ID: 963341424

View in Genome Browser
Species Human (GRCh38)
Location 3:144039331-144039353
Sequence ATGGCTGTTACAGGTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963341424_963341433 6 Left 963341424 3:144039331-144039353 CCTGGAAGACCTGTAACAGCCAT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 963341433 3:144039360-144039382 AGGACTCGTTGGGGGAACAGCGG 0: 1
1: 0
2: 0
3: 10
4: 162
963341424_963341432 -2 Left 963341424 3:144039331-144039353 CCTGGAAGACCTGTAACAGCCAT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 963341432 3:144039352-144039374 ATGTGGTCAGGACTCGTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 84
963341424_963341428 -5 Left 963341424 3:144039331-144039353 CCTGGAAGACCTGTAACAGCCAT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 963341428 3:144039349-144039371 GCCATGTGGTCAGGACTCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 87
963341424_963341431 -3 Left 963341424 3:144039331-144039353 CCTGGAAGACCTGTAACAGCCAT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 963341431 3:144039351-144039373 CATGTGGTCAGGACTCGTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 232
963341424_963341430 -4 Left 963341424 3:144039331-144039353 CCTGGAAGACCTGTAACAGCCAT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 963341430 3:144039350-144039372 CCATGTGGTCAGGACTCGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963341424 Original CRISPR ATGGCTGTTACAGGTCTTCC AGG (reversed) Intronic
900156707 1:1206091-1206113 ACGGCTGTTCCAGGTCCTGCTGG - Intronic
901964520 1:12855448-12855470 ATGGCTGGTACCGATCATCCCGG - Intronic
902394016 1:16122629-16122651 ATGGCTGAGTCAGGCCTTCCTGG - Intergenic
915029263 1:152862152-152862174 ATGGCTGTCCCAGGGCATCCAGG + Intergenic
915131484 1:153698232-153698254 ATGGCTTTCCCAGTTCTTCCTGG - Intergenic
915204213 1:154257413-154257435 AGGGCTGTTACATGCCTACCCGG + Exonic
915402293 1:155632238-155632260 AAGGCTGTTACAGGACTTGTCGG - Intergenic
916466275 1:165077257-165077279 ATGGCTGTGACAGATGTTCCTGG - Intergenic
917799381 1:178556474-178556496 AGGGCTCTTACACCTCTTCCAGG - Intergenic
918928917 1:190827262-190827284 TTGGCTGTGACAGGTTCTCCAGG - Intergenic
924027927 1:239856651-239856673 ATGGCTTTTAATTGTCTTCCTGG - Intronic
1065062773 10:21924670-21924692 ATGCCTATAACAGGTTTTCCTGG - Intronic
1071075594 10:81747673-81747695 ATGGAAATTTCAGGTCTTCCTGG - Intergenic
1073459588 10:103659036-103659058 ATGGCTGTTAGAGGTGGCCCAGG - Intronic
1076071307 10:127492202-127492224 AAGCCTGATACAGGTCTTACCGG + Intergenic
1076469098 10:130706116-130706138 ATGGCTGTTCAAGGTCTTGGGGG + Intergenic
1082759165 11:57109793-57109815 CTGGCTGTGCCAGGTTTTCCTGG + Intergenic
1083394303 11:62379205-62379227 AAGGCTGTTACAGGACTTGTCGG - Intronic
1084506783 11:69573345-69573367 ATGGATATTAGAGGGCTTCCTGG + Intergenic
1086851335 11:91812727-91812749 AGGTCTGTTACAGGTTTTCATGG - Intergenic
1086924623 11:92626764-92626786 ATGGCTGTCACAGGGCTGTCAGG + Intronic
1087724139 11:101698648-101698670 AAGGCTGTTACAGGACTTGTCGG + Intronic
1088044233 11:105428212-105428234 ATAGCTGTCACAGGGGTTCCTGG - Intergenic
1094874488 12:34625837-34625859 AAGGCTGTTACAGGACTTGTTGG - Intergenic
1095682935 12:44999836-44999858 ATGGATGTTACAGACCTTCACGG - Intergenic
1095929165 12:47608558-47608580 ATGGATGTTAAAGGTCATTCTGG - Intergenic
1097331042 12:58333308-58333330 AAGGCTGTTACAGGACTTGTCGG - Intergenic
1098662259 12:73110526-73110548 ATTGCTGTTCCAGATCTTTCAGG - Intergenic
1098985070 12:77003458-77003480 ATGACTGTTACAGTATTTCCTGG - Intergenic
1099108955 12:78532629-78532651 ATGGCTGTTAAAGTTCATCTTGG + Intergenic
1100437894 12:94588638-94588660 AAGGCTTTTACAAGTCTTCGTGG + Intronic
1103156569 12:118690048-118690070 TTGGCTGTTTCAGTTCTGCCTGG + Intergenic
1105681104 13:22728484-22728506 GTGACTGTTACAGCTCTTACAGG + Intergenic
1106197180 13:27503910-27503932 CTGGCTTTTACAGGTCTTTACGG - Intergenic
1106599993 13:31179472-31179494 ATGGCTGTCACAGGTATGCCCGG - Intergenic
1108142306 13:47436625-47436647 ATGTCTATAGCAGGTCTTCCTGG - Intergenic
1108979734 13:56495390-56495412 ATAGATGTTACAGTCCTTCCAGG + Intergenic
1111910498 13:94305967-94305989 ATGGTTCTTCCAGGTCTTTCAGG + Exonic
1116831222 14:49721851-49721873 AAGGCTGAAAGAGGTCTTCCAGG - Intronic
1117022005 14:51580318-51580340 ATTGCTGATACTGGACTTCCAGG - Intronic
1120895921 14:89532108-89532130 ATGGCTGTTAATTGCCTTCCAGG + Intronic
1121221443 14:92288455-92288477 GTGGGTGTTCCATGTCTTCCTGG - Intergenic
1121709867 14:96029962-96029984 ATGGATCTTACAGGTTTTCCAGG - Intergenic
1122999344 14:105283964-105283986 TTGTCTGTTTCAGGGCTTCCTGG - Intronic
1125821354 15:42634843-42634865 TTTGTTGTTACAGGTTTTCCAGG + Exonic
1128072604 15:64807132-64807154 ATGGCCCTTGCCGGTCTTCCTGG + Intergenic
1134329372 16:13236419-13236441 GTGGCTGTTTCAGGTCTTGGAGG - Exonic
1138138217 16:54543100-54543122 AGGGCTGTTACAGGCCTTAATGG + Intergenic
1138929989 16:61641655-61641677 GTGGGTGTTTCAGGTTTTCCTGG - Intergenic
1140261940 16:73388189-73388211 ATGGCTGCCACAGGTCTTCTTGG + Intergenic
1143479949 17:7222363-7222385 ATGGCTGTTGCAAGTCACCCTGG + Intronic
1144148839 17:12423831-12423853 CTGGCTGATACAGGTCTACTAGG - Intergenic
1144807457 17:17977394-17977416 AAGGCTGCTCCAGGGCTTCCTGG - Intronic
1147185136 17:38709225-38709247 ATGGCGGTTACAGGTCATGCAGG - Exonic
1149519200 17:57305479-57305501 CTGGCTGCTAGAGGTCTTGCTGG - Intronic
1151453252 17:74212164-74212186 ATGGCTGTTTCCAGCCTTCCGGG + Intergenic
1152009162 17:77700326-77700348 AGGGCACTGACAGGTCTTCCTGG + Intergenic
1152567394 17:81106421-81106443 CTGGCTGTCCCAGGTCCTCCAGG + Intronic
1153780928 18:8494498-8494520 ATGGCTGTAACAGGTGCTTCTGG + Intergenic
1155030740 18:21981382-21981404 CTGGATGTTACAGATTTTCCTGG + Intergenic
1157194695 18:45611191-45611213 ATGACTATTAAAGGTATTCCTGG - Intronic
1159118661 18:64144460-64144482 ATGTCTGATACAGGTCTCACTGG - Intergenic
1160117163 18:76090194-76090216 AAGACTGTTCTAGGTCTTCCAGG - Intergenic
1160404012 18:78632112-78632134 ATGGGTGTCACAGGCCTCCCTGG + Intergenic
1163311310 19:16516625-16516647 ATCGCTTTCACAGGGCTTCCAGG - Intronic
1164370933 19:27643813-27643835 AAGGCTGTTACAGGACTTGTCGG - Intergenic
1164740362 19:30571320-30571342 ATGGCTTTTGCAGGTCTGCTCGG + Intronic
1164955627 19:32381093-32381115 ATGGTTTTTACATGTCTTTCAGG - Intronic
1165606758 19:37112466-37112488 AAGGCTGTTACAGGACTTGTCGG - Intronic
1165781033 19:38434427-38434449 ATGGCTGCTAATGGTCTTGCAGG + Intronic
1165895195 19:39137068-39137090 GTGGCTGCTTCAGGTGTTCCTGG + Intronic
926155247 2:10449799-10449821 ATGGATGATCCAGCTCTTCCTGG + Intergenic
928255268 2:29716808-29716830 ATGAGCGTCACAGGTCTTCCAGG - Intronic
929385816 2:41404852-41404874 ATGAATGTTCCAGGCCTTCCTGG - Intergenic
931147058 2:59530604-59530626 ATGGCTGTTTCCTTTCTTCCTGG - Intergenic
933708577 2:85309077-85309099 AGGGCTGTCACAGGGCTTCTCGG - Exonic
938722623 2:134079870-134079892 AAGGCTGATACAGGTCTCACTGG + Intergenic
941624872 2:167820475-167820497 ATTGCTGTTGCAGGACTCCCTGG + Intergenic
942957408 2:181789281-181789303 AGAGCTCTTACAGGTTTTCCAGG - Intergenic
945627552 2:212229670-212229692 AGGGCTGTTACAGCTTATCCAGG + Intronic
1168959350 20:1858000-1858022 TTGGGTCTTACAGGCCTTCCCGG - Intergenic
1175710321 20:61215340-61215362 ATGGTTGTAACAGGTGTTACTGG - Intergenic
1176045548 20:63090901-63090923 ATGGCTGGCACAGGGGTTCCTGG - Intergenic
1178039990 21:28629671-28629693 ATGGCAGCTACAGTTATTCCTGG - Intergenic
1180838146 22:18942259-18942281 AAGGCTGTTACAGGACTTGTCGG + Intergenic
1182683682 22:32103561-32103583 ATGGGTGGTACAGGGCTACCTGG + Intronic
1183773547 22:39947430-39947452 AGGGCTGTTACAGATGTTCTTGG + Intronic
1184374494 22:44103136-44103158 CTGGCTGCTGCATGTCTTCCAGG + Intronic
949217144 3:1583561-1583583 TGGGCTGTTCCAGGTGTTCCAGG - Intergenic
949944547 3:9179658-9179680 ATGGGTATAACAGCTCTTCCAGG + Intronic
950030677 3:9850993-9851015 AAGGCTGTTACAGGACTTGTCGG - Intronic
951681451 3:25298909-25298931 ATGGGTATTTCAGGTATTCCAGG - Intronic
952223357 3:31347910-31347932 TTGTGTGTTAGAGGTCTTCCTGG - Intergenic
957402717 3:79737034-79737056 ATGGCTCTTACAGTACATCCAGG + Intronic
957624942 3:82644399-82644421 ATGGCTGTGAGAGGTGTTTCAGG + Intergenic
957918155 3:86713234-86713256 AAGACTGTTAAAGGTATTCCAGG + Intergenic
960027928 3:113029837-113029859 AAGGCTGTTACAGGACTTGTCGG - Intergenic
960169532 3:114442464-114442486 CTTGCTGTTACTGGTGTTCCTGG - Intronic
960598307 3:119428734-119428756 CTGGCCGTTACAGGTGTTCTTGG + Intergenic
961297111 3:125893879-125893901 AAGGCTGTTACAGGACTTGTTGG + Intergenic
962683777 3:137826608-137826630 ATGGCTGTTTCTGATTTTCCTGG + Intergenic
963341424 3:144039331-144039353 ATGGCTGTTACAGGTCTTCCAGG - Intronic
963695798 3:148564970-148564992 AAGGCTGTTACAGGACTTGTCGG - Intergenic
965561110 3:170063098-170063120 ATGGATGTTACAGGTTTCCAAGG + Intronic
967026358 3:185568117-185568139 AAGGCTGTTACAGGACTTGTCGG - Intergenic
967775421 3:193381369-193381391 ATGTCTGTTGCAGACCTTCCAGG - Intergenic
969610625 4:8225859-8225881 AAGGCTGTTGTAGGTTTTCCTGG + Intronic
971043732 4:22782148-22782170 ATTGTTGTTAAAGGTCTGCCTGG - Intergenic
974116882 4:57589909-57589931 ATGGATGTTACAGGCCATTCTGG + Intergenic
976051068 4:81012180-81012202 GTGGATGTCAGAGGTCTTCCTGG + Intergenic
981719431 4:147786745-147786767 ATAGCTTTAACAGGTCTTACAGG - Intronic
987023563 5:13900022-13900044 CAGGCCGTTACAGGTCTTGCAGG - Intronic
988380506 5:30492505-30492527 AAGGCTGTTACAGGACTTGTCGG - Intergenic
989344314 5:40412003-40412025 AAGTCTGATACAGGTCTTACTGG - Intergenic
991357260 5:65781887-65781909 CTGGGTGATACAGTTCTTCCTGG + Intronic
995217802 5:109615084-109615106 ATGTCTATTCGAGGTCTTCCAGG - Intergenic
995292226 5:110469980-110470002 ATGGCTGTTGCTGGGGTTCCGGG - Intronic
999952202 5:156663278-156663300 AAGGCTGTTACAGGACTTGTCGG - Intronic
1000608991 5:163354972-163354994 ATGGTTGTTAAGGTTCTTCCTGG - Intergenic
1004082537 6:12408613-12408635 ATGGTTGTTACAAGTGTTCCTGG + Intergenic
1005162826 6:22884152-22884174 ATGGGGGTTACAGGTCTGCAGGG - Intergenic
1005659945 6:27987234-27987256 ATGGCTGTTACAGCTTATCTGGG + Intergenic
1007599747 6:43074609-43074631 TTGTCTGTTTCAGGTCTCCCGGG + Exonic
1009033996 6:58094167-58094189 AGTGCTGTTTCTGGTCTTCCTGG - Intergenic
1010591982 6:77722767-77722789 AAGGCTGTTACAGGACTTGTCGG - Intronic
1012124629 6:95412472-95412494 ATTGCACTTACAGGTCTTGCTGG + Intergenic
1015873489 6:137800228-137800250 AAGGCTGTTACAGTACTTTCAGG + Intergenic
1017748634 6:157469573-157469595 GTGGCTGTTGCAGGTCAGCCTGG + Intronic
1019976657 7:4588290-4588312 AAGGCTGTTACAGGACTTGTCGG - Intergenic
1019977593 7:4596794-4596816 AAGGCTGTTACAGGACTTGTCGG - Intergenic
1022567460 7:31417353-31417375 AAGGCTGTTAAAAGTATTCCTGG + Intergenic
1022642996 7:32205799-32205821 ATGACTGTTACAGCTCTTAAAGG - Intronic
1023150516 7:37197411-37197433 ATGTCTGTTTCACGTCTGCCGGG - Intronic
1024183893 7:46928168-46928190 TGGGCTGTTACAAGGCTTCCAGG - Intergenic
1028012984 7:85672669-85672691 ATGAGTGTTACAGGTCTTAAAGG - Intergenic
1029966947 7:104750181-104750203 AAGGCTGTTACAGGACTTGTCGG - Intronic
1031638067 7:124126380-124126402 ATGGATTTTACAGTTCTTCTAGG - Intergenic
1032462607 7:132122945-132122967 ATCTCTGCTTCAGGTCTTCCTGG - Intergenic
1033230001 7:139589146-139589168 ATGGATGTTACAGGTTATCCAGG - Intronic
1033482177 7:141753382-141753404 AAGGCTGTTACAGGACTTCTCGG - Intronic
1035945760 8:3959918-3959940 ATGGCTAGTACAGGGCTTCAGGG - Intronic
1039148990 8:34481782-34481804 ATGGCTGAAACAGTTCTTGCTGG - Intergenic
1041774329 8:61507877-61507899 AAGGCTGTAACAGTACTTCCAGG - Intronic
1043289499 8:78579514-78579536 AGGAATCTTACAGGTCTTCCAGG - Intronic
1044153322 8:88810551-88810573 ATTGATGTTTCATGTCTTCCAGG - Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1046097375 8:109577676-109577698 ATGGCTGTTTCAGGAGTTCAGGG - Intronic
1052741238 9:32394946-32394968 CTGGCTGTCAGAGGTCTTCTGGG - Intronic
1053354104 9:37432023-37432045 AGGCCTGGTACAGGTCGTCCTGG - Exonic
1062277582 9:135738021-135738043 CTGGCTGTAGCAGGGCTTCCAGG - Intronic
1187036372 X:15544621-15544643 AGGGCTGGTACATGGCTTCCAGG - Intronic
1187044688 X:15635113-15635135 CTGGCTGGTACAGGTTTTCAAGG + Intronic
1190518865 X:51255904-51255926 ATGGCTTTTAGAGCTTTTCCAGG - Intergenic
1192339350 X:70250019-70250041 AGGGCCCTGACAGGTCTTCCTGG + Intergenic
1193079973 X:77397250-77397272 AAGTCTGACACAGGTCTTCCTGG + Intergenic
1195794269 X:108626320-108626342 ATTGGTCTTCCAGGTCTTCCTGG + Exonic
1199085297 X:143621513-143621535 ATGGCAGATACATGGCTTCCTGG + Intergenic
1201594224 Y:15649782-15649804 ATAGCTCTCACAGATCTTCCTGG + Intergenic