ID: 963345999

View in Genome Browser
Species Human (GRCh38)
Location 3:144097208-144097230
Sequence GCAGAACTGTCGGGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963345987_963345999 17 Left 963345987 3:144097168-144097190 CCTGAAGGCCATGATATAAAAAT No data
Right 963345999 3:144097208-144097230 GCAGAACTGTCGGGGGGGTGGGG No data
963345990_963345999 -10 Left 963345990 3:144097195-144097217 CCAAAAAATCAAAGCAGAACTGT No data
Right 963345999 3:144097208-144097230 GCAGAACTGTCGGGGGGGTGGGG No data
963345989_963345999 -7 Left 963345989 3:144097192-144097214 CCTCCAAAAAATCAAAGCAGAAC No data
Right 963345999 3:144097208-144097230 GCAGAACTGTCGGGGGGGTGGGG No data
963345988_963345999 9 Left 963345988 3:144097176-144097198 CCATGATATAAAAATGCCTCCAA No data
Right 963345999 3:144097208-144097230 GCAGAACTGTCGGGGGGGTGGGG No data
963345986_963345999 23 Left 963345986 3:144097162-144097184 CCTGAGCCTGAAGGCCATGATAT No data
Right 963345999 3:144097208-144097230 GCAGAACTGTCGGGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963345999 Original CRISPR GCAGAACTGTCGGGGGGGTG GGG Intergenic
No off target data available for this crispr