ID: 963331816

View in Genome Browser
Species Human (GRCh38)
Location 3:143923365-143923387
Sequence GACAGATCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963331816_963331819 11 Left 963331816 3:143923365-143923387 CCAGTAACAGGCCAAGATCTGTC No data
Right 963331819 3:143923399-143923421 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963331816 Original CRISPR GACAGATCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr