ID: 963326735

View in Genome Browser
Species Human (GRCh38)
Location 3:143871431-143871453
Sequence GCCTCTACTTTATTTCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963326732_963326735 -9 Left 963326732 3:143871417-143871439 CCAGCTGCATCCCTGCCTCTACT No data
Right 963326735 3:143871431-143871453 GCCTCTACTTTATTTCAGCAAGG No data
963326731_963326735 -8 Left 963326731 3:143871416-143871438 CCCAGCTGCATCCCTGCCTCTAC No data
Right 963326735 3:143871431-143871453 GCCTCTACTTTATTTCAGCAAGG No data
963326728_963326735 25 Left 963326728 3:143871383-143871405 CCTGCAAATGACAAACTGAAGAT No data
Right 963326735 3:143871431-143871453 GCCTCTACTTTATTTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963326735 Original CRISPR GCCTCTACTTTATTTCAGCA AGG Intergenic
No off target data available for this crispr