6:15981334-15981356 TTTCCTGTGGTGAAGTGGGGTGG - Intergenic
1007462108 6:42026412-42026434 TCCCCTCTGGTCAAAGGTGGAGG - Intronic
1009445039 6:63732719-63732741 TTGCCTATGGTGAAATAGGGAGG - Intronic
1010462892 6:76133456-76133478 TATCCTATGGTGAATGAGGTAGG - Intergenic
1016664254 6:146616601-146616623 TTGCATATGGTGAAAGGTGGGGG + Intronic
1017156553 6:151327591-151327613 ATTCCTATGGTAAAAGGAGGTGG + Intronic
1017681485 6:156868571-156868593 CCTCCTATGGTGGAAGGGGGTGG + Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1019023997 6:168942340-168942362 TCTCCTGTGATGGAAGGTGGTGG + Intergenic
1020611522 7:10403521-10403543 TCTTCTCTGGTGGAGGGGGGAGG - Intergenic
1021067238 7:16191490-16191512 ACTCCTAAGGTGAAAGAGGAAGG + Intronic
1024084406 7:45881573-45881595 TCACCTCTGGTAAAGGGGGGTGG - Intergenic
1024559813 7:50633190-50633212 TCTCCTACAGAGAAATGGGGAGG - Intronic
1028605953 7:92656060-92656082 TTTCCTATGGTTAAAGTGGGAGG + Intronic
1029115865 7:98236762-98236784 TCTCCTCAGGTGACTGGGGGTGG - Exonic
1029118462 7:98250840-98250862 TCTGCTACAGTGAAAGGGAGGGG + Intronic
1029974037 7:104815890-104815912 TCTTCAAAGGGGAAAGGGGGAGG - Intronic
1030373186 7:108723915-108723937 TCTCCGATGTGGAAAGGAGGTGG + Intergenic
1030777493 7:113552424-113552446 TCTCCTTGGGTGAAAGGGATAGG - Intergenic
1031030346 7:116727503-116727525 TCTCCTATGGTAACAAAGGGAGG - Intronic
1032440421 7:131938594-131938616 TTTCCTAGGGTGAAACTGGGTGG + Intergenic
1032742045 7:134748938-134748960 CCTCACATGGTGAAAGGGGTGGG - Intronic
1041059581 8:54022639-54022661 TCTCCTATGGAGAAAGTGCTTGG - Intergenic
1041784822 8:61620257-61620279 TCTCCTATGCACAAAGAGGGAGG - Intronic
1042352143 8:67788005-67788027 TCTCCAATGTTGAATGGAGGTGG - Intergenic
1043313108 8:78886579-78886601 TCTACTATGATGAAAGGAGGAGG + Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1047531065 8:125675753-125675775 ACTCCCATGGTGAAAGGCAGGGG + Intergenic
1048921047 8:139230417-139230439 TCACCTATGGTGAAATAGGATGG + Intergenic
1055573330 9:77639213-77639235 TCTACCATAGGGAAAGGGGGTGG - Intronic
1057840895 9:98484952-98484974 TCTCTTATGCTGAAAGGGCTTGG + Intronic
1058337772 9:103854131-103854153 TCTCCTAAGGAAAAAGGAGGAGG + Intergenic
1058639253 9:107067152-107067174 TCTCCAAAGGTGAAAGGCAGTGG - Intergenic
1059631407 9:116127330-116127352 TTTCTTATGGTGAAAGGTAGGGG + Intergenic
1060257759 9:122047516-122047538 TCTCTTCTGGGGAGAGGGGGTGG - Intronic
1061545080 9:131299738-131299760 TCTCCTATGGCCAAACGGGACGG - Intronic
1188005129 X:25011774-25011796 TCTCCTCTGGTTCAAAGGGGCGG + Intronic
1192241675 X:69335619-69335641 TTTCCTATGGTGGAAGGATGGGG + Intergenic
1193380489 X:80810763-80810785 TCTTCAATGATGAAAGGGGTTGG + Intergenic
1193698741 X:84739391-84739413 GCTCCTATAGTGAATGGAGGAGG - Intergenic
1197889772 X:131257695-131257717 AAACCTATGGTGAAAGGGGCAGG - Intergenic
1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG + Intergenic
1200466619 Y:3528023-3528045 TTTCCTATGGCGAAAGAGTGAGG + Intergenic
1201720459 Y:17090572-17090594 TTTCCTATGGTGAAAGCATGGGG - Intergenic
1202240628 Y:22764175-22764197 GCTACTATGGAGAAATGGGGTGG + Intergenic
1202393614 Y:24397928-24397950 GCTACTATGGAGAAATGGGGTGG + Intergenic
1202477171 Y:25272172-25272194 GCTACTATGGAGAAATGGGGTGG - Intergenic