ID: 963342139

View in Genome Browser
Species Human (GRCh38)
Location 3:144049174-144049196
Sequence ATATTCCTTTAGAAGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963342139 Original CRISPR ATATTCCTTTAGAAGAACAA AGG Intergenic
900874074 1:5329016-5329038 ATATTTTTTAAGAAGAAAAATGG - Intergenic
906780228 1:48566763-48566785 ATGTTACTTTTCAAGAACAAAGG - Intronic
908086090 1:60635890-60635912 TTTTTCCTTTAGAAGGAAAATGG - Intergenic
908232568 1:62120558-62120580 ATATTCATTTAAATGAATAAAGG + Intronic
908994619 1:70136513-70136535 AAATTCTATTATAAGAACAATGG + Intronic
910116394 1:83736672-83736694 ATATTTCTTTGGAAAAACTAAGG - Intergenic
910768586 1:90808032-90808054 ATATTCCTGTATGAGGACAATGG + Intergenic
912156099 1:106922261-106922283 TTTGTCCTTAAGAAGAACAATGG - Intergenic
912578817 1:110701807-110701829 ATTTTGCTTTGCAAGAACAACGG - Intergenic
912738318 1:112169954-112169976 ATATTCAATTTGAAGAACATGGG - Intergenic
913043113 1:115048846-115048868 AAATTTTTCTAGAAGAACAAAGG - Exonic
915115193 1:153594015-153594037 ATGTTCCTATAAAGGAACAAGGG + Intergenic
918364852 1:183796913-183796935 ATATTTCTGTAAAAGAAAAAAGG - Intronic
919409119 1:197222082-197222104 ATATTCCTTTAGGCGATGAAAGG + Intergenic
921511683 1:216038866-216038888 ATATTCAGTTAGAAAAGCAATGG - Intronic
923340270 1:233000832-233000854 ATATTCCACTAGAAGAAAGATGG - Intronic
923446817 1:234078980-234079002 AAATTCATATAGAAAAACAAGGG + Intronic
923928488 1:238664108-238664130 TGATCCCTTTAGAAGAACTACGG - Intergenic
924204768 1:241700337-241700359 ATACTACTTTAGAAGAGAAATGG - Intronic
924354685 1:243159478-243159500 AATTTTCTTTAGAAGAAAAAAGG - Intronic
924754116 1:246926255-246926277 ATATTCCTTTATAGCAACACAGG + Intronic
1063697310 10:8349223-8349245 ATATTCCTTTAAAAGAGAATTGG + Intergenic
1064394209 10:14968182-14968204 AAATTCCTTTAAAAGTACATAGG + Intronic
1064644052 10:17442400-17442422 ACAATCCTTTTGAAGAAAAATGG - Intronic
1065260318 10:23917045-23917067 ATATTCTATAAGAAGAAAAAAGG - Intronic
1065665698 10:28057749-28057771 ATCTTCCTTTAGAGGTCCAAAGG + Intronic
1066056412 10:31685235-31685257 GAATACCTTTAGAAGGACAAAGG - Intergenic
1068049453 10:51930798-51930820 ACATTCTTTTAGAAAAAGAAAGG + Intronic
1069058553 10:63869853-63869875 AAATTTTTTTAGAGGAACAATGG - Intergenic
1069072910 10:64008091-64008113 ATATTCCCCAAGAAGAACCAGGG + Intergenic
1069968351 10:72141918-72141940 AAATTTTTTTAGAAGACCAATGG - Intronic
1070047403 10:72852359-72852381 CTATTCCTTTGGAAGGAAAAAGG + Intronic
1070462087 10:76680499-76680521 ATATTCCCATAGGTGAACAAGGG + Intergenic
1071223890 10:83502978-83503000 AAATTTGTTTAGAAGTACAAAGG + Intergenic
1071700109 10:87922284-87922306 GTAATCTTTTAGAAGAAGAAAGG - Intronic
1072602926 10:96947736-96947758 ATAGTCCTTTAAAAAAAAAAAGG - Intronic
1074573714 10:114648968-114648990 ATATTACATGAGAAGACCAAAGG - Intronic
1076080362 10:127575097-127575119 ATAATGCTTGAGAAGATCAAAGG - Intergenic
1076172875 10:128337501-128337523 ATTTTCTCTTAGTAGAACAAAGG - Intergenic
1078695900 11:13631280-13631302 AAATTCATATAGAAGAGCAAGGG - Intergenic
1079292966 11:19204946-19204968 TTATTTTTTTAGGAGAACAAAGG + Intronic
1080151031 11:29052108-29052130 CTAACACTTTAGAAGAACAAGGG + Intergenic
1080439838 11:32282573-32282595 ATATTCAATTGGAAGAACCAGGG - Intergenic
1081031312 11:38087462-38087484 AGCTTCCTTAAGAACAACAAGGG - Intergenic
1081177857 11:39951045-39951067 ATAGTCTATTAGAAGAATAAAGG - Intergenic
1081840476 11:46197443-46197465 ATGTACCTTTAAAAGAAAAAAGG - Intergenic
1082815984 11:57509576-57509598 AGATTCCGTCAGAAGGACAAAGG + Intronic
1085417854 11:76331112-76331134 TTATTGCTTTACAAAAACAAGGG - Intergenic
1085721258 11:78914272-78914294 AAATTCCCTGAGAGGAACAAGGG - Intronic
1085776633 11:79372408-79372430 CTGTTCCTTTAGAAGAACCAGGG + Intronic
1086052377 11:82608726-82608748 ATCTTCCTTTAGAAGTAAATAGG + Intergenic
1086075496 11:82846738-82846760 GTAATTATTTAGAAGAACAAAGG + Intronic
1086589160 11:88491738-88491760 ATAGTCCTTTATAATTACAAAGG + Intergenic
1087458452 11:98416918-98416940 ATATTTTTTAAGAAGAACTATGG + Intergenic
1087586621 11:100130155-100130177 ATATTCTTTAAGAAAGACAAAGG + Intronic
1088161412 11:106875962-106875984 ATATTCCATTACAAGTAAAAAGG + Intronic
1089807537 11:121104895-121104917 ATATTCATTCAGGAGAAGAAAGG + Intronic
1090216669 11:124972964-124972986 ATATTACTTTATAAGAAAAAAGG - Intronic
1091576265 12:1738835-1738857 ATATTTCCTTTGAAGAACAAAGG + Intronic
1091827492 12:3523833-3523855 ATATTCCCTATGGAGAACAAGGG - Intronic
1093306166 12:17523242-17523264 ATTTTCCTTTACAAGACCAAGGG - Intergenic
1093327831 12:17801653-17801675 ATACTATTTTAGCAGAACAAAGG + Intergenic
1093725989 12:22509251-22509273 CTATTTCTTTAGAAGGAAAAAGG - Intronic
1094885160 12:34859652-34859674 ACTTTCCTTTAGAAGAGCAGAGG + Intergenic
1094909319 12:35250953-35250975 ACTTTCCTTTAGAAGAGCAGAGG + Intergenic
1095516083 12:43007056-43007078 ATAATTATCTAGAAGAACAATGG - Intergenic
1095534155 12:43225748-43225770 ATATTCCTCTAAAAGACCATGGG + Intergenic
1095656448 12:44675010-44675032 CTTTTCCTTTAAAAGGACAAAGG + Intronic
1097557948 12:61164066-61164088 AAATTCATTCAGAAGAACAGAGG + Intergenic
1097720614 12:63016356-63016378 TTATTCCTTTAGTTGAATAATGG + Intergenic
1098559393 12:71854837-71854859 ATATACCTTGAGAAAAAGAAAGG - Intronic
1099836874 12:87917667-87917689 ATATCCCTTTGGAAAAATAATGG + Intergenic
1100112923 12:91267664-91267686 AGATTTCTTTAGAAGAAGACAGG + Intergenic
1100500469 12:95169381-95169403 ATAGTCCTTTAAAAAAAAAAAGG + Intronic
1101188071 12:102302417-102302439 AAAATCTTTTAGAAGAAGAAAGG + Intergenic
1101408051 12:104446179-104446201 AAATGCATTTAGAAAAACAAAGG + Intergenic
1101443547 12:104721024-104721046 GTCTTCCTTTAGAAAAACCAAGG - Intronic
1101493752 12:105235009-105235031 TTATTCACTTAGAAGAAAAAGGG + Intronic
1101724780 12:107379783-107379805 AGAGCCCTCTAGAAGAACAAGGG + Intronic
1102748130 12:115267963-115267985 GAATTCCCTTAGAAGACCAAAGG + Intergenic
1103111621 12:118285029-118285051 ATATTCCCATAGAAAGACAAGGG - Intronic
1103543535 12:121683201-121683223 ATTTTCCTTTGGAAAAATAAGGG - Intergenic
1103658453 12:122493917-122493939 AGATTCCTTTAGAAAAATACAGG - Intronic
1108219952 13:48223430-48223452 ATATACCTTTGGAAGGCCAAGGG - Intergenic
1108305982 13:49133379-49133401 ATATCCCTACAGAATAACAAGGG - Intronic
1110376580 13:74801421-74801443 AAATTGATTTAGAAGAAAAATGG - Intergenic
1111675884 13:91388171-91388193 ATATTCCTCTCTAAGAAAAAAGG - Intergenic
1113194479 13:107786051-107786073 AGTTTCTTTTAGAAGAGCAAAGG + Intronic
1113847042 13:113398164-113398186 ATCTTCTCCTAGAAGAACAAAGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114128638 14:19762147-19762169 ATATTCCTTTTGAAGCCCAGTGG + Intronic
1114130940 14:19791456-19791478 ATATTGCTTTAGTGGAACATAGG + Intronic
1114541208 14:23460836-23460858 ATGTTACCTTATAAGAACAAAGG + Intergenic
1115016855 14:28626990-28627012 ACATTCATATAGAAGAGCAAAGG - Intergenic
1115582156 14:34771809-34771831 AGATTCATTTAGAAGGACTAAGG + Intronic
1116030536 14:39565919-39565941 AGTTTCCTTTGGAAGAATAAAGG + Intergenic
1116973232 14:51090450-51090472 ATTTTCATTTATAAAAACAAAGG + Intronic
1117394620 14:55296858-55296880 ATATTTTTTTAGAAGACAAATGG - Intronic
1119915260 14:78393898-78393920 GTATTCCTCTATATGAACAATGG - Intronic
1120415958 14:84218278-84218300 ATCATCCTTTAGAAAATCAAGGG - Intergenic
1120444190 14:84572926-84572948 GTATTCGTTCAGAAGAACAAAGG + Intergenic
1120904141 14:89604948-89604970 AGATTCCATTTTAAGAACAAGGG + Intronic
1121381414 14:93472188-93472210 AAATTCCTCTAGAATCACAATGG - Intronic
1121574943 14:94976624-94976646 ATATATCTTTTTAAGAACAAAGG - Intergenic
1123571578 15:21616389-21616411 ATATTCCTTTTGAAGCCCAGTGG + Intergenic
1123608195 15:22058980-22059002 ATATTCCTTTTGAAGCCCAGTGG + Intergenic
1123886804 15:24734714-24734736 ACATTCCTTTGGAGGAACCAGGG + Intergenic
1126128492 15:45317501-45317523 ATTTTCTTTTAGTAGGACAAGGG - Intergenic
1126405993 15:48323151-48323173 ACATTTATTTGGAAGAACAATGG - Intergenic
1126665501 15:51072908-51072930 AAATTCCTATGGAAGAATAAAGG - Intronic
1126925156 15:53577061-53577083 CTAGTCTTTTGGAAGAACAATGG - Intronic
1128420961 15:67491315-67491337 ATAATGCTTTGGTAGAACAAAGG - Intronic
1128502838 15:68240674-68240696 AGATTCCTTTAAAAAAAAAAGGG + Intronic
1128604275 15:69025077-69025099 ATATTTCCTTCTAAGAACAATGG - Intronic
1130203748 15:81856512-81856534 ATATTCCTTGAAAAAAAAAAAGG - Intergenic
1130218069 15:81991680-81991702 AAATACCTTTATAAGAACTAAGG + Intergenic
1130431613 15:83853232-83853254 ATAATCATTTAGAAAAATAATGG - Intronic
1130815801 15:87431089-87431111 ATAATTTTTTAAAAGAACAAAGG + Intergenic
1132290474 15:100698439-100698461 GTATTTCTTTAGAAAAACAATGG + Intergenic
1202980432 15_KI270727v1_random:350778-350800 ATATTCCTTTTGAAGCCCAGTGG + Intergenic
1133621033 16:7526511-7526533 ATAGTTGTTTAGAAGAAAAAAGG - Intronic
1135119644 16:19754719-19754741 ATATCCTTTTAAAAGTACAAGGG + Intronic
1139380520 16:66527725-66527747 GTAGTCCTTAAGAATAACAAGGG + Intronic
1139599370 16:67977344-67977366 TTATCCCTCTAGAAGAAGAACGG - Exonic
1139694725 16:68666004-68666026 ATATTCCTTTGAAAAGACAAAGG - Intronic
1140320360 16:73945138-73945160 AAATTACTTCAGAGGAACAAAGG + Intergenic
1141080154 16:81043676-81043698 CTAATCCTTTACAAGAACTAGGG + Exonic
1144122028 17:12164713-12164735 ATAATCCTGAAAAAGAACAAAGG - Intergenic
1144217201 17:13066950-13066972 ATATTCTTTGAGAATGACAATGG + Intergenic
1145412263 17:22678495-22678517 ACATTCCTTTTGTAGAATAAAGG - Intergenic
1145919816 17:28602133-28602155 ATATTTCTTTAGTAGAAACAGGG + Intronic
1146079706 17:29767732-29767754 ATACTCCTTTAAAAGAATGAGGG - Intronic
1148540813 17:48479007-48479029 ATATTCCCTGAGAAGAAGAGGGG - Intergenic
1148947686 17:51279008-51279030 ATTTTCCTGTAGTGGAACAAGGG + Intronic
1149016353 17:51913156-51913178 ATATCTCTTTAGAATCACAAGGG + Intronic
1149404019 17:56328767-56328789 ATGTTCCTTTAAAAAAAAAAGGG + Intronic
1149627343 17:58089125-58089147 AAATTCCTAAAAAAGAACAAAGG - Exonic
1153384987 18:4482801-4482823 ATATTCCTTTAAGATAAAAAAGG + Intergenic
1155608774 18:27638639-27638661 ATAATCTTTGAGAAGACCAAAGG - Intergenic
1155769717 18:29681368-29681390 GTATTCCTTTACAAAAGCAATGG + Intergenic
1156299517 18:35824004-35824026 AAATTCCTGTGGAAGAGCAAAGG + Intergenic
1157293110 18:46423997-46424019 ATATTCCCTTCTAAGAACAAAGG + Intronic
1158023803 18:52872105-52872127 ATATTCATTTACAGGAACATGGG + Intronic
1158163034 18:54507585-54507607 ATGTTCCTTGAGGAGCACAAAGG + Intergenic
1158354668 18:56604634-56604656 ATATTAATATAGAAGATCAATGG - Intronic
1158783137 18:60676334-60676356 ATATTACTGTGGAAGAACATAGG - Intergenic
1158906019 18:62012576-62012598 TTATTTCTTTGGAAGAACCATGG - Intergenic
1158947058 18:62456406-62456428 ATATTCCTTTTTAAGAAAATAGG + Intergenic
1159396598 18:67865811-67865833 ATATTTCTAGAGAAGATCAAGGG - Intergenic
1159485394 18:69049522-69049544 ATATTCAATTGGAAGAATAAAGG + Intronic
1160045829 18:75386578-75386600 ATTTTCCTTAAGAAGAAATATGG - Intergenic
1161756897 19:6140505-6140527 ATATTCTTTTAGTAGAAACAAGG - Intronic
1162253014 19:9462380-9462402 GTATTCTTTAAGGAGAACAAAGG - Intergenic
1162448497 19:10739207-10739229 ATGTCCCCATAGAAGAACAAGGG - Intronic
1164810553 19:31151574-31151596 AAATTCCATAAGGAGAACAAAGG + Intergenic
1165054695 19:33167275-33167297 ATATTACATTAATAGAACAAAGG + Intronic
925485054 2:4319416-4319438 TAATTCCTGTAGAACAACAATGG + Intergenic
925711196 2:6742539-6742561 ATATTTGTTTAGAAGAACTGAGG - Intergenic
926950623 2:18239167-18239189 AATTGGCTTTAGAAGAACAATGG + Intronic
927358563 2:22204702-22204724 ATATAGCTTTAGAGGAACTATGG + Intergenic
928311616 2:30215376-30215398 AAATTCCCTTGGAAGCACAAAGG + Intergenic
928369198 2:30728339-30728361 ATATTTCTTTAAAAGAAGATGGG + Intronic
928625777 2:33138541-33138563 AGAATCCTTTAAAACAACAACGG - Intronic
929212045 2:39367913-39367935 ATATTCCTTTAAAATAAGAAAGG - Intronic
930436651 2:51352683-51352705 ATATTTCTTTAAAAGACCAATGG + Intergenic
930854241 2:55995424-55995446 ATATTTCTTTATAATGACAATGG + Intergenic
931284872 2:60823624-60823646 ATGTTCCTTGAGAAGCACAATGG + Intergenic
931506611 2:62934743-62934765 ATATCCCTATTGAAAAACAAAGG - Intronic
931754567 2:65361052-65361074 AAATTCTTTTAAAAGAAAAAAGG + Intronic
931967292 2:67547788-67547810 ACATTCCATCAAAAGAACAAGGG + Intergenic
932040184 2:68291292-68291314 ATACTCCTTTAAAAAAAAAAGGG - Intronic
933114566 2:78451939-78451961 ATATTTGTTCTGAAGAACAAAGG + Intergenic
933365195 2:81344734-81344756 ATTTTCATGTAGAAAAACAAAGG - Intergenic
936393938 2:112104127-112104149 TTATTCTTCTAGAAGAAAAAAGG + Intronic
938149770 2:128872079-128872101 AAATTTCTTTAGAAGATCCAGGG + Intergenic
938842431 2:135175970-135175992 ATCTTTCTGTACAAGAACAATGG - Intronic
939932327 2:148251094-148251116 ATATTCTTTTAAAATAAAAAAGG + Intronic
941045507 2:160671231-160671253 ATATTCCTTTATAATAACCTGGG + Intergenic
941113028 2:161438400-161438422 AAAATCCTTTGGAAGCACAAGGG + Intronic
941338779 2:164279346-164279368 AAATTCCTTTGGAACCACAAAGG - Intergenic
942431712 2:175918625-175918647 ATATTCCTTTAGATGACCACTGG + Intergenic
942447488 2:176087815-176087837 TTACTCCTTTAGAACAAAAAGGG - Intergenic
942874605 2:180779656-180779678 ATATTCCCAAAGAAGAGCAAGGG + Intergenic
945335793 2:208591527-208591549 ACATACCTTTAAATGAACAAAGG + Intronic
947376177 2:229498146-229498168 ATATTACTTTAAAAGAATGAAGG + Intronic
948317056 2:237036009-237036031 TTATTTATTTAAAAGAACAAAGG - Intergenic
1168886436 20:1262268-1262290 ATATTCCTTTACAATATAAAGGG - Intronic
1169124415 20:3116729-3116751 ATAGTCTTTTAGAAGAACATAGG + Intronic
1169629641 20:7615832-7615854 ATATTTATTTGGAAAAACAAAGG + Intergenic
1170966464 20:21076675-21076697 ATATTCCTCTTGAACAACATTGG + Intergenic
1171052177 20:21870337-21870359 ATATTACTTTATAAGCAAAAGGG + Intergenic
1173605535 20:44328340-44328362 ACCTTCCTGTAGAAGAACTACGG - Intergenic
1174008535 20:47429624-47429646 ATATTGCTTAAGAACAACAAAGG - Intergenic
1174937489 20:54886982-54887004 ATATTGATATAGAAGACCAATGG - Intergenic
1175675484 20:60943061-60943083 ATATTCCTTTGGAAGTTTAAAGG + Intergenic
1178268696 21:31168987-31169009 ATATTTTTTTAAAAGAAGAAAGG + Intronic
1178347369 21:31841938-31841960 AGGTACCTTTAGAAAAACAAGGG - Intergenic
1179262322 21:39768775-39768797 ATATTCCCTTGGAATAAGAAAGG - Intronic
1182173339 22:28255854-28255876 ATAGTCATTTAGAAGAGCAAAGG - Intronic
1184873215 22:47254718-47254740 ATATTCCTCTAGGAGAGCAAGGG + Intergenic
952611124 3:35211017-35211039 ATATTTCTTTAGATAATCAAGGG - Intergenic
952875835 3:37943578-37943600 AAATTACTTTGGAAGAGCAAAGG - Intronic
954888065 3:53894163-53894185 ATGTTCCTCTCGAATAACAAAGG + Intergenic
955006483 3:54973482-54973504 CTATTCCTTTGGAACAAGAAAGG - Intronic
955422583 3:58753550-58753572 ATTAACCTTTAGAAGAACAAGGG + Intronic
955953577 3:64266246-64266268 ATCTGCCTTCAGAAGAAGAACGG + Intronic
956047076 3:65207209-65207231 ATCTTCCTTTAGACAAAGAAAGG - Intergenic
956253345 3:67257464-67257486 ATATTGATTAAGAAGAACAAAGG - Intergenic
956768535 3:72505129-72505151 TTATTGCTTTAGAACAAGAAGGG - Intergenic
956955683 3:74336698-74336720 ATATTCATTTGGAAAAAAAATGG - Intronic
958923230 3:100129383-100129405 ATTTTTCTTTAAAAGAGCAAAGG - Intronic
958979652 3:100706534-100706556 ATATGTCCTCAGAAGAACAAAGG - Intergenic
961268456 3:125668799-125668821 ATATTCCTTTAAGAGCTCAATGG + Intergenic
961853419 3:129844840-129844862 ATATTTCTTTGGAATAACAAAGG - Intronic
963342139 3:144049174-144049196 ATATTCCTTTAGAAGAACAAAGG + Intergenic
963655481 3:148043672-148043694 ATATTCCATTTAAAAAACAAAGG - Intergenic
963951603 3:151208300-151208322 GTATTCCTTTAGAAAGATAATGG + Intronic
963991750 3:151664331-151664353 ATATGCCTTTGAAAGAAAAAGGG - Intergenic
964056172 3:152460663-152460685 ATATTCCTATGGATGAAAAATGG - Intronic
964698330 3:159535292-159535314 ATATACCTGTAGAAGAATGATGG - Intronic
964893124 3:161560359-161560381 ATTTGCGTTTTGAAGAACAAAGG + Intergenic
965414614 3:168377303-168377325 ACATTCCTTTAGATGTGCAAAGG - Intergenic
965489181 3:169315729-169315751 GTATTCCTTTGTAATAACAAAGG + Intronic
966083704 3:176039861-176039883 AACTTCTTTTAGAAGAACATAGG - Intergenic
967313080 3:188124936-188124958 CTACTCCTTTAGAAAAAGAAGGG + Intergenic
968987303 4:3883080-3883102 CTATTCCCTAAGAACAACAAAGG - Intergenic
969891884 4:10267471-10267493 GTATTCCTTTATGAGTACAAGGG + Intergenic
970167326 4:13252687-13252709 ATATTCCTTAACAAGATAAATGG + Intergenic
970466782 4:16331944-16331966 ATATTCCTTTAGAGGTGCTAGGG - Intergenic
970656555 4:18236894-18236916 ACAATCCTGAAGAAGAACAATGG + Intergenic
971108353 4:23552735-23552757 ATATTTCTATAGAATAAAAAGGG + Intergenic
972185556 4:36523648-36523670 ATAATTCTTTCTAAGAACAAGGG - Intergenic
972310308 4:37875920-37875942 ATATTCCTAAAGAAGAGTAAAGG + Intergenic
972845606 4:42985131-42985153 AAATACCTTCAGAAGAACTAAGG - Intronic
974104502 4:57454280-57454302 AAATACCTTTACAAGAACAGAGG - Intergenic
976995525 4:91427704-91427726 ATATTATTTTATAAGAATAATGG - Intronic
977065603 4:92310259-92310281 ATATTTCATTATAAGAATAATGG + Intronic
977342721 4:95779628-95779650 GTATTCATTTAGAAAATCAATGG - Intergenic
977380237 4:96263812-96263834 ATATTCCTTTAGCAGAGCTATGG + Intergenic
977418028 4:96760169-96760191 ATATTCCATTAGCAGAATGAAGG - Intergenic
978321252 4:107498386-107498408 ATATTGTTTTAGAAGAAGCAAGG - Intergenic
978423671 4:108560475-108560497 ATATTTCCTTAGAAAAACCAAGG + Intergenic
978475618 4:109125931-109125953 AGTTTCCTTCAGAACAACAAAGG - Intronic
979621915 4:122807711-122807733 ATATATCTTTAAAGGAACAAAGG - Intergenic
980074262 4:128277489-128277511 ATATCCCTTTAGAAACACTAAGG - Intronic
983426992 4:167597809-167597831 TTATTCAGATAGAAGAACAAAGG + Intergenic
984052436 4:174881853-174881875 ATAGTCCTTCACAGGAACAAGGG - Intronic
986312310 5:6560857-6560879 AAATTCATTTGGAACAACAAAGG + Intergenic
987023921 5:13904577-13904599 ATATCTCTTTAAAAGAGCAATGG - Intronic
987105914 5:14639097-14639119 ATATTCCTTGAAAAAAAAAATGG - Intergenic
987552031 5:19395752-19395774 ACATGCATTTAGAAGAACACCGG + Intergenic
988709055 5:33755291-33755313 ATATTGCTTTAGGAGAAATATGG + Intronic
988991207 5:36672553-36672575 AATTTCCTTCAGAAGATCAATGG - Intronic
989497656 5:42127510-42127532 ATTTTTCTTTAAAACAACAATGG - Intergenic
989514550 5:42326837-42326859 ATATTCCTTTATGAGAATAAAGG - Intergenic
989801835 5:45551932-45551954 ATATTCTTTTATAAAACCAATGG - Intronic
991908219 5:71534189-71534211 ATCATCTTTTAGAAGAAAAATGG - Intronic
992426332 5:76661885-76661907 ATATCCCTTTATCAGAGCAAGGG + Intronic
993023687 5:82622664-82622686 ATATTCCTTTAAGGAAACAATGG + Intergenic
993351963 5:86861352-86861374 ATGCTAGTTTAGAAGAACAAAGG - Intergenic
994952486 5:106482169-106482191 CTATTTCTCTAGAAAAACAAAGG + Intergenic
997175354 5:131770431-131770453 ATGTTCTTTTAGAAAAACCAAGG + Intronic
998025075 5:138809740-138809762 ATGTTCCTTTAAAAAAAAAAGGG - Intronic
1000987885 5:167880806-167880828 ATGGTCCTTTATAAGAACTAAGG - Intronic
1003359546 6:5411601-5411623 ATTTTGCTTTTCAAGAACAAAGG - Intronic
1003424184 6:5986103-5986125 TAATTCCTTTAGAAAAACCATGG - Intergenic
1003632127 6:7796480-7796502 ATATTCCTATAGATGAGGAAGGG - Intronic
1007648266 6:43399375-43399397 ATATTCCCTTTGGAGAACAAGGG - Intergenic
1007652896 6:43434166-43434188 CTATTCCTGTAGAAGTACACAGG - Intronic
1008154585 6:47997971-47997993 ATTTTTCTTCAGAAAAACAATGG + Intronic
1009578700 6:65502786-65502808 ATATTACTTTTGTACAACAATGG - Intronic
1009834852 6:68986507-68986529 ATATTCATTTACCAGAACTAAGG + Intronic
1009969672 6:70613670-70613692 ATACTCCTTTTAAAGACCAAGGG + Intergenic
1010267565 6:73884192-73884214 ACATTTCTTTAGAAGAAAATAGG + Intergenic
1010420534 6:75669483-75669505 AAATACCTTTAGAAGGATAATGG + Intronic
1010480314 6:76344177-76344199 ATATACCTATAGAAAAACTATGG + Intergenic
1010897712 6:81385360-81385382 ATATTGCTTTTGTAGAACAAGGG - Intergenic
1011445071 6:87430113-87430135 AAATTCTTTTAGAACAACACTGG - Intronic
1011974078 6:93271274-93271296 ATTTTTCTTTAAAAAAACAAAGG + Intronic
1012002412 6:93669283-93669305 ATATTGCTTTGGAAGAAAAGTGG + Intergenic
1012740489 6:103010044-103010066 ATATACGTTTAGATGTACAATGG - Intergenic
1013169766 6:107626164-107626186 GTATTGGGTTAGAAGAACAAAGG + Intronic
1013434235 6:110085684-110085706 AAATTCATTTGGAAGAATAAAGG + Intergenic
1014077679 6:117255224-117255246 AAATTTCTTTAGTAGAGCAAAGG - Intergenic
1014467127 6:121770301-121770323 ATATTCATATACAAGAGCAATGG - Intergenic
1014954963 6:127603385-127603407 ATATTACATTAACAGAACAAAGG - Intergenic
1015417539 6:132966876-132966898 CTGTTCCTTTTGAAAAACAAAGG - Intergenic
1016287625 6:142490875-142490897 ATATTCCATTAGAAGCCCAGAGG + Intergenic
1016342383 6:143077565-143077587 ATATGCCTTTAAGAGCACAATGG - Intronic
1016886566 6:148964864-148964886 GTAGTGCTTAAGAAGAACAAAGG + Intronic
1017286727 6:152684587-152684609 ATATTGCTTTAAAAAAAAAAAGG - Intergenic
1017912975 6:158810682-158810704 TTTTTCCTTGAGAAGACCAATGG + Intronic
1018380173 6:163251904-163251926 TTATTCCATTTGAAGAACCATGG - Intronic
1018467241 6:164059716-164059738 TTATACCATTAGAAAAACAAAGG - Intergenic
1022290072 7:28993148-28993170 ATTTTACTTTAGAAGAAGAAAGG - Intergenic
1022434568 7:30369798-30369820 AAATACCTGTACAAGAACAAGGG - Intronic
1022916517 7:34960831-34960853 ATATACCTTTATAATATCAAAGG + Intronic
1023284912 7:38608857-38608879 ATATTCCTACAGAAGAATTAGGG + Intronic
1023442580 7:40199532-40199554 CTATACTTTTAGAAGTACAATGG + Intronic
1023514267 7:40984952-40984974 GTATTCATTTAGAAGAACAAAGG - Intergenic
1024453171 7:49572633-49572655 ATATTCTTAAACAAGAACAATGG + Intergenic
1024815418 7:53263252-53263274 ATATTCCTTTGGGAGAAAAGGGG - Intergenic
1025480289 7:60974946-60974968 ATATTCCTTTAAATGAATATAGG - Intergenic
1026059010 7:67009635-67009657 ATATTCTTTTAGATTAATAATGG - Exonic
1026719078 7:72815407-72815429 ATATTCTTTTAGATTAATAATGG + Exonic
1028762721 7:94512363-94512385 ATCTTGCTTTAGAATAAGAAAGG + Intronic
1030633184 7:111917867-111917889 ATAATGCTGTATAAGAACAAAGG + Intronic
1031662203 7:124439136-124439158 ATATATTGTTAGAAGAACAAAGG + Intergenic
1031668106 7:124510498-124510520 ACATTCATATAGAAGATCAAAGG - Intergenic
1031884958 7:127236692-127236714 ATACTCCTTTAGAAAAAGGAGGG - Intronic
1032477303 7:132220747-132220769 AGATCCCTTTAGAAGAATGATGG - Intronic
1033894255 7:146052558-146052580 ATATTCCCTATGGAGAACAAGGG + Intergenic
1034356799 7:150457153-150457175 GTATTCCTTAAGGAGAACAAAGG + Intronic
1034519537 7:151608760-151608782 ATATACCTTTATAAGATTAAAGG + Intronic
1034519540 7:151608792-151608814 ATATTCCTTTATAAGATTAAAGG + Intronic
1034688636 7:152996231-152996253 ATATTCCTCTAGAAGAGGAGAGG - Intergenic
1035487021 7:159233989-159234011 AGATTCCCTCAGAAGAACCATGG + Intergenic
1036215411 8:6876174-6876196 CTATTCCTTTAAAAAAACATGGG + Intronic
1037386162 8:18344260-18344282 AGATTCATATAGAAGCACAAAGG + Intergenic
1037495418 8:19435837-19435859 ATATTCCTTTATAAGGATCATGG - Intronic
1038150095 8:24935421-24935443 ATATTCCTGTACAAGAACGTAGG + Intergenic
1041711727 8:60900520-60900542 AGATGCTTTTAGAAAAACAAAGG + Intergenic
1042006855 8:64190478-64190500 ACATTCCTAGAAAAGAACAAGGG + Intergenic
1042795112 8:72653346-72653368 CTATTCCTTGAGAAGAACCTGGG - Intronic
1042984593 8:74568984-74569006 ATCTATCATTAGAAGAACAAGGG - Intergenic
1043364306 8:79514341-79514363 ATATTACTTTGGAAAAATAAAGG + Intergenic
1043538648 8:81234219-81234241 TTCTTCCTTTTGAAGAACAGGGG + Intergenic
1044048597 8:87470433-87470455 ATATTTCTTAAGCAGAAAAAGGG - Intronic
1044336675 8:90992147-90992169 ATGTTATTTTAGAAGAAAAAAGG - Intergenic
1046001048 8:108421316-108421338 GTATTCCTTGAGAGAAACAAAGG + Intronic
1046341573 8:112864931-112864953 ATCTTCCTTTATAAAAACACAGG - Intronic
1046703375 8:117425330-117425352 AAATTCATATAGAAGAAAAAAGG + Intergenic
1046840099 8:118846838-118846860 AAATTCTTTTAGAGGTACAATGG - Intergenic
1047390819 8:124449607-124449629 ATATTCCTAAAGAAGACAAAGGG - Intergenic
1047476488 8:125236955-125236977 ATGTACCTTAAGTAGAACAAAGG + Intronic
1047561689 8:125993141-125993163 ATATTCCCTATGGAGAACAAGGG - Intergenic
1050435657 9:5607182-5607204 AAATTCCTATGGATGAACAAAGG + Intergenic
1050638743 9:7642311-7642333 ATTTTTCTTTAGAAGGCCAAAGG - Intergenic
1050740071 9:8809845-8809867 ATATTCCTGGTGAAGAATAAAGG - Intronic
1050868391 9:10533955-10533977 ATATTCCCTTAGAAAAAAATAGG - Intronic
1051055329 9:12978626-12978648 AAATTCCTTTACAAGAACATGGG - Intergenic
1051236839 9:15009638-15009660 ATGTTCCTTATGAAGAACATTGG - Intergenic
1054161704 9:61676291-61676313 ACATTCTTTTTGTAGAACAAAGG + Intergenic
1055143956 9:72909952-72909974 AATTTCCTTTGGAAGAAGAAAGG + Intronic
1055848124 9:80592476-80592498 ATATTCCTTTTGGATTACAAAGG + Intergenic
1056052186 9:82780666-82780688 AAATTCTTTTGGAAGAACATGGG - Intergenic
1059622034 9:116016647-116016669 ACATTCCTTGAGGAGAACATGGG - Intergenic
1061437496 9:130574549-130574571 ATTCTCCTTTAGAAGACCGAAGG - Intergenic
1203370630 Un_KI270442v1:300555-300577 ATAATGCTTCAGAAAAACAAAGG - Intergenic
1185956233 X:4494056-4494078 ATAATTTTTAAGAAGAACAATGG - Intergenic
1186014755 X:5178861-5178883 ATTTTGGTTTAGAAGAAGAAGGG - Intergenic
1186225266 X:7392316-7392338 ATATTCCTTTACATGACCAAAGG + Intergenic
1186602442 X:11052544-11052566 ATTTTCCTTTAGAACCATAAAGG + Intergenic
1187099177 X:16174375-16174397 AAATTCATTCAGAAGTACAAGGG + Intergenic
1187402462 X:18973897-18973919 ACAGTCCTTTAGGAGAAAAAGGG - Intronic
1187652486 X:21424197-21424219 ATATTCCTTTAGAAGATTACAGG - Intronic
1187954180 X:24499615-24499637 ATGTTCCATAAGAAGAACTAGGG + Intronic
1188534549 X:31182159-31182181 TTATTCCTTTAGAAGTTCACTGG + Intronic
1189111746 X:38297830-38297852 ATATTTCTTTTGAAGTAAAAAGG - Intronic
1192896774 X:75451529-75451551 ATATTACTTTTGAAGATCAATGG - Intronic
1193093864 X:77526227-77526249 CTATTCCCTTAGAAAAAAAAAGG + Intronic
1193994362 X:88346063-88346085 ATATTCCTTCAGATGAAAACAGG + Intergenic
1194075237 X:89383462-89383484 ATATTCAATTATAAGAAGAATGG + Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1194629372 X:96264819-96264841 AAATTCCATTAGATCAACAATGG + Intergenic
1194790534 X:98143435-98143457 ATATACTTTCAGAAGTACAACGG + Intergenic
1194989307 X:100528495-100528517 AATTTCCTTTAAAAGAAAAAAGG + Intergenic
1196029640 X:111082601-111082623 ATGTTACTTTGGAAGAAGAAAGG + Intronic
1196792872 X:119480126-119480148 AGATTACTTTAGAAGTACAGAGG - Intergenic
1197616482 X:128697662-128697684 AAACTCCTTAAGAAAAACAACGG + Intergenic
1197829833 X:130629862-130629884 ATATTCCATTTGGAGAACAGTGG - Intronic
1197948398 X:131865952-131865974 ATAATACTGAAGAAGAACAAAGG - Intergenic
1198223023 X:134620290-134620312 ATATTTTTGTAAAAGAACAATGG - Intronic
1199457693 X:148047552-148047574 AAATGCCTCTAGAAGAACACTGG + Intergenic
1200730835 Y:6737619-6737641 ATATTCAATTATAAGAAGAATGG + Intergenic
1200812215 Y:7498114-7498136 ATTTTGCTTTAGATGACCAATGG + Intergenic
1201665601 Y:16450107-16450129 ATTTTGGTTTAGAAGAAGAAGGG + Intergenic