ID: 963331816 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:143923365-143923387 |
| Sequence | GACAGATCTTGGCCTGTTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963331816_963331819 | 11 | Left | 963331816 | 3:143923365-143923387 | CCAGTAACAGGCCAAGATCTGTC | No data | ||
| Right | 963331819 | 3:143923399-143923421 | GAGTAGTTATCTGCAGAAGATGG | 0: 178 1: 192 2: 102 3: 110 4: 247 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963331816 | Original CRISPR | GACAGATCTTGGCCTGTTAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||